Chapter 1: percy becomes God
Chapter Text
we had a bonding moment! I cradled you in my arms!
PJ : im bored
TS : ok????
PJ : entertain me
TS : im working right now
PJ : damn guess i’ll get up and go find something myself
TS : NO
TS : percy if you move i swear to god
TS : there is a HOLE in your LUNG. ask fri to get something
PJ : :(
TS : don’t :( me
PJ : :(
---
we had a bonding moment! I cradled you in my arms!
PJ : [Image: Mrs. O’Leary is sitting on the couch patiently. She has neatly done pigtails in, and looks very happy]
TS : heh.
`TS: nice
---
we had a bonding moment! I cradled you in my arms!
TS : im going to call the kid. Invite him over to the labs at some point
PJ : good.
PJ : he seems like a good kid
TS : he is.
---
we had a bonding moment! I cradled you in my arms!
TS : was there fucking crack in those cookies
PJ : no?????
TS : cookies arent that good. Its not how life works
TS : it felt like crack
PJ : why do you know what crack feels like???
PJ : Tony?????
PJ : TONY?????
---
we had a bonding moment! I cradled you in my arms!
PJ: i almost suplexed your child
TS: what?????
PJ: i was in the garage. he was in the garage. I was unaware of who he was
TS: did you punch him?
TS: i swear to god
PJ: pffft no. where the trust?
TS: you spartan kicked a reporter yesterday.
PJ: they were fucking rude, tony.
TS: not the point. what did you do.
PJ: nothing!!
PJ: i just kinda looked at him for a second then left
PJ: no harm done
TS: ….
PJ: i can feel your judgmental squint from here
TS: good
PJ: you really like the kid, huh
TS: well
TS: yeah
TS: hes hella smart
PJ: thats not it
TS : ?
PJ : you actually like him as a person
PJ : i can tell
PJ : you’re gonna adopt him
TS : What?? No.
PJ : ooooh someones busting out the capital letters and punctuation
TS : how do you even know that?
PJ : fri
TS : ...ok. but im not going to adopt him, he already has a family and i dont need a kid
PJ : uhhhh huh. that’s why you anonymously donated to his school’s chemistry program
TS : how the shit did you know about that
TS : i just did that
TS : how
PJ : ;)
TS : mildly upsetting. anyways
TS : not my kid.
PJ : ooooh wait
[PJ has changed TS’s nickname to ‘Father of 5’]
PJ : :)
Father of 5 : wh
Father of 5 : why
PJ : peter, U, dum-e, butterfingers, and fri
Father of 5 : i still deny that
PJ : its a nice name! I worked hard
Father of 5 : ...you just learned how to do that, huh
PJ: mayhaps
Father of 5 : shouldn't you know technology? You are like 20
PJ : not my fault i never had a phone
Father of 5: i still think that is weird
Father of 5: thats like. the one thing someone your age should have
PJ: ‘someone my age’ shut up old man
PJ: im actually an eldritch being from centuries ago. I Know Everything.
Father of 5: ...that fact that i sort of believe that is a little concerning.
---
Father of 5: where the hell did you and mrs o’leary get matching pajamas
Father of 5: please i need to know
---
Father of 5: fri said you had a nightmare last night. You ok?
PJ : fucking snitch
PJ: yeah im fine.
PJ: ive had worse
Father of 5: i hate that
PJ: life do be like that sometimes
Father of 5: for fucks sake
PJ: a n y w a y s
PJ: spidey coming over today?
Father of 5: yeah
Father of 5: at 10:30
PJ: awful early time to make your child get up
Father of 5: he gets up early
Father of 5: and hes not my kid
PJ: your nickname begs to differ
Father of 5: oh for hell's sake
Father of 5: if i have to suffer, you do too
[Father of 5 has set PJ’s nickname to ‘crack dealer’]
crack dealer: what
Father of 5 : im still not forgetting those cookies
crack dealer: of course not.
---
we had a bonding moment! I cradled you in my arms!
crack dealer: hey where are you
crack dealer: nvm im coming down
---
Peter Parker and Tony Stark
Underoos : mr stark your friend is scary
---
we had a bonding moment! I cradled you in my arms!
crack dealer: ok im stealing your child now. going to go feed him lunch.
---
we had a bonding moment! I cradled you in my arms!
crack dealer: i think your kid just helped me track down a shooter
---
Peter Parker and Tony Stark
Underoos: ok i take it back his dog is cute
---
we had a bonding moment! I cradled you in my arms!
crack dealer: your son was very helpful
crack dealer: i can see why you adopted him. 10/10, gave lea good pets
Father of 5: not my kid
Father of 5: …
Father of 5: glad he could help, though
---
we had a bonding moment! I cradled you in my arms!
crack dealer: i have the power of god
Father of 5: why do i hear boss music
crack dealer: i have an idea
Father of 5: im already scared
---
[PJ has added Tony Stark and Peter Parker]
[PJ had changed their name to ‘God’]
God: told you
Tony Stark: are you really gonna pull the kid into this?
God: family bonding, tony
[Peter Parker has changed their name to ‘soup’]
soup:
hi????
Tony Stark: why soup?
soup: like soup
God: mood
God: like food….but can use straw
soup: mmm yes. swirly straw for soup
God: s̸̢͉̯̖̬͇̺͇̜͖̗͆̋̇̏̓̈̇̽̌͛̄̓̇̑ơ̸̧͙̣̣̜̤̹̤͕͐͋͒͑͂̋̋̏̊̈́̾̆͐̑̿̋͆̚u̴̢̧̱̰͍̫̻̣̲̲͈͚̝̮̠̤̜̞̣̩̐̉̒̾̋̐̇͗͑̋̅̈́̊̋̌̌́̉̄̔̾͂͜͝ͅp̸̧̧͕̠͍̝̰̦͔̈́̇̎̽̏̌̀̊̊̉̍̅͂̐̎̃͆͘͜͝
soup: finally someone Gets It
Tony Stark: what the fuck
Tony Stark: why does that cover other messages
Tony Stark: how did you do that
soup: we did nothing. twas but the power of s̸̢͉̯̖̬͇̺͇̜͖̗͆̋̇̏̓̈̇̽̌͛̄̓̇̑ơ̸̧͙̣̣̜̤̹̤͕͐͋͒͑͂̋̋̏̊̈́̾̆͐̑̿̋͆̚u̴̢̧̱̰͍̫̻̣̲̲͈͚̝̮̠̤̜̞̣̩̐̉̒̾̋̐̇͗͑̋̅̈́̊̋̌̌́̉̄̔̾͂͜͝ͅp̸̧̧͕̠͍̝̰̦͔̈́̇̎̽̏̌̀̊̊̉̍̅͂̐̎̃͆͘͜͝
Tony Stark: you two meeting was a mistake
God: your anti soup ways are tearing this family apart
Soup: mr stark :(
Tony Stark: …
Tony Stark: …
Tony Stark: dear god
Tony Stark: fine
Tony Stark: im just going to say it normally. s̸̢͉̯̖̬͇̺͇̜͖̗͆̋̇̏̓̈̇̽̌͛̄̓̇̑ơ̸̧͙̣̣̜̤̹̤͕͐͋͒͑͂̋̋̏̊̈́̾̆͐̑̿̋͆̚u̴̢̧̱̰͍̫̻̣̲̲͈͚̝̮̠̤̜̞̣̩̐̉̒̾̋̐̇͗͑̋̅̈́̊̋̌̌́̉̄̔̾͂͜͝ͅp̸̧̧͕̠͍̝̰̦͔̈́̇̎̽̏̌̀̊̊̉̍̅͂̐̎̃͆͘͜͝
Tony Stark: what in the fresh hell
Tony Stark: why did it do that
Tony Stark: what did you do
God: we did nothing. soup is just like that
soup: indeed
[God has changed the group name to ‘SSEA’]
soup: soup speed eaters association?
God: yeah B)
soup: nice B)
Chapter 2: Ned Gets Emplyoye
Summary:
Not a loser: peter. What did you do
Loser 1: ok so you know how we
Loser 1: like
Loser 1: looked up that Deathstroke guy
Not a loser: peter.
Loser 2: uh oh
Notes:
thanks to black_victor_cachat for some of these ideas!
edit: i cant believe that none of you fuckers told me i misspelled employed
(See the end of the chapter for more notes.)
Chapter Text
Judas!!!! no!!
Loser 1: ok dont be mad
Not a loser: what did you do
Loser 2: im already mad.
Loser 1: i said DONT be mad
Loser 2: you arent making this better
Not a loser: peter. What did you do
Loser 1: ok so you know how we
Loser 1: like
Loser 1: looked up that Deathstroke guy
Not a loser: peter.
Loser 2: uh oh
Loser 2: she sounds pissed
Loser 1: nobody got hurt
Not a loser: not helping. What. did. You. do.
Loser 1: ok so like
Loser 1: i was in the lab. Minding my own business
Not a lose: bullshit
Loser 1: i was!!!!
Not a loser: get on with it
Loser 1: ….
Loser 1: deathstroke came in. he said hi. I said hi. I pet his dog
Loser 2: P E T E R
Loser 1: i got a dog pic
Not a loser: you spent time with one of the worlds most deadly mercenaries?
Not a loser: his name is Deathstroke
Loser 1: ok but he was really nice!!!!!
Loser 1: he makes really good cookies!
Loser 2: damn now im jealous
Not a loser: what is wrong with you two
Loser 1: ~trauma~
Not a loser: fair
Loser 2: ok but
Loser 2: was he nice
Loser 1: yes actually
Loser 1: i helped him track down a shooter
Not a looser: what????
Loser 1: long story. Anyways
Loser 1: he said he liked my suit. Very nice colors
Not a loser: he knows you’re spiderman?????
Loser 1: ...yes
Not a loser: oh my god
Loser 2: why do i feel like there’s more
Loser 1: because there is
Loser 1: i can now proudly say i am in a group chat with mr stark
Not a loser: and deathstroke?
Loser 1: and deathstroke !
Not a loser: for fucks sake
Loser 1: no its ok. he likes soup
Loser 2: oh ok
Loser 1: ooh
Loser 1: i d e a
Loser 2: oh????
---
SSEA
[soup has added Michelle Jones and Ned Leeds]
[soup has changed Michelle Jones’ name to ‘mindiana jones’]
[soup has changed Ned Leeds’ name to gitc]
soup: :)
God: owo whats this
Tony Stark: never say that again
gitc: peter
gitc: is this what i think it is
soup: do you think its a groupchat with mr stark and mr deathstroke?
gitc: i think its a groupchat with mr stark and mr deathstroke
soup: then yes
mindiana jones: parker i swear to god
mindiana jones: mindiana? really?
Tony Stark: kid…
God: i thought it was funny
gitc: wait who are you
God: mr deathstroke, apparently
gitc: oh my god
gitc: im so sorry
mindiana jones: forget that. did you just owo
God: indeed i did, mindiana.
mindiana jones: you are deathstroke????
God: i prefer percy
gitc: your name is percy???
God: sometimes
Tony Stark: jackson for fucks sake
Tony Stark: stop messing with them
God: oh you think you’re all high and mighty, huh
Tony Stark: ?
God: with your boring ass nickname
God: but you know what
[God has changes Tony Stark’s nickname to ‘Tony Stank’]
Tony Stank: i see you have been talking to rhodey
God: what gave me away
Tony Stank: i regret meeting you
God: xoxo no you dont
Tony Stank: …
Tony Stank goddamnit
God: just be glad i didn't change your nickname to match the other one
Tony Stank: whatever crack dealer
God: :/
mindiana jones: you sell crack?
God: no comment
soup: i feel like this is going well
gitc: i dont even know anymore.
gitc: deathstroke owo-ed. life is a lie
God: there is no rule against mercenaries owo-ing
God: i know the law
mindiana jones: did you study law?
God: no i just commited a bunch of crimes
soup: valid
gitc: but you’ve never been caught???
God: oh sweet summer child
God: this was w a y before the mercenary thing
Tony Stank: wait what
God: i blew up a gym.
Tony Stank: WHAT
God: listen…
God: teenagers all make mistakes
God: not that though
God: that was on purpose
Tony Stank: what the fuck
soup: its ok i kinda broke a ferry on accident once
God: i did that once!
God: except it was a yacht
God: and also on purpose
mindiana jones: you really like blowing things up, huh
God: well yes
God: you see i met my best friend by blowing up a toilet
gitc: oh that's nice
God: yeah it was fun
gitc: was it on purpose, mr deathstroke?
God: actually no
God: it was either that or drink sewer water :/
mindiana jones: i see absolutely no correlation between the two
soup: yeah me neither
God: that's ok
Tony Stank: ……...alright
Tony Stank: ted please stop calling him mr deathstroke. I take hit damage every time it happens
gitc: but what do i call him
gitc: he has so many names
God: ?
gitc: uh
gitc: we may or may not have
gitc: looke you up a little
God: oh
God: did you see the bounty?
mindiana jones: yes
God: pretty sweet right
mindiana jones: sure?
Tony Stank: theres a bounty on your head?
God: yeah my cousins set it up
soup: well thats rude
Tony Stank: why? what did you do to them?
God: well
God: partially they were upset because i forcibly vaccinated them
God: but mostly so they would know who did it when i am inevitably murdered
God: and it was just easier that way
mindiana jones: how does that make things easier
God: that way i know whos out to get me
God: and i get them first (✿◠‿◠)
Tony Stank: …
Tony Stank: thats
Tony Stank: innovative? I guess?
God: thanks
God: hey wait ned
God: how long did it take you to find all that stuff on me?
gitc: uhhh like 20 minutes
God: are you serious
gitc: wait am in in trouble
God: no??????? It just
God: it only took you 20 minutes????
Gitc: ...yeah
God: ok
God: are you looking for a job
gitc: what
God: job. Do you want one
gitc: doing what?
God: some of my cousins are idiots who forgot to exist on paper
God: and now im getting the youngest one a fake identity for her birthday
Tony Stark: wtf your family is so weird
God: oh tony
God: this is NOTHING
gitc: a job sounds great???????
soup: awww good for you ned.
soup: going to work for the scary murder man
mindiana jones: child labor laws are a thing that exist
God: eh
gitc: eh
God: ive been paid to kill people since i was 12
God: and look at me now
Tony Stank: percy what the hell
Tony Stank: are you ok???
soup: wait 12?
mindiana jones: mildly concerning
God: well
God: i was exaggerating
Tony Stank: oh thank god
God: i wasnt getting paid
Tony Stank:
soup:
gitc:
mindiana jones:
Tony Stank: i worry about you
God: the feeling is mutual
gitc: wait how would i get paid? Dont i have to like. Do something with taxes?
God: no
God: i have never paid taxes my entire life
Tony Stank: what
Tony Stank: percy
God: taxes are for rich people
mindiana jones: yeah thats fair
Notes:
hazel and nico set the bounty up, btw. percy's cousins who 'forgot to exist on paper' are like. all of them.
2 cousins from the past, 1 raised by wolves, and 1 was a tree. so.
Chapter 3: An Environmentally Friendly Dictatorship
Summary:
peter gets bonked, mj and percy plot
Notes:
thanks to black_victor_cachat and mayaellise for some of the ideas
(See the end of the chapter for more notes.)
Chapter Text
soup: mr starbk i think i jit my hef
Tony Stank: what
soup: bonmk
mindiana jones: karen says he hit his head
gitc: hes not bleeding out
Tony Stank: not promising
gitc: a Small Concussion
Tony Stank: peter
soup: yesh ?
Tony Stank: come to the tower
soup: i toootaltly would
soup: but i domnt kniw where i a m
Tony Stank: for fucks sake
Tony Stank: ted where is he
gitc: rooftop on Knowlers and 8th
Tony Stank: im in a meeting right now. Pepper will kick my ass if i leave
Tony Stank: percy
Tony Stank: @God
God: what
God: oh
God: yeah ill get him
soup: oooooh
soup: mr tall mans is gunna gett me
mindiana jones: …
mindiana jones: are you actually that tall?
God: no
God: im actually the shortest on my dad’s side. My little brother is like twice my height
gitc: how tall are you???
God: 6
gitc: 6?
God: yeah it was 6
mindiana jones: im assuming 6 feet. how old is your brother?
God: not completely sure. I found him in a cardboard box, you see
God: like. 8?
Tony Stank: there are so many things wrong with what you just said
Tony Stank: also you’ve never mentioned a brother???
God: i have so many…
God: also yeah he lives underground
gitc: wh
gitc: like in the sewers
God: no
gitc: ok
Tony Stank: are you almost there?
God: yeah
God: found him
soup: hnnfdg beeg dog
mindiana jones: ??
God: hes sitting on my dog. she’s taking him to the tower
mindiana jones: and you think people just arent going to question why spider-man is getting a ride from a dog(?) with deathstroke walking behind them
God: nah
God: trust me on this
gitc: sure . why not
soup: doggyyie
Tony Stank: thank you for your contribution, peter.
soup: : )
----------
Tony Stank: i just found out coca cola can remove rust from stuff
Tony Stank: imagine what its doing to peoples bodies
God: pfftt getting rid of the rust, idiot
Tony Stank: thats not how that works
God: ive been drinking soda…...my body is rust free…..not sure where you’re getting your facts from
Tony Stank: no
mindiana jones: no he’s right
Tony Stank: you go to a science school
Tony Stank: what are they teaching you
gitc: right now?
gitc: global warming and stuff
mindiana jones: except our teacher is very much ignoring the fact that most of pollution comes from large corporations :/
God: yeah, it was the same at all of my schools. a lot of kids parents were business people, so. school didnt want to upset them
mindiana jones: its not that bad at midtown, but the principal did try and stop me from organizing a school protest
gtic: she ended up staring him down. It was amazing
God: hm
God: if you want to get more involved without the school getting in your way
God: call this number
God: ***---***---****
gitc: thats not sketchy at all
God: its just my friend grover. He runs the new york environmental association
mindiana jones: grover underwood?????
God: yeah!!!
mindiana jones; you know him?
Tony Stank: please tell me you didnt try and kill him
gitc: or that he hired you to kill someone
God: he would never. Ive offered, but
God: he’s been my best friend since the 6th grade where he broke into my cabin with no pants on, passed out, and then i dragged him to safety after i fought a bull
Tony Stank: why do you always say things like this
God: i have no idea what you mean
God: but dont call that number from your own phone. Use a payphone, or someone who you dont like’s phone
God: tell him percy jackson sent you, and the code word is enchilada
mindiana jones: alright seems legit
Tony Stank: i am very concerned right now
God: what???? He’s an environmental activist, not a terrorist
God: though i do know a few of those if you need one
gitc: great
gitc: wait i just looked him up
gitc: grover underwood is suspected for stealing animals from aquariums and sabotaging Dare Enterpises facilities
God: hah
God: yeah
Tony Stank: ok to be fair william dare sucks ass
God: yeah i met him a couple times
God: he liked me well enough, though
mindiana jones: what?
God: i was staying at his house
Tony Stank: why the fuck
God: im friends with his daughter
mindiana jones: you know rachel dare????
God: yeah who do you think helped her plan the Sea World heist
mindiana jones: it was YOU????
Tony Stank: you stole a fucking whale?
Tony Stank why am i not surprised
gitc: holy shit
gitc: thats so cool
God: yeah the three of us plus my cousins hunting club plan to take over the oil industry within the next 10 years
mindiana jones: wow
mindiana jones: im in
God: cool
Tony Stank: im a little scared but
Tony Stank: carry on
mindiana jones: >:)
God: >:)
----------
Tony for fucks sake go to sleep
Honeybear: why did i just see on the news that a Dare Enterprise facility just got destroyed
Honeybear: and WHY do i feel like you had something to do with it
Dumbest genius: i did nothing of the sort
Honeybear: ….
Dumbest genius: except look the other way
Honeybear: tones for fucks sake
Dumbest genius: at least it will be an environmentally friendly dictatorship
Honeybear: what????
Notes:
percy did mission impossible but with fish. i take no critisism
ok guys the 'soup' thing at the bottom. do you see it too??? i cant get rid of it. the power of soup
Chapter 4: Flash Thompson's In BIG Trouble
Summary:
Tony Stank: all of my money will be going to keeping me out of jail
Tony Stank: because i will have committed aggravated assault
soup: DO NOT
Chapter Text
SSEA
God: Tony’s fine. No need to worry.
soup: what happened
God: bomb :/
mindiana jones: what?????
God: we were in the building. There was also a bomb in the building.
gitc: alright then
soup: but mr stark got hurt?
God: a Small concussion.
God: he’s very whiny
soup: so what im hearing is the two of us match head injuries
God: yeah basically
soup: did you guys get rumlow?
God: yeah hes fucking dead
gitc: oh my god????
God: no dont worry it was on purpose
mindiana jones: wait like. You killed him?
God: he tried to shoot tony i have no regrets
God: we fought to the death in a basement
gitc: did you get hurt?
God: eh. I spent 8 months wrestling wolves in california. Ill live
mindiana jones: the fact that i cant even tell if you’re joking anymore---
God: :)
God: anyways
God: tony’s asleep right now so im going to do what i want
soup: what does that mean
soup: percy
soup: PERCY????
--------
SSEA
soup: one day im going to kill him i swear to god
Tony Stank:
woah woah woAH WOAH
Tony Stank:
kiddo?
soup: wrong chat
soup: ignore that
God: i can hide a body
Tony Stank: NO
Tony Stank: NO murder.
God: uhhhhhgg
God: you never let me have fun
Tony Stank: people die when you have fun
God: :(
Tony Stank: anyways
Tony Stank: you alright, underoos?
soup: yeah im fine
mindiana jones: liar. flash dumped his lunch tray on him today
soup: mj!!
soup: its was nothing, mr stark. promise.
Tony Stank: too late
Tony Stank: who the HELL is flash
soup: nobody
gitc: flash thompson. he’s an asshole to peter all the time. its been going on for like 3 years
soup: NED
soup: betrayed by my own friends….unbelievable.
gitc: he needed to know
gitc: im sorry dude
mindiana jones: im not
Tony Stank: peter
Tony Stank: 3 years?
soup: its nothing. I barely even notice it anymore
Tony Stank: that's even worse
Tony Stank: has any of it been reported?
mindiana jones: yes. most of the time there’s no evidence
gitc: and other times he just gets off really easy. his parents make a lot of donations to the school
Tony Stank: so what i'm hearing is
Tony Stank: i just need to out-donate this dumbass’s parents
soup: no!!!!
soup: do not!
soup: i can handle it, mr stark
soup: if its not me, its going to be someone else who cant take it
Tony Stank: just because you can handle it doesn't mean you should, kid.
mindiana jones: i've been trying to tell him that for almost a year
soup: he barely even touches me. I’m fine. Seriously.
Tony Stank:
Tony Stank:
gitc: uh
gitc: mr stark
gitc: are you alright?
Tony Stank: He hits you?
gitc: uh oh
gitc: full capitals and punctuation
soup: not usually
mindiana jones: he shoves him into lockers like all the time. I’ve seen the bruises on his shoulders and back.
soup: MJ!
mindiana jones: he needs to know. Still not sorry.
Tony Stank: ok so im not going to out-donate his parents to make him stop bothering you
soup: thank you
Tony Stank: all of my money will be going to keeping me out of jail
Tony Stank: because i will have committed aggravated assault
soup: DO NOT
gitc: no its ok
gitc: he hits you, peter.
soup: im spiderman!
soup: i can take a hit
soup: and i shouldn't be punching my classmates. I'm a superhero!
Tony Stank: well i'm an avenger
Tony Stank: and i kicked a justin hammer in the nuts once
soup: well he’s evil
Tony Stank: no this was before we knew about that
Tony Stank: he was just an asshole
mindiana jones: hell yeah
mindiana jones: i've always hated that guy
Tony Stank: you can't stop me
Tony Stank: and really
Tony Stank: i'm not the one you should be worrying about
soup: what do you mean?
Tony Stank: dearest pj has been rather silent
gitc: uh oh
soup: oh no
God: lucky for us. i am not above murder OR clotheslining a teenager
God: <3
soup: percy. do nOT
mindiana jones: eh as long as he doesn't kill him
Tony Stank: don't track blood in the tower
soup: no!!!! No blood!!!
Tony Stank: yeah
Tony Stank: none in the tower
soup: no blood in GENERAL
soup: because you should NOT hurt flash
soup: percy???
gitc: pretty sure he’s already on his way, dude
mindiana jones: everything will be fine
soup: not for flash!!!!!
mindiana jones: everything will be fine.
soup: percy?????
God: [Image description: Percy is crouched on a roof in full gear, except for his helmet. Only his head and shoulders are visible, and you can see the swords strapped to his back. He is smiling, and giving a peace sign to the camera.]
God: see you on the news
Tony Stank: be home before 8
soup: is that flash’s neighborhood
soup: please tell me it isn't flash’s neighborhood
gitc: i'm pretty sure he’s standing on his roof, dude
soup: how did you get there so fast????
mindiana jones: pretty sure he’s a little too busy to respond to you, peter.
soup: aw, beans.
Notes:
and we never heard from flash again. the end uwu <3
Chapter 5: Peppers And Bread
Summary:
the AcDec kids make their first appearances!
Chapter Text
Mr Harrington please stop sending memes challenge
peterman: i feel like a dried pretzel crumb and the only way to combat that is the shove my head into a bowl of hot lima beans
President lincoln: hi what the fuck
peterman: you heard me
nedleedle: peter i love you but why
Scary Captain: parker i swear to god
peterman: leave me alone !!!!
moonmoon: no no let the man speak
moon moon: hes onto something
peterman: thank you CINDY
The news(™): pete are you alright?
peterman: just dandy
peterman: i mean im throwing up into a toilet for the 4th time but
President lincoln: what happened?
Peterman: jal a pe no s
The News(™): translation please
moonmoon: you ate a bunch of peppers?
peterman: yeth
peterman: at the expense of my own morality
Scary Captain: the the fuck did you do that for
avril lavigne: are you alright?
peterman: am fine
peterman: im being laughed at though
Scary Captain: i guarantee you deserve it
nedleedle: peter were you serious about that
avril lavigne: about what?
nedleedle: he texted me asking if i thought he could beat pj in a pepper eating contest
murphy’s law: excuse me what is a pj
nedleedle: the scariest man alive
peterman: he works for mr stark at my internship
fastest man alive: parker for fucks sake stop with the internship
fastest man alive: nobody believes you
---------
Rowdy boys
Small™: hey flash is talking shit
Jalapeno eating king: on it
-------
Flash Thompson --- Unknown Number
Unknown Number: watch your mouth
-------
Mr Harrington please stop sending memes challenge
Fastest man alive: ok im sorry i take it back
moonmoon: wha
avril lavigne: whoa
President lincoln: what just happened
peterman: ;)
The News(™): very threatening i like it
The News(™): but whats with the jalapenos
peterman: well you see
peterman: my dearest friend pj and i were watching this video of a guy eating a ghost pepper
peterman: and he went “pft i can do better than that”
peterman: and i challenged him
peterman: but we only had jalapenos so
Murphy’s law: this sounds fabricated
peterman: i have Never Lied Ever
Murphy’s law: i demand an audience with this so called spice god
peterman: adsfdgjrthtfd
nedleedle: on it
[nedleedle has added PJ to the chat]
[PJ has changed their name to ‘spicey’]
moonmoon: hello peter’s mystery friend
Murphy’s law: we have Questions
spicey: hm
spicey: ask away
The News(™): did you or did you not eat a bunch of jalapenos with peter
spicey: yes i did
The News(™): who won
spicey: me obviously
spicey: i ate all of my peppers and then all of peters once he left to go throw up
President lincoln: you didnt go to help peter??
spicey: no i was eating jalapenos
spicey: if i didnt my dog would
spicey: and im not letting that happen for a 6th time
nedleedle: 6th???
spicey: yeah
nedleedle: ok
Scary Captain: how many peppers did you two eat?
spicey: well peter had like 12
Murphy's law: peter oh my god
peterman: and pj had over 300
moonmoon: yo what the fuck
avril lavigne: what is wrong with you
spicey: i think im going to go for an even 1000
President lincoln: ARE YOU STILL EATING THEM???
peterman: yes i can confirm
peterman: he’s sitting with me on the bathroom floor just eating them out of a grocery bag
Murphy’s law: wait i just did the math
Murphy’s law: about 960 jalapenos will kill you
Murphy’s law: do NOT go for 1000
spicey: no its fine i drank laundry detergent as a kid and now my blood is toxic
The News(™): i
The News (™): ok then
Scary Captain: he can do it trust me
moonmoon: whats this????
moonmoon: michelle jones putting faith in someone????
Scary Captain: well i actually like pj. he’s punched a cop in the face
spicey: dont forget i stole a cop car
Scary Captain: he also stole a cop car
moonmoon: good for you…..good for you
President lincoln: do any of you know where tyler grayson is?
Avril lavigne: im in english with him right now why
President lincoln: i decided to not let my feet touch the hallways this month
President lincoln: so every day i have been bringing a skateboard to school
The News(™): you know how to skateboard?
President lincoln: no
President lincoln: and thats why i hired tyler to pull me around using a jump rope while i t-pose to instil fear amongst my enemies
nedleedle: icon
President lincoln: i know but where’s tyler
avril lavigne: he said he’s going to be late because he got streamers to attach to your skateboard
President lincoln: hm
President lincoln: alright i can accept that
peterman: what color streamers
avril lavigne: rainbow and shiny
peterman: oh hell yeah
moonmoon: stylish
-----------
SSEA
Tony Stank: which one of you fuckers ate all of the bread
gitc: ?
Tony Stank: there were like 5 loaves
Tony Stank: they are all gone now
soup: would you be less angry if i told you it was for science
Tony Stank: i would not
soup: forget i said anything then
Tony Stank: peter what did you do
soup: nothing!!!
Tony Stank: percy?
God: i wasnt there
God: my friend piper and i are in my cousins attic right now
God: we’re making hissing noises and suspicious scuttling to try and convince him we’re raccoons
God: we want to see if we can get him to call animal control
Tony Stank:
Tony Stank: alright good luck
God: thanks
Tony Stank: mj? ned?
gitc: peter im sorry
soup: ned no!!!!
gitc: you know i cant lie to him
soup: betrayal…….from my own guy in the chair…..
gitc: we wanted to see if peter can eat enough carbs to become immune to bullets
Tony Stank: you fucking ate all that bread
Tony Stank: wait IMMUNE TO BULLETS
Tony Stank: do not test that. Peter parker i swear to god
soup: …….
Tony Stank: stay where you are
Tony Stank: im already on my way
Notes:
if any of you have funky ideas for this please drop them in the comments being funny is hard
also does anyone here know how to put a photo into ao3???
edit: guys i figured out the photo thing. the photo above is in NO WAY related to the story. i just liked it.
Chapter 6: baby avenger :)
Summary:
finally some demigods content !
Notes:
(See the end of the chapter for notes.)
Chapter Text
Judas!!!! No!!
not a loser: where the fuck are you two?
Loser 1: well
Loser 1: uh
[Loser 2 has changed Loser 1’s nickname to ‘one hit KO’]
one hit KO: n e d
not a loser: what did you guys do???
Loser 2: well,,,,,,you see
not a loser: holy shit
not a loser: i just saw flash leaving morita’s office with a bloody nose
not a loser oh my god i think its broken
one kit KO:
Loser 2:
not a loser: oh you FUCKERS
not a loser: I CANT BELIEVE YOUVE DONE THIS
one hit KO: we’re sorry!!!!!!!
Loser 2: it wasnt planned or anything i swear
Loser 2: it just
Loser 2: happened
not a loser: and what, pray tell, actually HAPPENED?
one hit KO: flash started talking shit and i gave him what was coming to him
Loser 2: 0-0
not a loser: wow
not a loser: i mean i love the bloodthirstiness but
not a loser: peter where the HELL did that come from
one hit KO: percy gave me a pep talk (✿◠‿◠)
not a loser: yeah that sounds exactly like him
not a loser: how much trouble are you guys in?
Loser 2: both suspended. flash was hella close to getting expelled, though
Loser 2: and thats not even the best part
not a loser: can it really get better than that?
Loser 2: yep!
Loser 2: so basically may was working and couldnt come get peter, so his ‘brother’ came in. and we were all like tf? Brother?
Loser 2: Then BOOM it was percy fucking jackson
not a loser: no shit?
one hit KO: yeah it was wild
one kit KO: he had a fake identity with a doctorate and everything
Loser 2: then he intimidated a confession out of flash and convinced my mom to come with him and peter to get ice cream
Loser 2: my mom actually likes him a lot??? they're talking about seagulls.
one hit KO: its been going on for like 15 minutes
not a loser: wack
---
we had a bonding moment! I cradled you in my arms!
crack dealer: and then i pushed him down a well
Father of 5: huh
Father of 5: is that how all of your grocery trips end?
crack dealer: yeah usually
Tony Stank: good to know
---
Preator Party
pecan pie: hey have any of you seen hazel????
punch: I am also looking for her.
panda: not since our lunch date
pecan pie: perce?
puddle: mcdonalds roof with me and nico
panda: may i ask why there?
puddle: frank i love you but
puddle: no you may not
punch: Please tell her she cannot run from her Centurion duties. There is a Senate meeting soon.
puddle: she says “tell reyna i know and thats why im hiding”
pecan pie: oh gods
pecan pie: can you bring her back please?
puddle: hmmmmmmmMMMMMMMMM
pecan pie: cmon bro. for me?
puddle: for you bro <3
pecan pie: bro <3
punch: Disgusting.
---
our family tree is a wreath
horse girl: percy jackson prepare to die
sparky: oh????
horse girl: you too, jason. I know he wouldn't do it unless you asked.
pied piper: wait what the shit happened
horse girl: i may or may not have been running from a senate meeting
horse girl: and nico invited me to hang out with my dearest older brother figure
horse girl: so we were on a roof, right
horse girl: but then stuPID JASON AND REYNA TEXTED HIM TO BRING ME BACK
my chemical ron weasley: it was pretty brutal
mcshizzle: nico??? explain????
mcshizzle: and wow hazel. tone down the language please.
horse girl: sorry i am just VERY ANGRY
my chemical ron weasley: she tried to run
my chemical ron weasley: a fatal mistake.
sparky: percy??? what did you do?
has a buzzfeed unsolved episode: well you see
has a buzzfeed unsolved episode: i just so happened to have come directly from work :)
my chemical ron weasley: next thing i knew he was grabbing a duffel bag and
horse girl: HE FREAKING TRANQ-ED ME
horse girl: HE PULLED OUT AND ASSEMBLED A RIFLE WHILE I RAN FOR MY FREEDOM
horse girl: AND SHOT ME
my chemical ron weasley: it was terrifying. he did it all so fast
pied piper: P E R C Y
sparky: BRO
has a buzzfeed unsolved episode: and i’d do it again
my chemical ron weasley: she was like half a block away-
RARA: You shot Hazel with a tranquilizer dart from half a block away?
RARA: Impressive.
has a buzzfeed unsolved episode: :)
---
SSEA
Tony Stank: hey percy? :)
God: yes tony? :)
Tony Stank: why the fuck did i just get a notification from fri that one of our satalites got footage of you chasing and shooting somebody from a mcdonalds? :)
mindiana jones: that smiley face looks like its screaming inside
God: oh, that
Tony Stank: yes, THAT
God: i was hanging out with my cousins
God: and two of my friends texted that one of them, hazel, was in fact hiding from a Very Important Responsibility
God: and they requested i bring her in
gitc: so…..you SHOT her??????
God: with a tranquilizing dart, yes
soup: oh wow
mindiana jones: cool
Tony Stank: is your cousin ok????
God: yeah of course
God: besides she almost killed the earth when she was like 13 so
God: she can handle it
Tony Stank:
Tony Stank: ok.
---
SSEA
[God has changed soup’s nickname to ‘baby avenger’]
God: they grow up so fast :,)
gitc: ???????????
Tony Stank: spiderbaby has joined the avengers jr. reserves
gitc: !!!!!!!!!!!!!!
baby avenger: :D
mindiana jones: good job, peter.
baby avenger: love you to mj!!! <3
mindiana jones: …
mindiana jones: …<3
gitc: hoLY SHIT
gitc: MJ USED A <3
mindiana jones: shut up or ill take it back
God: we’re proud of you for expressing your emotions, mj.
mindiana jones:
mindiana jones: thank you percy
Notes:
mj using a <3 is something that can be so personal-
and yes the preator party is just reyna, jason, frank, and percy. i chose to Ignore some canon. currently reyna and frank are the preators.
Chapter 7: He's a war criminal, Barbara.
Notes:
ok so i know you guys are ready for the sequel. but. im not. i also have a bunch of little oneshots written---stuff that didn't make it into The File, or stuff on Percy's past that I changed. (With SHIELD, missions, tartarus, etc.) i was thinking of just posting a collection of them. the timeline would be all over the place---some stuff pre-canon, some during The File, some inbetween The File and the Unnamed Sequel. Nothing super important for the plot moving on, but. if you guys want it?
also SnufflesThePig this is for you <3
CHAT NAMES:
crack dealer/God: percy
gitc: ned
baby avenger: peter
mindiana jones: mj
father of 5/tony stank: tony
(See the end of the chapter for more notes.)
Chapter Text
Coolest Intern @peterparkour
900K Followers | 105 Following
You Know Who I Am @TonyStark
425.7 Mil Followers | 32 Following
nick fury @12yearoldterrorist
623.1 Mil Followers | 1 Following
Coolest Intern @peterparkour
the internet doesnt get to see the weird stuff that goes around the tower daily and i am very sorry for that
Coolest Intern @peterparkour
like??? y'all actually respecting these people
Frogsareneat @littlegreenboy
What??? Does this mean????
Coolest Intern @peterparkour
it MEANS that the avengers are all meme loving disasters. all of them. they are so weird.
merp @lowla
ok so you guys know that avengers intern account right
weenie @cissiesmith
The one just called the avengers memers????
merp @lowla
thats the bitch. anyways.
merp @lowla
What do you guys think he MEANS????
mossboy @localfungi
if he tells me thor knows vines ill cry i swear to god
Mindy @mindyydnim
Ok but you guys just believe him???? Hes probs lying
astrology, hoes @starcharts
Shut the fuck up i would trust him with my life
SSEA
gitc: hey mr stark?
gitc: is nick fury alive?
mindiana jones: is this about the twitter account?
gitc: YES THIS IS ABOUT THE TWITTER ACCOUNT
Tony Stank: what are you talking about?
baby avenger: ill send you the link
SSEA
Tony Stank: i
Tony Stank: he’s alive but. I have no clue if this is him or not
Tony Stank: im going to follow him
You Know Who I Am @TonyStark
425.7 Mil Followers | 34 Following
ferris wheel fighter @uhov4hiorei
uh hey guys???? am i having a reaction to my meds or did tony stark just follow that intern kid AND the cryptic nick fury account???????
Turtleducks @duckys<3
HE DID WHAT THE FUCK
astrology, hoes @starcharts
PB DESERVES IT HES THE BEST INTERN
astrology, hoes @starcharts
that nick fury account is just mad funny though
Pepper potts marry me challenge @deno
Is that the actual nick fury???????
merp @lowla
Nick fury does NOT run a crytpid conspiracy meme account. I refuse to believe.
merp @lowla
Hes also dead but thats not the weird part
chiecken @bord
tstark only follows people he knows?????? Plus a few charities and shit
chiecken @bord
And the nick fury account is an Experience but its not a charity. That means it HAS to be nick fury himself
I feel like a sad rug @woooooo
i am Confused
ferris wheel fighter @uhov4hiorei
Dude check out the account its @12yearoldterrorist
nick fury @12yearoldterrorist
623.1 Mil Followers | 1 Following
nick fury @12yearoldterrorist
I once defeated a peacock because it looked at me funny. I hissed at a gargoyle and it shattered into dust. I eat nails for breakfast and strawberry milkshakes for lunch. dont try me
nick fury @12yearoldterrorist
an amendment: unless you’re captain america. please try me so i can effortlessly defeat you in hand to hand combat.
nick fury @12yearoldterrorist
poll: hey guys should i or should i not dump this catcaller in the bay
Decimate him : 83% | same answer but over here: 63%
nick fury @12yearoldterrorist
hey google how much paper can i eat before dying
I feel like a sad rug @woooooo
this guy is fucking crazy, i love it
I feel like a sad rug @woooooo
He literally has more followers than the president
Turtleducks @duckys<3
are we going to ignore how the poll somehow got higher than 100%??? My mans got 146% of votes. what.
suspiciously round dog @ORB
he(?) issues public threats to captain america.
weewonk @weewonk
Ive never loved a man more
Babs @BarbaraLewis
This man is threatening an American icon! This isn’t funny, or a joke!
I feel like a sad rug @woooooo
he’s a war criminal, barbara.
astrology, hoes @starcharts
Manifesting that the nick fury imitation(?) account tracks down and defeats captain america
Trending:
#he's a war criminal, barbara
#stark clean energy
#met gala
#mr. fury please duel him
#sokovia accords
SSEA
Tony Stank: it sounds NOTHING like fury but the security is so good?? an imitation wouldnt have that kind of firewalls
gitc: should i try hacking it?
Tony Stank: ...no. No, i want to see how this plays out.
nick fury @12yearoldterrorist
due to popular demand, i will be fighting steve ‘bitchass’ rogers. swords at dawn, coward.
Frogsareneat @littlegreenboy
GUYS HES FUCKIN DOING IT-
merp @lowla
HE RESPONDED ASDJGSDLHFJ I FEEL LIKE I JUST SPOKE TO MOTHMAN
ferris wheel fighter @uhov4hiorei
Captain america is shaking in his boots
we had a bonding moment! I cradled you in my arms!
Father of 5: this is going to sound weird but
Father of 5: would fury have social media?
crack dealer:
crack dealer:
crack dealer: what
Father of 5: hypothetically, of course
crack dealer: i have no idea?????
crack dealer: the only time we talked was when he sent me on a mission or yelled at me
Father of 5: hmm
Father of 5: thanks anyways
crack dealer: why do you ask?
crack dealer: tony?
crack dealer: tony????????
SSEA
God: i just got a vaguely threatening message from tony what happened
gitc: nothing
baby avenger: nothing
mindiana jones: nothing
Tony Stank: mind your own business.
Tony Stank: we’re investigating.
God: ?????????????????????
Notes:
the nick fury account idea came from one of you. i looked through like, ALL of the comments, but for the life of me i couldnt find who it was. if you are the genius who birthed this idea, please tell me.
edit: i figured it out, boys. lilithdcclxxvii, you have my eternal gratitude. genius.
Chapter 8: Family Reunion
Summary:
babey avenger: percy?
Tony Stank: he’s probably not on his phone right now. He’s at a family reunion
mindiana jones: like. his mom’s family, right?
Tony Stank: i sincerely hope so.
Notes:
a godly family reunion is something that is very funny to me
(See the end of the chapter for more notes.)
Chapter Text
SSEA
God has changed their name to ‘Godly buttkicker’
Tony Stank: is everyone really going to just ignore that name
mindiana jones: yeah
baby avenger: yeah
gitc: yeah
Godly buttkicker: yeah
Tony Stank: ok
---
Mr harrington please stop sending memes challenge
moonmoon: would you guys do the nasty with hawkmoth
nedleedle: why would you ask this. Right in front of god??
murphy’s law: would i w h a t
moonmoon: you know. The Nasty
moonmoon: cork the onion
moonmoon: dip the fondue
moonmoon: illegal breakdance
President lincoln: im begging you to stop
moonmoon: only if you answer the question
Avril lavigne: i would 100%
Murphy’s law: SALLY
Avril lavigne: what????? Have you seen that guy
president lincoln: dilf
murphy’s law: NO
moonmoon: thank you abe
moonmoon: @peterman @nedleedle @TheNews(™) @scarycaptian
peterman: what?
President lincoln: scroll up
peterman:
peterman: cindy are you alright
moonmoon: i will be as soon as all of you answer the question
nedleedle: he’s rich?
moonmoon: yep
nedleedle: then hell yes
The News(™): no bc i like adrien and his dad is a piece of shit
moonmoon: fair point
moonmoon: so to recap:
moonmoon: sally and abe would bc they think hes hot
moonmoon: ned would because he likes money
moonmoon: charles wouldn't because hes a party pooper
moonmoon: betty would not because hes a bad dad and doesn't deserve her
murphy’s law: i wouldn't do it because hes old ugly and mean!!!!!!
moonmoon: uh huh. Anyways. mj? Pete?
Scary Captain: No.
moonmoon:
moonmoon: ok have a nice day
peterman: i cant answer
Avril lavigne: booooo!!!!
Murphy’s law: we all had to answer !
peterman: yes but consider this:
peterman: i am babey
The News(™): hes got a point guys
President lincoln: yeah thats fair
ned-->peter
Peter: are you thinking what im thinking
Ned: 100%
SSEA
gitc: mr stark
gitc: percy
gitc: would you do the do with hawkmoth
Tony Stank: i worry about you kids sometimes
mindiana jones: but would you?
mindiana jones: im actually a bit curious
Tony Stank: no, i am cuter and richer than him
babey avenger: fair
babey avenger: percy?
Tony Stank: he’s probably not on his phone right now. He’s at a family reunion
mindiana jones: like. his mom’s family, right?
Tony Stank: i sincerely hope so.
Godly buttkicker: Photo Attachment
[Percy is standing in what looks like a giant field. A few temples high up on a far away hill can be seen in the background. He is posing with ten people---a girl with dark skin and curly hair, a pale boy in an aviators jacket, a punk-looking girl in silver, a blonde boy with glasses and a scar on his lip, a man wearing gold with a startlingly bright smile, an auburn haired woman with a bow on her back, a curly haired man wearing a UPS uniform, a man with a scowl and a buzzcut, a portly man holding a coke, and a burly man with leg braces]
Godly buttkicker: me and some of my first cousins!
mindiana jones: s o m e
Tony Stank: dear god
babey avenger: gods, actually.
gitc: all of those are gods except for the four we met right
Godly buttkicker: yep :)
gitc: ok then
Godly buttkicker: Video Attachment
[The cameraman is shakily holding a phone, laughing behind the camera. Percy is seen standing with a strong looking brunette girl wearing camo pants. They are in the middle of what looks to be the longest handshake known to man. The cameraman whispers into the microphone, now recognizable as Hazel:
Hazel: he and clarisse have known each other since they were 12. They do this every time they see each other. We’re about 4 minutes in so far.
The two do a fistbump and then a serious of handshakes and a clap
Percy: you are the ugliest person i’ve even met. you get worse every year. every time i see you i gag a little.
Clarisse: i have never met anyone more worthless or pathetic than you
They bump elbows and then knees, then continue on for half a minute.
Clarisse: Wait a damn minute, you little shit---
End of description]
Godly buttkicker: she falls for it every time. The last i remember of her face was when she was like fifteen.
babey avenger: that handshake inspires us all
gitc: pete and i will strive to do better
Godly buttkicker: pic with the fam :)
Godly buttkicker: [Photo attachment]
[It is an aerial view of a field jampacked with people. Seriously, it’s like a football stadium’s worth of people, standing shoulder to shoulder. There are so many people here. What the fuck.]
Godly buttkicker: most of the nature spirits werent able to make it, plus we didn't invite the super evil ones, so its not everyone, but we did our best
Tony Stank:
baby avenger:
mindiana jones:
gitc:
Godly buttkicker: im in the corner by most of the horses :)
Tony Stank: HORSES????????
mindiana jones: i have never considered the ramifications of the greek gods being real until now. I regret that deeply.
Godly buttkicker: i’m related to a whirlpool with teeth
gitc: now you cant just go around saying stuff like that
baby avenger: why.
Godly buttkicker: my dad’s a whore and i suffer for it
Our family tree is a wreath
Horse girl: percy where are you
Horse girl: the mild grievance matches are about to start
Has a buzzfeed unsolved episode: on my way
SSEA
Godly buttkicker: Video Attachment
[It is what looks like a boxing ring. Two people are fighting in it, weapons discarded at a table next to the entrance. They are both swearing at each other loudly and viciously]
Tony Stank: theres a boxing ring at your family reunion?
Godly buttkicker: there isn't at yours?
Godly buttkicker: oop---
Godly buttkicker: Video Attachment:
[The crowd is cheering as the two fight. In the front row, one person accidentally twacks someone in the face with an excited arm. They punch them back, and soon enough the two are rolling on the ground, fists flying]
mindiana jones: oh my god
gitc: violent
Godly buttkicker: i know its great
Godly buttkicker: hey i love this partaasdfghjkgrehreds
Tony Stank:
Tony Stank: perce?
baby avenger: they killed him
gitc: damn :/
mindiana jones: dibs on his knives
baby avenger: we’ll take care of mrs o'leary together
gitc: a group effort to raise her right
Tony Stank: ill pay for her college
mindiana jones: we expect no less
Tony Stank: i can get her into MIT with one phone call
Godly buttkicker: Video Attachment
[Everyone is fighting. The entire field, people are yelling and swearing. Some are wrestling, some fistfighting, some sword and knife fighting. Spears, clubs, and batons are being used as well. Somebody throws a shield. There is a group of kids off to the side arming cannons towards a specific group of people. Another kid gets turned into a piglet by a cackling girl. Arrows are being shot all the way across the field. Many things are on fire.
Percy is in the middle of this. He is beating down a man---the one with the buzzcut from the cousin's photo. There is a small ring of people around them cheering.]
Godly buttkicker: Video Attachment:
[Its even more chaotic now, somehow. Lightning is striking down. Percy is standing with a group of very pretty looking people on a raised platform of earth that he clearly made, and he is smiling while they all issue random commands that, for some reason, the people down below are following.
Unknown: Alright, that’s enough!
Lightning begins to strike down. Percy laughs, as does the girl next to him.
Percy: Bring it on!
Unknown girl: Try us, Sparky! ]
Godly buttkicker: Video Attachment:
[Mid-air now, Percy is wrestling with ‘Sparky’, now identified as his cousin Jason. The punk girl is cheering Percy on until the girl from before sneaks up on her and tackles her to the soggy grass. ]
Godly buttkicker: Video Attachment:
[The phone is now being held by the pale boy with the aviators jacket.
Nico: Hey, it’s Nico now. Percy gave me his phone because his third least favorite half brother showed up. Percy’s going to beat his ass. It’ll be great.
He zooms the camera in to a clearing in the field, where a young man, with a vague resemblance to Percy, stand. The man’s chin in tilted up, nose in the air.
Nico: That’s Triton. He sucks. Over there is his mom, Amphitrite, and Poseidon.
Indeed, a pretty woman is standing, looking a little annoyed, while Triton gloats. Poseidon just looks resigned.
Triton: —father’s favorite, I’m his heir—
Percy: —you’re both immortal, dumbass, you’re not gonna inherit shit—
Triton: —if he hadn’t wasted his time with that mortal, you wouldn't have—
Percy: —you little pissbaby, get a fucking hobby—
Triton: —I'm actually Atlantean, unlike you, halfbreed—
Percy: —you pathetic little bitch, seriously, you've been saying this almost a decade, i still don't care—
Triton: —soiled our bloodline with that peasant of a mortal woman—
It grows scarily silent. Poseidon raised a sole eyebrow.
Percy: did you just insult my mom?
A collective ‘oooh’ goes across the thousands watching. Triton takes a step back.
Triton: I—
Percy is already running at him.]
Notes:
how many of you people have read six of crows? i have a fun little fic idea for it. mostly crack, but it'd be something with the crows repeatedly breaking into the palace, just for fun. thoughts?
opinions on fucking hawkmoth, drop them down below
Chapter Text
SSEA
baby avenger: you know
baby avenger: i feel like the internet misses out on a lot
Tony Stank: what?
baby avenger: you know. everyone looks up to the avengers and stuff
mindina jones: but they still dont know how stupid you guys are
baby avenger: h e y
mindiana jones: are you going to look me in the eyes and tell me im wrong?
baby avenger:
baby avenger:
baby avenger: damn
Godly buttkicker: im a dumb bitch, sure
Godly buttkicker: but everything i do is calculated to the decimal
Godly buttkicker: you guys just dont like my math
mindiana jones: fair
Tony Stank: i do hate 70% of the things you do
Godly buttkicker: thank you i try
Godly buttkicker: my friend piper is reading over my shoulder and says she agrees
baby avenger: i just realized the internet dosent really know anything about percy
Godly buttkicker: wdym
Godly buttkicker: oh wait
Godly buttkicker: i forgot you guys didnt know about the terrorist thing
gitc: the what
Tony Stank: the WHAT
Godly buttkicker: uh later skaters ✌
Tony Stank: PERCY
baby avenger: ok so while mr stark is going to try and chase percy down
baby avenger: i will be informing the masses
baby avenger: mr stark? Any objections?
baby avenger: none?
baby avenger: ok thanks for you compliance (✿◠‿◠)
Coolest Intern @peterparkour
The Newest Cryptid: The Agent Who Lives In Stark Tower
[ Video description: The camera is set on a counter, slightly hidden behind a bowl of fruit. In the kitchen, Tony Stark is facing away from it, focused on a cutting board. He works in silence for a minute, before another person enters the kitchen.
TS: Hey, Aquaman, is my water boiling?
‘Aquaman’ turns towards the stove and walks over to the pot. He then proceeds to stick his hand into it, up to his wrist. He holds it there for a second.
PJ: Yes.
He pulls his hand out of the pot, seemingly unbothered. He then picks up an apple, and leaves the kitchen. End of video description. ]
Frogsareneat @littlegreenboy
hey hi yes what the fuck
merp @lowla
who---
mossboy @localfungi
god bless mr. parkour for keeping the tony stark fans well fed
weenie @cissiesmith
well yeah but WHO THE FUCK IS THAT
Frogsareneat @littlegreenboy
and he just stuck his hand in boiling water???????????? Um???
Tony Stank: peter.
baby avenger: yes?
Tony Stark: what did you just post
baby avenger: documentary
gitc: its quality stuff
Tony Stank: i swear to god you live to give me gray hairs
baby avenger: i needed to spread the word, mr stark. I will be their messiah
Tony Stank:
Tony Stank: i dont even know how to RESPOND to that
Tony Stank: did you ask percy?
baby avenger: kind of???
Tony Stank: elaborate.
baby avenger: i walked over. i asked him if i could do something
baby avenger: he cut me off and said, and i quote
baby avenger: “i dont care as long as its to cause chaos”
Tony Stank: everything about that man unnerves me a little bit.
baby avenger: “also you wouldn't last in jail. keep that in mind.”
mindiana jones: its true you look like you belong in a pixar movie
baby avenger: :(
mindiana jones: my point? proven.
Mr harrington please stop sending memes challenge
[Scary Captain has removed fastest man alive]
President lincoln: oop--
The News(™): ppft
peterman: MJ!
Murphy’s law: and we love to see it
moonmoon: i saw this and almost crashed my car
nedleedle: oh i forgot! Hows drivers ed?
moonmoon: scary. dont like it
Avril levigne: god thats a mood
peterman: i think you are the only two taking it right now
Scary Captain: yeah, none of us have our license
moonmoon: so none of you can help me cheat on my test (¬_¬)
peterman: well you see. None of us have taken it.
Avril levigne: fake friends smh
peterman: :(
Avril levigne: not you peter you amaze us all every day
peterman: :)
Scary Captain: disgusting.
nedleedle: you say it like you dont love peter with your whole heart like the rest of us
Scary Captain: thin ice, leeds.
President lincoln: im not seeing any denial 👀
The News(™): oop
peterman: hey wait a second
peterman: !!!!! idea
peterman: there is one among us who can drive
Avril lavigne: pete, you know mr harrigton got his license revoked for hijacking that truck
peterman: well yeah duh
peterman: but
peterman: @spicey
spicey: im busy what you want
Murphy’s law: oh my god i forgot he was here
spicey: all in a days work
peterman: but you know how to drive right?
spicey: i can drive, yes
peterman: ok cool so you have a license and stuff
spicey: ...i can drive, yes
moonmoon: dubious but ill take it
moonmoon: how do i win the drivers test
spicey: take car. drive away. go fast.
moonmoon: thank you for your wisdom
Murphy’s law: im pretty sure thats horrible advice, cindy
spicey: and im pretty sure you’re failing english, charles.
The News(™): WOAH
nedleedle: GODDAMN
peterman: WHY WOULD YOU KILL HIM LIKE THAT
spiecy: i didnt get shot on international television for this
peterman: what
President lincoln: McScuse Me
Avril lavigne: ???
nedleedle: explain??
spicey: no
moonmoon: uhhhhhh ill send pictures of my dogs if you do??
spicey: oh hell yeah thats a deal
Rowdy boys
Small™: percy you cant see the pictures???
Jalapeno eating king: they’re for mrs oleary duh
Small™: oh shit my b
Small™: also i know you can drive but
Small™: can i ask how?????
Jalapeno eating king: 🤪
Small™: fear
Mr harrington stop sending memes challenge
spicey: remember like. The stark gala a while ago ?
Avril lavigne: holy shit yeah it was super scary
moonmoon: yeah i remember it was all the news would cover for like a month
spicey: heh yeah
spicey: and remember that guard that took the bullets
nedleedle: yeah?
The News(™): w
The News(™): THAT WAS YOU?????
spicey: yeah
peterman: PJ
peterman: DUDE
spicey: nah its chill i got to keep the bullets
Scary Captain: literally why would you want that?
spicey: they entered my organs. im keeping them. I deserve it.
spicey: legally nobody can stop me
Murphy’s law: i mean
Murphy’s law: i guess????
moonmoon: but you just. got shot??
spicey: three times on tv yes
President lincoln: are you ok??
spicey: lmao yeah
spicey: if i get a few more ill be up to 69
Murphy’s law: nice
moonmoon: nice
Avril lavigne: nice
President lincoln: nice
nedleedle: nice
Scary Captain: nice
The News(™): nice
peterman: nice
President lincoln: wait one second
President lincoln: you'll be up to 69 what
moonmoon: bullet wounds???
The News(™): wait PLEASE tell me this man is not talking about gunshots like pokemon cards
nedleedle: honestly
peterman: we dont even know either
peterman: pj???
Murphy’s law: dude??
The News(™): mr pj spicey please we are on the edge of our seats
Scary Captain: and there he goes. He has delivered his cryptic message
nedleedle: and now, he is gone
President lincoln: pj is the only valid cryptid
Avril lavigne: rt
Murphy’s law: also i love how he didnt react at all to the knowledge that mr harrington hijacked a truck
nedleedle: tbh pj probably helped him
Scary Captain: yeah, he’s like that.
peterman: he just walked over to me and went “you see, that’s the exact type of person who should be influencing young minds” then went back to his knitting
moonmoon: h
moonmoon: he knits?
nedleedle: yes he makes us sweaters
peterman: god bless
Notes:
ok so i need your guys opinions on calypso. because like. immortal lady, older than most of the gods, falls in love with a 14 year old boy and tried to get him to stay with her forever? and then curses a 14 year old girl out of jealousy??? idk man. kinda fishy.
Chapter 10: violence on SIGHT
Summary:
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i straight up dont believe this im sorry
baby avenger: see for yourself then
gitc: dibs on making the account
Chapter Text
SSEA
Godly buttkicker: are none of you really gonna explain what the questions about fury were about
Tony Stank: no
Godly buttkicker: tell me or else
Tony Stank: or else what
Godly buttkicker: OR i send pepper and rhodey the video of you laying on the floor covered in spaghetti
Tony Stank:
Tony Stank: you are the worst person alive
Godly buttkciker: <3
mindiana jones: weak.
Tony Stank: you underestimate how hellish my life would be if the two of them get their hands on that photo
Tony Stank: i dont even know how percy got it, honestly
Tony Stank: i was alone when that happened
Godly buttkicker: thats what they all think
baby avenger: o-o
mindiana jones: i present percy jackson, deathstroke, the living embodiment of the >:) emoticon
baby avenger: ppft
[baby avenger has changed Godly buttkicker’s name to ‘>:)’]
>:): …
baby avenger: WAIT
gitc: ?
[baby avenger has changed >:)’s name to’ ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ’]
Tony Stank: oh my god its perfect
mindiana jones: how long did it take you to find that
baby avenger: like 15 minutes but it was totally worth it
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: thank you i love it
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but dont think you can distract me from the fury social media questions
Tony Stank: damnit
gitc: percy, do you have social media?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: no
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: demigods and phones dont really mix
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: its basically a homing beacon for monsters
mindiana jones: holy shit really???
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: yeah i never really had a phone growing up, other than a landline
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: even after i was an Adult(™) and moved out, and my family wouldn't be in danger, i only really used burners
baby avenger: wack
Tony Stank: yeah a lot makes sense now
mindiana jones: huh
mindiana jones: interesting
mindiana jones: but basically, theres an account that people believe is nick fury
gitc: and it has like, mad firewalls. I cant crack it
baby avenger: the account literally has more followers than the president
gitc: its all shitposts, too
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ...and you guys actually think that’s fury????
Tony Stank: with that kind of encryption?? Absolutely.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ:
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i straight up dont believe this im sorry
baby avenger: see for yourself then
gitc: dibs on making the account
Tony Stank: oh god
Tony Stank: this wont end well
kelp face @localcryptid
0 Followers | 0 Following
SSEA
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i knew introducing you to Thalia was a mistake
gitc: shrug emoji
mindiana jones: did you just type shrug emoji
gitc: no
mindiana jones: *squint*
mindiana jones: aight that checks out
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: HEY WHAT THE FUCK
Tony Stank: what??????
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: IM the 12 year old terrorist here!!!
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ooooooh when i find this bitch its game over
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: thats my thing :(
mindiana jones: i mean if you can find them
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: >:)
kelp face @localcryptid
@12yearoldterrorist
kelp face @localcryptid
@12yearoldterrorist
kelp face @localcryptid
@12yearoldterrorist
kelp face @localcryptid
@12yearoldterrorist
kelp face @localcryptid
@12yearoldterrorist
nick fury @12yearoldterrorist
What
kelp face @@localcryptid
Bitch
nick fury @12yearoldterrorist
oh
SSEA
baby avenger: !!!! he made contact!!!!
gitc: finally some plot development
baby avenger: what
gitc: what
tony stark stan account @ilovehim
Shoutout to the one and only billionaire ever
Iron man <3 @starkswife
*slides you a double-sided piece of notebook paper written in gel pen*
reasons i love tony stark:
-clean energy!!! Icon :)
-simps for pepper potts
-kicked justin hammer in the nuts, on live TV
-this was before we knew he was a supervillain
-gives so many scholarships, dude
-hot
-im just kidding
-sort of.
-found out his business partner was selling under the table weapons to terrorists and nazis and just straight up killed him
-uses his position to uplift other peoples voices!!!!!
-pays for damage the other avengers *cough cough captain america cough cough* cause
-sells prosthetics for free???? Because he can???
-pretty :)
Captain America Hate Blog @teamironman
You also forgot that he either
- Has a teenage intern who regularly makes fun of him, and allows it
Or
- Just follows the account because he thinks its funny
Iron man <3 @starkswife
god youre so right
Coolest Intern @peterparkour
ive been summoned
Coolest Intern @peterparkour
oh???
Coolest Intern @peterparkour
a simple addition:
-always tells his bots he’ll donate them to a community college, but once punched a general who was mean to them
-makes me hot chocolate
-let me keep a kitten in the tower for a week until it was healthy
-gives good hugs
tony stark stan account @ilovehim
we’ve been graced with the presence of a god
Avengers!!!! @superherostan
Mr parkour ill give you my kidney to describe what his hugs are like
Coolest Intern @peterparkour
I would never take your kidney!!!!!! Ill tell you for free :)
Coolest Intern @peterparkour
they are WARM and SOFT and he smells NICE
Coolest Intern @peterparkour
easily a 12/10
Iron man please marry me @starklover
oh my god,,,,,,,,,,,
Avengers!!!! @superherostan
soft
Captain America Hate Blog @teamironman
soft
merp @lowla
Wait nobody @ed the intern kid
merp @lowla
How did he find the thread
tony stark stan account @ilovehim
OH MY GOD
tony stark stan account @ilovehim
mr. parkour were you just scrolling through the tony stark stan pages???
Coolest Intern @peterparkour
...no comment
Frogsareneat @littlegreenboy
A W W W W
You Know Who I Am @TonyStark
425.7 Mil Followers | 35 Following
weenie @cissiesmith
ok so we agree the intern kid is legit, we’ll never find out about the nick fury account
weenie @cissiesmith
but TS just followed someone else???
mossboy @localfungi
oh shit who
weenie @cissiesmith
@local cryptid ??????
Mindy @mindyydnim
alright now who the FUCK is this
Mindy @mindyydnim
they aren’t following anyone, never posted anything????
astrology, hoes @starcharts
wait no he just posted something
astrology, hoes @starcharts
he called the nick fury account a bitch????
ferris wheel fighter @uhov4hiorei
the account was JUST made
ferris wheel fighter @uhov4hiorei
so let me get this straight
weenie @cissiesmith
you cant get anything straight but continue
ferris wheel fighter @uhov4hiorei
bitch i---
ferris wheel fighter @uhov4hiorei
ANYWAYS as i was saying
ferris wheel fighter @uhov4hiorei
this person makes a twitter account, gets followed by tony stank but dosent follow him back, because they were too busy verbally attacking the cryptic nick fury account
Pepper potts marry me challenge @deno
and it was on SIGHT too
weenie @cissiesmith
wild
Notes:
i mean i KNOW tony stark has fan pages. i know he does.
im also accepting ideas for this now btw :) my brain bank account is broke
for anyone wondering: the photo percy was talking about was taken while tony was cooking. it was directly related to how tony found out percy could stick his arm in boiling water without dying on sight. screaming and fear were involved.
Chapter 11: girlbossing B)
Summary:
The News(™): i cant believe tony stark outed himself as a thot
moonmoon: the world will never emotionally recover
Notes:
(See the end of the chapter for notes.)
Chapter Text
Mr harrington please stop sending memes challenge
moonmoon: gaslight, gatekeep, girlboss. mansplain, manipulate, malewife.
moonmoon: choose your alignment
Scary Captain: girlboss
nedleedle: gatekeep
The News(™): also girlboss
Murphy’s Law: mansplain
president lincoln: i feel like i could pull off malewife
peterman: i do too
peterman: gaslight is pretty tempting tho
avril lavigne: peter you couldn't lie to save your life
peterman: hey!!!!
peterman: yes i could >:(
Murphy’s Law: dude you cant keep anything a secret
Murphy’s Law: when betty planned a surprise party for me last year?? Remember?
moonmoon: charles asked what we were talking about, you freaked out and yelled “apples aren't real”
peterman: I PANICKED OKAY???
avril lavigne: don't worry peter, we still love you
avril lavigne: even though you couldnt keep a secret if your life depended on it
peterman:
peterman: ok
nedleedle: what do you think mr. stark is???
peterman: i have no idea
moonmoon: peter. If you go up and film you asking him, i will give you my kidney
peterman: hmmmm
peterman: well i have been in the business for a new one
peterman: you’ve got yourself a deal, moon
---
Rowdy Boys
Small™: im about to do something hilarious
Small™: come to the lab
jalapeno eating king: im running—
---
peterman: Video Attachment
[Video description: Peter is walking with his phone, the camera sneakily pointed at the floor. All we can see is his socks---they are patterned with Thor’s hammer. He is heard quietly snickering as he walks across the shiny tiled floors.
Peter: Hey, Mr. Stark?
Tony: What’s up, kid?
Here, Peter clears his throat, clearly psyching himself up. Then, through a laugh, he says:
Peter: Do you feel like a girlboss?
Tony: …
Tony: What?
Peter giggles.
Peter: Girlboss, gaslight, or gatekeep?
Tony is silent.
Peter: Or, perhaps, you feel a stronger connection to mansplaining? Manipulate, or malewife?
Here, Peter risks moving the camera up to get a shot of Tony’s blank face.
Tony, quietly: Is this one of those trends you like?
Peter: Irrelevant.
Tony sighs and turns back to his workbench. It is silent for a long moment, the man focused on his project. Then, consideringly, he adds;
Tony: Manwhore.
Peter’s roaring laughter is cut off by the video ending.
End of video description]
moonmoon: PFFFFT-
President Lincoln: BHAHAHAHAHA
avril lavigne: WHAT THE FUCK OH MY GOD
nedleedle: p e t e r
peterman: your kidney. hand it over.
---
SSEA
baby avenger: percy is on the floor laughing
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: adfrejkrekjbgrebjk can you blame me????
baby avenger: oh my god you keysmash
baby avenger: does percy jackson is do gay?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: pete.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: im ancient greek
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: at this point i think its an inherited trait
mindiana jones: mmm fair point
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: when i came out to my dad he was just like “yeah”
gitc: f
gitc: cindy is losing her mind rn
Tony Stank: i stand by what i said
mindiana jones: ive never liked you more than i do now
Tony Stank: thanks? I think?
---
Mr harrington please stop sending memes challenge
The News(™): i cant believe tony stark outed himself as a thot
moonmoon: the world will never emotionally recover
president lincoln: peter. If you know tony stark
president lincoln: and HE knows pepper potts,,,,
peterman: !!!!!!!!!!
avril lavigne: DO NOT
Murphy’s Law: if you ask pepper potts if she’s a gatekeeper, i think god will strike you down without question
Scary Captain: peter. Im warning you
Scary Captain: dont bother ms potts
nedleedle: i think its too late
nedleedle: hes probably running up the stairs in the tower as we speak
The News(™): a preemptive rip for one peter benjamin parker
president lincoln: rip
avril lavigne: dont even go there abe
avril lavigne: you are the one that started all of this
---
peterman: Video Attachment
[Video description: Peter is sprinting up the stairs and down a nice-looking hallway at inhuman speeds. He stops at a large oak door. In the placard by the room number, the name V. Potts is displayed. Peter knocks politely on the door.
Pepper, muffled: Come in!
Peter briskly opens the door and walks to the desk. He slams a hand down on the wood.
Peter: Ma’am.
Peter: Would you classify yourself under the category of girlboss, gaslight, gatekeep, manipulate, mansplain, or malewife?
Pepper looks distinctly amused. She cups her chin in her palm, tilting her head to the side a little.
Pepper: Hmm…
She nods once.
Pepper: I’d have to say I’m partial to girlboss, myself. Though manipulate is a good one as well.
Peter: Thank you for your service.
The video cuts to a confused man in decorated military dress sitting on the couch, looking up at Peter from a stack of paperwork.
Rhodey: I’m sorry, what?
Peter: If you had to classify yourself, Mr. Colonel Rhodes War Machine Sir. What would you pick?
The Colonel still looks a little confused, but considers it.
Rhodey: Uh, gatekeep?
Rhodey: And what have I told you about calling me that?
Peter laughs.
Peter: Thank you for your time, Colonel.
The camera cuts, once more, to a different setting. An abnormally large black dog is sitting on the couch, drooling on what looks like a very expensive pillow. She wears an ocean colored collar and a white harness with fluorescent stripes.
Peter approaches the behemoth of a dog, cooing and baby talking.
Peter: Who’s a good girl? Aw, it’s you. Best girl. Fantastic dog.
The dog breaks out into a smile, showcasing canines as long as Peter’s pinkie. He reaches forward and rubs her head.
Peter: You’re a girlboss. I just know it.
She licks his hand.
Now, he moves the camera away from the dog to the cushy armchair next to it. A tall man is sitting in it, elbows on the knees of his spread legs, sharpening a long steel xiphos. Dark hair hangs over his eyes, obscuring most of his face.
Peter: Hi, PJ!
PJ doesn't look up, but he gives Peter and acknowledging nod.
PJ: Hey.
Peter inches forward.
Peter: Ok. So.
Peter: Gaslight, gatekeep, girlboss. Mansplain, manipulate, malewife.
Peter: Which one are you?
Momentarily, the steady scraping of PJ’s sharpening pauses. He cocks his head to the side, then resumes his steady motions.
PJ: Manslaughter.
Peter:
Peter: ...okay
End of video description]
peterman: PS if you guys show this to anyone MJ is gonna shove your eyes down your esophagus
Scary Captain: 🔪
moonmoon: peter i cant believe you
moonmoon: you give us god’s gift to man
moonmoon: but we cant even show anyone
President lincoln: forget T H A T
President lincoln: war machine classified himself as gatekeep???
The News(™): and pepper confirmed she knew she's a girl boss
avril lavigne: okay but
avril lavigne: i know rich people are ✨quirky and eccentric✨
avril lavigne: but having a fucking bear on the couch is a tad much, methinks
peterman: oh thats just my friends dog
President lincoln: d o g ? ? ? ?
peterman: yeah :)
peterman: shes a sweetheart
Murphy’s Law: and that scariest man i’ve ever seen??? Just sitting on the couch with a sword??
moomoon: yeah like i know superheroes are funky
moonmoon: but the broadsword was a little much
peterman: oh he’s not a superhero
peterman: that’s my friend PJ
peterman: the one who ate all the jalapenos, remember?
moonmoon:
The News(™):
President lincoln:
Murphy’s Law:
avril lavigne:
nedleedle: i think you broke em, pete
peterman: ?
moonmoon: THATS PJ????
President lincoln: ARE YOU SERIOUS
The News(™): I THOUGHT HE’D BE LIKE. SOME RANDOM GUY
The News(™): NOT AN ACTION HERO WITH A SWORD
avril lavigne: HE LOOKS LIKE THE MAIN CHARACTER
Murphy’s Law: and that bear is his???
peterman: dog* and yes
peterman: also he would like you to know its not a broadsword
peterman: its a xiphos
peterman: hes very particular like that
moonmoon: peter, and i cannot express this enough,
moonmoon: what the fuck
Notes:
percy just LOOKS like the main character, okay
happy pre-emptive halloween, folks.
i'll try to drop an out-of timeline halloween chapter at some point
Chapter 12: flash, p l e a s e
Summary:
murphy’s law: I JUST SAW SPIDERMAN SWINGING ABOVE MY STREET
Notes:
(See the end of the chapter for notes.)
Chapter Text
Coolest Intern @peterparkour
[Video description: The camera is facing Peter, who is wearing a thick jacket with the hood pulled up. “It’s cold as fuck.” He whispers into the mic of his earbuds.
The camera then flips around to the rubber chicken in his hands. He is very determinedly fitting the other earbud in the mouth of the chicken. Without a word, he slowly squeezes it and throws it. As soon as he lets go, the infernal chorus begins.]
Coolest Intern @peterparkour
Oh my god i forgot my phone was plugged into my headphones
You Know Who I Am @TonyStark
You post something like THIS
You Know Who I Am @TonyStark
And that is the thing you regret?
Coolest Intern @peterparkour
😔
Mr harrington please stop sending memes challenge
Scary Captain: god fucking damnit
Scary Captain: flash snitched
Scary Captain: now morita says i have to add flash back to the chat
President lincoln: gross
The News(™): ill call the fucking exterminator
nedleedle: absolutely disgusting
[Scary Captain has addled fastest man alive to the chat]
Scary Captain: behave or i’ll beat the shit out of you
fastest man alive: whatever, jones
murphy’s law: HOOHOOHO MY GOD
murphy’s law: PAUSE THE FLASH THREATENING PLEASE
murphy’s law: I JUST SAW SPIDERMAN SWINGING ABOVE MY STREET
peterman: spider-man*
fastest man alive: spider-man*
moonmoon: jesus christ theres two of them
Avril lavigne: peter, you like spider-man too?
peterman:
peterman:
peterman:
peterman: hes ok i guess
fastest man alive: ugh
fastest man alive: further proof that penis is a fucking idiot
fastest man alive: spider-man is the best superhero ever
Scary Captain: what did i say, flash?
fastest man alive: what, like im wrong?
fastest man alive: or do you hate spider-man too?
peterman: i never said i hated the guy
Scary Captain: i like spider-man a fair amount. Its good we have somebody fighting for the average citizens, to do what the avengers can’t.
peterman:
peterman: ok
moonmoon: peter just dropped his phone
moonmoon: you good bud?
peterman: peachy, thank you cindy
fastest man alive: ok back to spider-man
fastest man alive: he’s just the best hero. nobody really does what he does, going out there every day and keeping the streets safe. It’s really admirable. He’s a hero, through and through.
Avril lavigne: wait for it
fastest man alive: id also let him snap by spine like a glow stick
Avril lavigne: there it is
Rowdy Boys
jalapeno eating king: is,,,,,,,,,
jalapeno eating king: is this a normal occurrence
Small™: what?
jalapeno eating king: flash
Small™: how the fuck do i consistently forget you are in the chat
jalapeno eating king: easy
jalapeno eating king: because im an ~international super spy~
Small™: wa
Small™: was that a fucking backyardigans refrence
jalapeno eating king: absolutely. I binge it with my little sister.
Small ™ : i-
jalapeno eating king: im a uniqua stan. She prefers pablo, but only because he is blue, which i can respect.
Small ™ : im shaking why are you giving me this information
jalapeno eating king: because nobody
jalapeno eating king: will ever
jalapeno eating king: believe you.
Small™: oh you sick bastard
jalapeno eating king: <3 <3 <3
jalapeno eating king: now answer the question
Small™: percy i swear to god
jalapeno eating king: im fucking crying peter is it normal
Small™:
Small™: yes
jalapeno eating king: one day, far in the future, this is going to be even funnier
Small™: i hate you
jalapeno eating king: liar
Small ™ : :/
jalapeno eating king: but speaking of flash
jalapeno eating king: say the word
jalapeno eating king: ill make that kid believe in god.
Small™: that is very threatening thank you
Judas!!!! No!!
one hit KO: nobody:
one kit KO: percy ‘older brother’ jackson upon being within a mile of flash:
Loser 2: i think that’s how he shows affection
not a loser: hey when you think about it
not a loser: kind of like mrs oleary
one hit KO: what do you mean?
not a loser: remember when we took her on a walk and that guy shoulder checked you and me?
Loser 2: and she untied his shoelaces so he tripped in that gutter? how could i forget?
Loser 2: i didnt even know dogs could do that
not a loser: yeah i dont think anybody here really believes shes a dog
one hit KO: fair
not a loser: but if you r e a l l y think about it they are both very similar
not a loser: they both do that head tilt thing when they hear a noise
not a loser: they're like the same size but are somehow so goddamn stealthy
not a loser: both can fire automatic weapons
not a loser: both really like spicy peppers and have a weird aversion to lettuce
not a loser: same hair color
Loser 2: except from percy’s stress induced(?) grey streak yeah
one hit KO: i always assumed he had like. A birthmark.
one hit KO: but holy shit ive never really thought about it like that
Loser 2: consider the fact that im not sure we’ve ever seen them together
not a loser: consider that we literally have?????
Loser 2: maybe he’s just fast, michelle.
one hit KO: orrrr
one hit KO: theYRE THE SAME PERSON
Loser 2: BRO OH MY GOD
one hit KO: BRO
Loser 2: IT ALL MAKES SENSE NOW
not a loser:
not a loser:
not a loser:
Coolest Intern @peterparkour
[Video Description: A compilation of pictures with a voice-over
“This is Todd, he ate his parents.”
A picture of an absolutely enormous dog chewing on what looks like a full size training dummy is shown.
“This is Gustavo, he’s normally ok but every so often he cries until he throws up.”
This one is a picture of Peter, wearing a giant hoodie that clearly wasn't his, the hood up and the drawstring tight, obscuring his face as he curled up in a ball.
“These are the twins; Free Willy and Free Britney.”
Overtop, the words “my emotional support friends” are written. MJ and Ned are standing there, MJ with a sketchpad under her arm.
“This is Greg, he hates everyone, so if he likes you can have him for free.”
This one is ‘Aquaman’ from Peter’s earlier video, standing with his arms crossed, an instrument case on his back. His scowl is something of nightmares.
“This is Let It Gopher, the lady who found him thought he was a gopher snowman, but he was actually a cat.”
Once again, there are words atop this one. They say “This is Tony, we thought he was a responsible engineer, but he actually can’t boil water.”
“This is Death By Chocolate Lab, he has three legs and seven eyes, so he’s either cursed or really weird. But no ones died yet so we’re leaning towards weird.”
Here, there is just a short clip of Spider-Man crawling on a ceiling.
“This is Camilla Caballo. She is a horse.”
It’s the giant dog again. End of video description.]
Frogsareneat @littlegreenboy
oh? my? god?
Iron man <3 @starkswife
would i die for tony stark? Yes. will i make fun of him for not being able to boil water? Also yes.
merp @lowla
that,,,,,dog,,,,,
weenie @cissiesmith
WAS THAT INTERN? WAS THAT PB???
Mindy @mindyydnim
!!!!!i think it was!!!!!
ferris wheel fighter @uhov4hiorei
that was so fucking cute i-
flash @fastestmanalive
holy shit was that spider-man???
Coolest Intern @peterparkour
Okay you guys really liked the last one so heres another bc im nice
{Video Description:
Another series of clips with voice overs
“Every friend group has… big tiddy identity crisis,”
Colonel Rhodes sits on a couch in the lab, his head in his hands. You’ve never seen a man look so tired. It’s a bit hard to hear over the audio, but Tony Stark is laughing maniacally.
“Sweet but no brain,”
It’s Peter, doing a very excited cartwheel.
“Omnipotent God,”
Mrs O’Leary, doing that cute little dog stretch they do after waking up from a nap.
“Wine Step Mom”
It’s Pepper in all her regal glory at her desk.
“Encyclopedia Bitch”
Ned. He is standing in front of a projector in the “had to do it to em” stance. The projector is displaying a slideshow entitled ‘The Government Tells Us About The Moon. Should We Believe Them?’
“The one with goals”
MJ is standing, clipboard in hand, yelling at various classmates.
“Unbridled rage”
It’s Percy. He is sitting still. Too still. In the lens flare on his eyes red, or does he just look like that?
“Rich.”
It’s Tony, obviously, laying face down on the carpet, a mug of coffee in hand. End of video description.]
Notes:
YES i classified rhodey under big tiddy identity crisis. thats because it is a state of being, completely unrelated to your physical body.
also i was thinking of doing a pure fluff holiday chapter to soothe my soul, what do you guys think?
what other alignment charts should i put the Gang(TM) in and how would you guys classify them?
Chapter 13: Holiday Chapter :)
Notes:
Happy Holidays everyone! And for everyone who celebrates, Merry Christmas!
(See the end of the chapter for more notes.)
Chapter Text
Friday, December 24th
7:12 PM
Camp Half Blood, Long Island, New York
Christmases at Camp were always a little bit too much, in all the best ways. Tinny holiday music was blasting from at least three speakers that Percy could pinpoint, all playing different songs. The entire camp, from the big house to the cabins, smelled like peppermint and pine.
The warm weight on his shoulder shifted. “Perce, you should fuckin’ see this place. The Stolls,” Piper laughed. “Everythin’s covered in tinsel. I dunno where they even found it all.” Percy bit his lip against a smile. “Is it shiny?”
Piper flopped dramatically into his lap. “ So shiny.” She whispered, reaching an arm out to scratch Mrs. O’Leary on the head.
Putting a steady hand on her side to keep her from falling into the grass, Percy raised a brow. “Pipes, how much of Pollux’s eggnog have you had?”
She smiled. “A lot.”
He snorted. “Right. Lovingly, you’re a mess.” She hummed in response. “You gonna leave soon?”
Percy’s hand went to her hair, moving some of it off her face. “Yeah.”
Piper nodded distantly, slowly shutting her eyes. As her breathing steadied out, Percy kept his ears open for Jason or Reyna’s familiar voice. Piper was definitely going to be out for a while, and he couldn’t stay here for much longer.
It was the low timbers of the daughter of Bellona’s voice he caught first, standing by the bonfire with Gwen and Nico. As careful as he could, Percy shifted Piper into his arms. He moved carefully between the crowds, trying his best to not jostle his friend.
Nico noticed him first. “Hey, Perce.” He gave the Hellhound a few greeting pats.
Reyna, who was either smart enough to stay away from the Dionysus kids’ eggnog, or could just hold her drink, turned towards him. “You got our girl, Jackson?” In response, Percy just lifted Piper a bit higher. Like always, as soon as her eyes fell on Piper, Reyna’s heart sped up, just a little. Percy smiled a little. He doubted Reyna even knew it happened; he certainly wouldn’t tell her. It was adorable, certainly, but an embarrassed Reyna was a violent one.
“Where’s Jay?”
The Preator cast a look over her shoulder. “With Hazel and Frank, I think.” She looked down at the mug held in her mittened hands. “I’m about done anyways. I’ll stay with her.”
Percy nodded, adjusting his grip on Piper. As he walked, she turned her face into his chest. Probably getting drool all over his sweater, but, whatever. She assured him it was absolutely hideous when she picked it out, anyways.
He and Reyna made the trek to the Poseidon cabin in silence, instead soaking in the chilly December air. It was barely windy, just a light breeze that ruffled his hair and made Piper grumble in her sleep. He could still hear the noise of the party, overlaid by the crunch of his and Reyna’s boots in the frost-coated grass.
As they skirted around the canoe lake, Percy took a minute to feel the soft mist rolling across the surface, clinging to the ground and around his ankles. Mrs. O’Leary snapped at it with her fangs out.
Reyna was the one to break the silence, her eyes still on the Hellhound’s fight with the cold mist. “So.” She shoved her hands into the pockets of her coats. “An Avenger, huh?” He had no doubt she was smiling.
Percy rolled his eyes. “Shut up.” He muttered. Reyna laughed quietly, as to not wake her girlfriend. “No, seriously. What’s it like?”
He grinned. “Honestly? A lot of paperwork.”
“They got a braille printer for you, right? I don’t need to do any ass kicking?” She questioned.
With a huff, Percy turned his head towards her so she could see his face. “Yes, Rey. Tony Stark and his fancy AI have so many goddamn accessibility options that it makes my head hurt. I’m doing fine.”
“I know. We just…” She sighed. “We worry about you, you know?” The softness of her tone was one she used rarely. Percy swallowed. “I… I do. I appreciate it. Really.” He broke off for a second as they approached the wide circle of cabins. Reyna stepped in front of him, opening the door.
As Percy stepped through the doorway, any terseness in his body evaporated. Even after all these years, Cabin 3 always had that effect on him. With Reyna’s help, Piper was placed on her usual bottom bunk on the far wall, blankets pulled up to her shoulders.
The two of them sat on the edge of the only permanently unoccupied bunk, legs stretched out, Mrs. O’Leary between them. It was quiet, save for the sound of Piper’s soft breathing and the wind rustling through the leaves.
Percy folded his arms over his chest, leaving back against the wall. “I know you guys worry.” He said, voice low and quiet. “It’s just…for the first time in a long time, I feel like I’m actually helping people.”
“I get that, Jackson. I do. I’m glad you’re happier now.” She tugged at the end of her long braid. “I never really trusted those SHIELD people.”
He shrugged. “That makes two of us. I tried to warn them. They didn’t listen. I cut my losses.”
She hummed. “I know you’re living it up in the Avengers Tower now, but if you ever get tired of being shot at…” Her lips twitched. “You’re always welcome with all of us in New Rome. Our armies have never looked better since you were there to drill ‘em.”
Percy laughed. “Right. Thanks. I’m pretty sure everyone else would object to that, though.”
She rolled her eyes. “You weren’t that bad.”
He raised a brow. “I believe brutal was the word everyone else used.”
Reyna just shrugged. “It worked.”
They didn’t talk for a bit longer after that, just listening to the soft gurgling of the fountain in the corner. That was one of the things he had always liked best about Reyna; she was just as content to sit in the silence as he was.
If he focused, he could feel the crowd in the amphitheater start to wane as the younger campers retired. He knew, if he went over there, some of the Dionysus kids would be breaking out the harder stuff, like they did every year once the kids below the drinking age went to bed.
He swung his legs over the side of the bed. “That’s my cue.”
Reyna opened one eye to squint at him. “Goin’ to try an catch her before you leave?” She asked through a yawn.
Percy nodded, stretching his shoulders. “Gotta get home soon, too. Mom promised to keep Stella up ‘till I got there. Don’t wanna keep them awake for too long, though—” Percy paused, tilting his head to the side. “Nico and Hazel.” He announced.
Reyna sighed, letting her head thunk back against the wall. “Seven years, and that’s still creepy as shit.” He smiled at her.
True to his word, not even a minute later, Hazel opened the creaking door and gently as she could. “Piper asleep?” She whispered. Percy nodded.
Nico closing the door behind them, they both made a beeline for Percy. “You heading out?” Nico prodded, though he already knew the answer.
“Yep.” Percy affirmed, catching both of them under his arms in a tight hug. Nico pulled a face, like always, but leaned into Percy’s side. Also like always. Hazel, from his right side, hummed. “Frank’s gonna be here in a few. You seen Leo and Jason?”
“Why no, Hazel, I can’t say that I have.”
As Hazel’s ears pinked, Nico jabbed him in the side. “Asshole. I know you know where they are.” He muttered. Percy laughed. “Jason’s with Gwen, Leo’s with Nyssa and Harley.” Hazel nodded tiredly. Percy loosened his grip on both of them, not before planting a kiss atop Hazel’s curls and Nico’s dark locks.
“I’ll visit soon.” He promised as he made his way to the door, Mrs. O’Leary hopping off the bed to follow.
Nico crossed his arms. “You better!” He called. Percy just smiled and waved as he stepped outside.
“If I see your dumbass on the news again, I’ll shadow travel to wherever the hell you are and kick your ass!” Nico’s aggravated voice called after him.
It was just him and Mrs. O’Leary, now, her paws padding soundlessly on the grass. If not for the displacement in the mist and the slight vibrations in the ground, he might’ve not even known she was there.
They made it to the Dionysus cabin just in time. Emma stood on the porch in her pajamas, a thick fleece blanket around her shoulders. She was rocking back and forth on her heels, mug cupped in her hands.
She squinted a little at Percy’s lone figure, the dark obscuring his face. Once he stepped close enough to the cabins that he was visible, Emma let out a loud squeal. She quickly set the mug down on the porch railing, then hopped over it in a singular smooth motion.
“Piper teach you that one?” Percy laughed as she barreled into him. Emma shook her head against his chest. “Reyna.” He rolled his eyes. “Right,” He muttered, arms coming up to wrap around her. “Should’ve known.”
After a long minute, she pulled back a little. “I haven’t seen you in forever!” She accused. Percy smiled blandly. “Wish I could say the same.”
“...You’re not funny, you know.”
“On the contrary. I’m hilarious.”
She scoffed, but a smile crept back up on her face anyway. “Where have you been?”
Percy gave a small shrug. “Kind of everywhere, really. I’m sorry I’ve been so busy.” He said, tone apologetic. Her eyes gleamed. “Anything fun? Ooh, did you take down a drug ring? Or fight some magic terrorists? Have you met a wizard?”
He laughed. “Uh, yes, sort of, and that last one is classified.”
She stared, unblinking. “Perseus Jackson, you better not be shitting me on that one. A wizard? ”
He just smiled. “Anyways. I got you a Christmas present.”
“Wh-wait, you can’t just move on from the wizard part—” She cut herself off as he thrust a wrapped package into her hands. She looked down at it, then up at him. Biting her lip to keep from laughing, she asked, “Did you wrap this?”
He crossed his arms. “I can do many things, Em, but wrapping a present simply isn’t one of them.” His voice softened, his face taking on a smile. “Estelle insisted she do it.”
The package was covered in at least six layers of Ariel and Flounder wrapping paper, and secured with pink duct tape. “Your sister amazes me.”
Percy nodded. “She has that effect.”
After a brief struggle, Emma tore it open. Inside, rested a beautiful curved blade with a serrated handle. Breath leaving her, she pried it out of its box and picked it up. “Holy shit, this is nice .” She whispered, tilting it side to side and watching the moonlight glint off the shining metal. “Where did you even get this?”
She received a shrug in return. “I have a guy.”
Emma barked out a laugh. “A knife guy?”
“All sorts of weapons, actually. And I’m a mercenary, Em. Of course I have a guy.” Gently, he plucked the blade from between her fingers. “Now, listen to me about this.” She looked up at him. “This is sharp, alright? No practicing without supervision. I know Piper or Clarisse would be glad to teach you.”
She nodded quickly. “Right. Don’t be stupid with weapons. And I’ll ask Piper. Clarisse scares me. I honestly don’t know how you befriended her.”
“We just mostly beat the shit out of each other in our spare time.”
“...Right. Well, thank you, Percy. I…I don’t have anything for you.” She frowned, hanging her head.
He nudged her with an elbow. “I don’t need a gift, Emma. I wasn’t expecting one. You didn’t even know I was gonna be here. Besides, what are surrogate older brothers for if not to randomly show up and give you weapons?”
This brought a laugh out of her. “Still. Thanks. Merry Christmas, Percy.” Mindful of the knife, she leaned in and gave him another hug. He smiled. “Merry Christmas, Emma.”
Friday, December 24th
8:42 PM
The Jackson-Blofis Apartment, New York
He went to his mom’s next. Paul and Estelle waited for him on the couch as his mom opened the door.
Estelle was so happy to see him she almost squirmed right out of Paul’s arms as onto the floor. Percy barely caught her.
He held her close to his chest, her arms around his neck, until she fell asleep. After he put her to bed, the three of them just sat in the living room and talked way past midnight.
“I’ll be gone by the time you wake up,” Percy said apologetically. His mom just nodded and kissed him on the forehead. “Merry Christman, filho .”
“Merry Christmas, Mom.”
He slept on the couch that night, and, true to his word, was gone by the time Paul woke up to make coffee.
Saturday, December 25th
11:03 AM
The Chase House, California
The Chase house never changed. Not really.
When Percy went up the steps to the door, he could hear the laughter inside. Ms. Chase was the one to open the door for him.
“Percy,” She said warmly. “We’ve been waiting for you.”
He smiled and ducked his head. “Didn’t mean to keep you.”
She shook her head. “Nonsense.”
Bobby and Matthew both ran at him in the same time. Both of them were nearing their fourteenth birthdays, but he could still lift them both with ease. The two boys laughed, giving him a fierce hug. “Percy!” Bobby yelled. “I knew you’d come!”
Percy grinned. “Course, like I’d ever forget.”
“Oh! Oh! Wait ‘till you hear what we got!”
“Why don’t you go grab your new things from your rooms, boys.” Dr. Chase suggested. The twins ran off so fast it reminded Percy of the Stolls.
Dr. Chase chuckled, watching the two speed out of the room. Then, he turned towards Percy. “Good to see you,” The man said with a smile. “How’ve you been? Anything exciting?” He leaned over the edge of the couch. “I hear you’ve been working with Dr. Stark himself.”
Percy fought back a smile. “A little.” He agreed.
The first time Percy visited the Chase house on Christmas, he was sixteen years old. Annabeth had taken him. Neither of them had come the year after; he was missing and Annabeth was still running herself ragged trying to find him. The year after that, he had been invited.
The invitation had surprised him, at first. Grover was the one who told him he should go. “Annabeth…she’d want you to look out for them.”
Percy knew the saytr had a point. So, that morning after Estelle had unwrapped all her presents, he threw on a coat and Mrs. O’Leary took him to California. Bobby and Matthew had remembered him, to his surprise. Annie’s cool boyfriend.
“You were special to her. Maybe the most special. I…You can refuse if you’d like, Percy, but you’re a fine young man, and I’d like for you to stick around. She…I think she would have liked that as well.”
So every year, he came back. He always brought gifts, too.
The boys were easy. The first year, he’d gotten them each a good pair of hiking boots and, the next week, had supervised a trip to the Redwoods. Mrs. Chase had been a tad hesitant, but Fredrick just shrugged. “Personally, I can’t think of anyone better to protect our boys.”
She’d relented eventually.
The boys hadn’t stopped talking about it for weeks, afterwards.
The two elder Chases were a bit more difficult. He figured it out eventually, though. Frederick liked almost anything he could read. Percy brought back the most interesting books he could find, from whatever corner of the globe he’d most recently visited. For Ms. Chase, it took a bit of asking, but she’d finally revealed that she had a deep passion for tea. So, wherever he stopped to get a book, he grabbed a new kind of tea, as well.
“Tell me all about it.” The doctor practically demanded. Percy laughed. “Everything I can.” He promised.
Saturday, December 25th
4:13 PM
Stark Tower, New York
By the time he got back to Stark Tower, it was late in the afternoon.
As he rode the elevator up, he could hear the Christmas music starting from floor 80. In contrast to Camp, everything was soaked in the smell of gingerbread and pine, instead of peppermint.
(Long story short, it turns out spiders really don’t like peppermint. And, wouldn’t you know, their resident Spider was not fond of it either.)
Percy made a beeline to the kitchen, a giant tupperware of cookies in one arm and another of his mother’s hot chocolate in the other. He’d just dropped them on the counter when he heard Tony.
“Hey!” Tony yelled. “You’re back! Great. I need you to hold this.” The engineer thrust a giant spool of lights into Percy’s hands.
The demigod followed him obidiently as Tony strung them up across the fireplace. “How was Camp?”
“Loud.” Percy offered. “My friend passed out on top of me. I hunted down her girlfriend, and we had to drag her ass back to my cabin. Got to talk to everyone again, though, which was nice. Saw Emma, too.”
“Oh, yeah? How’s she doing?”
Percy grinned. “Great. Has her brother wrapped around her finger.”
Tony snorted.
(Percy never mentioned going to the Chase household. Nothing against Tony; only a few people knew he did that every year. Maybe he’d bring it up one day, but… not today. It was Christmas day. They didn’t need a bunch of baggage with it.)
Pepper showed up next. She kicked off her heels and dropped down on the couch. Percy got her a mug of hot chocolate. She kissed him on the cheek.
Next was Peter and May, red-cheeked and bundled in a few too many layers. Peter especially. May had gotten word of his thermoregulation problems and, according to Peter, had gone majorly overboard. They brought a big thing of orange cinnamon rolls. Store bought, Peter had assured him.
MJ and Ned showed up next. She brought apple cider and he brought muffins. Percy directed them to the kitchen while MJ grilled him on Dare Enterprise’s new land acquisition.
Last was Rhodey, who came bearing his mother’s banana bread. On the way to the quickly overcrowding countertop, he turned on the fireplace, coating the room in a soft, warm glow.
They ate in the living room while Tony turned on the audio description for Home Alone. The engineer was squished in the middle of Rhodey and Pepper on the small couch. May took up the armchair. Percy stretched across the loveseat with Mrs. O’Leary. MJ and Ned sat on the soft carpet in front of the loveseat with blankets around their shoulders, leaning back against the two of them. Peter sat with them until he got cold and shoved his way into Percy’s side, burying his face in Mrs. O’Leary’s fur.
In the midst of MJ and Rhodey arguing on whether or not Kevin was a sociopath or not, they started to drift off. Peter was first, his breathing slowly evening out. Then Pepper. Then May. Ned. Tony. MJ and Rhodey.
Percy laid there awake the longest.
“Hey, Fri?” He whispered. “Pause it, please.” He then added on, “Oh, uh. I’m pretty sure the lights are on. Can you turn them off?” While he obviously didn’t give two shits about how bright the room was, he didn’t want it to wake any of the others.
“Of course.” The AI responded quietly. “Merry Christmas, Mr. Jackson.”
He smiled, tilting his head up towards the ceiling. “Thank you. Merry Christmas, Fri.”
Percy listened to the soft, steady heartbeats of the people around him until he fell asleep.
He slept uninterrupted for the first time in months.
When Percy woke up, the first thing he did was listen around him. It seemed only Rhodey and MJ were up; he could hear them softly moving around the kitchen.
A part of him wanted to get up, to stretch out his joints and help with whatever they were doing, but, as if he knew what he was thinking, Peter let out a soft snore, curling into Percy’s side.
Percy didn’t move a muscle for the next two hours. Until everyone was awake but Peter.
Tony leaned over the couch. “Uh, hey?” The man murmured softly. “I really can’t tell if you’re awake or not.” He muttered. “Jackson?”
Percy caught Tony’s outstretched finger an inch away from his face. “I’ve been up for hours. If you wake Peter, it will be the last thing you ever do.”
“Fair.”
Peter didn’t stir until an hour later. Even then, he refused to detach himself from Percy’s side. “How are you so warm?” The mutant muttered, mystified. Percy just shrugged. “I can’t get cold.” He said flatly.
This had Tony leaning around to look at him. “Really?”
“I mean. I swim in the Artic in my spare time, so, yeah.”
Ned rubbed a tired hand through his hair. “Demigods are so weird.”
Percy stuck his tongue out at him. Mrs. O’Leary copied the motion as she hopped up on one of the seats at the counter. “Hey, buddy. We were here first. As far as I’m concerned, you guys are the weird ones.”
MJ paused. “Huh. Wait, if the whole Prometheus thing is real, does that mean evolution is fake?”
In an instant, six heads turned towards him. He just shrugged. “Listen, I stopped asking questions around the time I found out Santa’s sleigh came from Artemis.”
“ What ?”
“What?”
(Peter stuck to Percy’s back all day. When May offered to try and pull him off, Percy met her eyes as best as he could. “I benched the sky,” He said. “Peter can stay.”
“...alright.”)
Notes:
yeah reyna piper and jason are dating, and i will fight somebody on that
also emma's back :)
where does this fit in the timeline, you ask? nowhere. absolutely nowhere.
Chapter 14: defense budget who???
Summary:
Father of Five: you got stabbed.
crack dealer: uh oh got to skedaddle
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
gitc: @ ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ @Tony Stank do you guys know any good exorcists
Tony Stank: excuse me?
gitc: please
mindiana jones: [Video Attachment]
[Video Description: MJ is sitting on Peter’s bunk bed, pointing the camera down at the carpet. Slowly, she moves down, until the camera is level with the floor. Under the bed, you see one (1) Peter Parker, under the bunk. Ned tries to poke him, and Peter hisses at him. End of video description]
Tony Stank: what the actual fuck
Tony Stank: there is not enough room under that bed for him
Tony Stank: kid are you okay
gitc: hjkdhgjkhfuewh he reached an arm out and hes going for my r[phgrijne
gitc: hi mr. stark. this is peter. i am fine :)
Tony Stank: did you dislocate literally all of your joints??????
gitc: no
gitc: my bones are just stretchy
Tony Stank:
Tony Stank: please tell me i’ve suddenly lost the ability to comprehend english because im pretty sure you just said your BONES ARE STRETCHY
Tony Stank: THATS NOT SOMETHING THAT CAN HAPPEN
Tony Stank: you’re killing me here, underoos
mindiana jones: explain, peter
gitc: spiders have no bones. i had some bones. got bit by magic spider. I now have Some Bones Sometimes
mindiana jones: i…
mindiana jones: im getting ned his phone back.
Tony Stank: good. I… i need some time to think
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: peter, as someone who has extensive bone-stretching experience, i support you fully
baby avenger: thank you, percy
baby avenger: glad someone appreciates me
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :)
[Daniel Wén-Campbell has added Lee Van Keppel, Aspen Anev, Bridgette Lehey, Ross Bunmi, Mal Tanuk, and PJ to the chat]
[Daniel Wén-Campbell has changed the chat name to ‘hey robloxers’]
Lee Van Keppel: dan i have never respected you less
Daniel Wén-Campbell: thats fair
Daniel Wén-Campbell: but if im going down, im going down all the way
[Daniel Wén-Campbell has changed their name to ‘roblox hacker’]
Bridgette Lehey: jesus christ it got worse
Aspen Anev: roblox?? Really?
Bridgette Lehey: aspen!!!!!!!! <3 <3 <3 <3 <3
Aspen Anev: hi
Bridgette Lehey: :)
roblox hacker: simp
Bridgette Lehey: i’ll kill you.
roblox hacker: o-o
Mal Tanuk: f
Lee Van Keppel: @PJ @Ross Bunmi
Lee Van Keppel: answer, cowards
Ross Bunmi: hewwo
Mal Tanuk: blocked
PJ: what do you people want
Ross Bunmi: you, always <3
roblox hacker: oh??????
Ross Bunmi: i mean i have the love of my life but like
Ross Bunmi: damn if i wouldnt tap that. Anyways
Ross Bunmi: line up, fuckers
[Ross Bunmi has changed their name to ‘jason derulo’]
[Ross Bunmi has changed Lee Van Keppel’s name to ‘unique and unhinged’]
[Ross Bunmi has changed Mal Tanuk’s name to ‘egg’]
[Ross Bunmi has changed Bridgette Lehey’s name to ‘local MILF’]
egg: wh
local MILF: excuse me
egg: how come aspen was safe????
jason derulo: aspen <3
egg: ok thats fair
local MILF: 1) i have No children and 2) the commander escaped too???
jason derulo: aspen’s was out of love. commander jackson’s was out of vague fear
egg: what happened to being horny for death???
egg: fake smh
jason derulo: ok but i want to die in a sexy fun way
jason derulo: not murdered in a basement by my boss
unique and unhinged: i am very ok with this name
roblox hacker: you would be
unique and unhinged: >:(
PJ: guys. we are supposed to be looking into a missing persons case.
PJ: please.
egg: oh fuck right
Our family tree is a wreath
has a buzzfeed unsolved episode: leo you owe piper 5 bucks
mcshizzle: FUCK
pied piper: your vague but menacing secret agency???
has a buzzfeed unsolved episode: made the group chat today, just like you predicted
pied piper: fuck yeah pay up loser
mcshizzle: percy you really couldnt have kept it quiet for one more week
has a buzzfeed unsolved episode: and miss the chance of seeing you lose money? I think not
pied piper: hah ‘seeing’
has a buzzfeed unsolved episode: lmao
horse girl: piper dont be mean
pied piper: he thinks its funny!!!!!!!
framk: percy also thinks making ‘run through by the giant king and holding my organs in’ jokes is funny
has a buzzfeed unsolved episode: ok first off they are VERY funny and second
has a buzzfeed unsolved episode: do you know how specific the circumstances have to be to make those jokes??? It's harder than you think
sparky: so perce are you gonna do it
RARA: Do what?
my chemical ron weasley: hazel and i bet him he couldnt act like a Responsible Boss for a couple months
my chemical ron weasley: hes a good actor for sure, but we think he’s simply to chaotic and that will override it
RARA: That is one of the dumbest things I’ve ever heard, and I used to listen to Octavian talk.
pied piper: d a m n
has a buzzfeed unsolved episode: im giving my all
has a buzzfeed unsolved episode: i work regular hours. I remind them to finish deadlines. I hold conference calls. Ten minutes ago i assigned campbell extra paperwork for trying to revive flappy bird instead of writing his report.
pied piper: holy fucking shit
framk: who are you and what have you done with percy
has a buzzfeed unsolved episode: i am going to win this bet, franklin.
framk: for the last time you know thats not my full name
sparky: its funny every time though
mcshizzle: percy….my man….my welding bro……what has the wheel of bureaucracy and capitalism done to you.,.........,,,..
has a buzzfeed unsolved episode: oh dont worry last week rachel and i took sledge hammers and saws to some hostile architecture
has a buzzfeed unsolved episode: some guy tried to arrest us but i just pulled my badge out and told him the metal spikes on the ground were part of a alien plot to take over new york
horse girl: whoever let you in charge made a mistake
sparky: no no, let the man speak
has a buzzfeed unsolved episode: since we’re technically our own division, we get a defense budget for guns n shit straight from the government. last week we spent it on cupcakes and then donated the rest
has a buzzfeed unsolved episode: in the official report i wrote, it was spent on tracking down rogue hydra agents. It was really all mrs. o’leary and i sniffing them out.
has a buzzfeed unsolved episode: never in a million years will i be telling the WSC chairwoman that my team is simply too cool for guns, not when lee and ross made a separate budget for ‘funky outfits’
has a buzzfeed unsolved episode: i can only assume they mean supersuits and will soon become vigilantes. They think i don't know. I have no plans to stop them.
RARA: Jesus Christ.
we had a bonding moment! I cradled you in my arms!
Father of Five: percy why the fuck did i see you and your team unloading 16 crates of berry blue jell-o into your headquarters
Father of Five: i literally just came to drop your prescription off. Why
crack dealer: it was my turn to pick the snack
crack dealer: also thank you i havent had time to go pick it up
Father of Five: yeah i know thats why i got it
Father of Five: thats so much jell-o where did you get it
Father of Five: i swear to god percy where did you get that money
crack dealer: hanover gave us another grant for medical supplies and hospital bills cause i got stabbed but i just hopped in the ocean for a bit so we used the money for snack
Father of Five: you got stabbed.
crack dealer: uh oh got to skedaddle
Father of Five: PERCY JACKSON
Notes:
percy making SWORD think he's responsible? top tier comedy
they're gonna think hes all stoic and serious but really he spends his time taking his baby sister for ice cream and comiting misdemeanors with his cousins
also!! ideas!!! headcannons! love hearing them :)
percy and blue jell-o = saiki k and coffee jelly if you get my vibe
Chapter 15: too many froggy
Summary:
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but dont worry i got this
Tony Stank: NO
gitc: oh god oh fuck
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
Tony Stank: do you ever have someone come up to you and say something and you’re just like.
Tony Stank: w h a t
baby avenger: ye s all the time
baby avenger: like. please i do not understand you
gitc: me whenever someone talks about anything related to football in the slightest
mindiana jones: literally anything about crochet. I tried to learn once. it went horribly.
baby avenger: me with any literary reference 😔 ✊
baby avenger: like ma’am. I do not read unless its the instructions on my hot pocket
mindiana jones: really think you would have memorized them by now
baby avenger: im a biochemist not a chef
Tony Stank: first off, peter, i really hope you aren’t eating that many hot pockets. you need more nutrients than that, especially with your mutation
we had a bonding moment! I cradled you in my arms!
crack dealer: oh my god
crack dealer: and you still have the audacity to deny that child is your son
Father of Five: SH U T
SSEA
Tony Stank: second, this came from me trying to talk to a guy with a weird midwest accent
Tony Stank: he was an investor and pep wanted me to have a conference with him but i could not understand a single word coming out of his mouth it was horrible
Tony Stank: he already left and pepper is asking me how it went
Tony Stank: how do i tell her i don’t know
baby avenger: the mighty iron man,,,,,brought down by some fucker from ohio,,,,
mindiana jones: bold words, hot pocket man
baby avenger: we all have our weaknesses ok
baby avenger: football, people from kansas, crochet,,,,,
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: sign language
baby avenger: JGIAPRBSFFUI—
nick fury @12yearoldterrorist
the dinosaurs are still alive i just hid them in my trench coat
nick fury @12yearoldterrorist
[Photo Attachment: A blurry photo of a radish in low lighting]
merp @lowla
please marry me mr fury
weenie @cissiesmith
this is literally the first time he’s posted in months. what the fuck
Mr harrington please stop sending memes challenge
peterman: guys i think i fucked up
peterman: [Photo Attachment: Peter is sitting on the floor of a bathroom, completely surrounded by frogs. They are in his hair, on his clothes, covering the floor. Some are perched on the sink and the toilet seat.]
avril lavigne: far too many froggy. evacuate this instant
peterman: i cant
peterman: if i open the door they might get out
peterman: and the frogs are kinda,,,,,,secret
Murphy’s law: how the fuck did you get so many frogs
peterman: mr stark let me use his credit card,,,,,,......,.,.,,it was just supposed to be one
peterman: i got excited
moonmoon: you fucking dumbass
peterman: seriously what the heck do i do
bonmk @widget
Guys i just had the best idea
bonmk @widget → nick fury @12yearoldterrorist
bonmk: hey mr fury rate my meme
nick fury: hm. twist on a classic, but lacking a certain something. bonus points for making fun of the cap psas, though. 7/10
bonmk: thank you for your sage wisdom mr fury sir
hey robloxxers
jason derulo: @PJ
jason derulo: @PJ
jason derulo: @PJ
jason derulo: @PJ
PJ: what do you need, ross?
jason derulo: plant
jason derulo: i want to get an office plant
PJ: as long as you take care of it, i don’t see why not.
jason derulo: FUCK YEAH
jason derulo: @unique and unhinged WERE GETTING THE CHIA PET
unique and unhinged: wait oh my god really
egg: we’re getting a chia pet??????
roblox hacker: mal has begun to vibrate at a frequency only animals can hear
aspen: doggie chia pet?
local MILF: im down w doggie
unique and unhinged: seconded! Love doggie
jason derulo: i, too, approve of doggie
egg: we are getting that doggie
roblox hacker: fifth vote for the doggie :)
Egg: @PJ
jason derulo: @PJ
local MILF: @PJ
aspen: @PJ
unique and unhinged: @PJ
roblox hacker: @PJ
aspen: just heard him sigh all the way across the office lmao
PJ: yes, you can get the doggie.
egg: IM RUNNING
egg:
GOING TO STORE RIGHT NOW
PJ: mal, we are in the middle of a case, and you don’t get off work for another hour. Nice try, though.
egg: f u c k
our family tree is a wreath
has a buzzfeed unsolved episode: man this boss thing is so fun
Mr harrington please stop sending memes challenge
nedleedle: *staring out the window like a depressed victorian lady* when will my husband peter parker return from the war
peterman: as soon as he takes care of all these fookin froggs
Scary Captain: you are an idiot, parker
peterman: i know
peterman: i just. I didnt think it would work
moonmoon: you didnt think going online and buying things with a rich man’s credit card would work?????
peterman:
peterman: no 😔
[president lincoln has changed peterman’s name to ‘dumb little boy’]
dumb little boy: hEY
Scary Captain: it’s deserved.
dumb little boy: this screams transphobia. I cast my scorn upon you, abraham
moonmoon: wooooow abe
The News(™): smh you think you know a guy
Murphy’s Law: i cant believe you, abe
President lincoln: what????? Mj literally agreed with me?????
Avril lavigne: yeah, but its mj
moomoon: yeah
nedleedle: dont try to distract us from your prejudice, abe
dumb little boy: yeah ABE i cant believe you’d do this
Abraham lincoln: jesus christ fine im sorry
dumb little boy: :)
dumb little boy: i got all the frogg out safely though
dumb little boy: pj’s dog helped me. she’s surprisingly gentle w frogg
nedleedle: can confirm. I would trust that dog with my life.
Scary Captain: we all would, ned.
moonmoon: rt
SSEA
baby avenger: ya’ll ever watch keeping up with the kardashians
Tony Stank: if i wanted to see a trashy rich person id go look in a mirror
baby avenger: mr stark youre not trash :(
Tony Stank:
Tony Stank: thanks, kid
baby avenger: :)
gitc: yes i love that show
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i havent watched it but every time i hang out with my cousins piper and leo do a two man retelling of it and its timing is accurate down to the millisecond so id say im pretty well versed in the lore
baby avenge r: perfect.
baby avenger: im making a keeping up with the avengers version
Tony Stank: for who???
baby avenger: me :)
baby avenger: also the my school friends
baby avenger: i have everything worked out. They already know i just Am in the tower sometimes so there’s no questions there. If spider-man makes a cameo ill have karen change my voice
mindiana jones: this is a stupid idea. Ill help
baby avenger: i love you so much
nedleedle: what about percy?
baby avenger: eh the gc is kind of used to him just being himself, i doubt they'll ask any questions
nedleedle: fair
Tony Stank: if you’re sure, kid, i guess i dont really care
Tony Stank: just be careful. percy’s identity as Sentinel is an international secret, im pretty sure
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: all of SWORD’s info is
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but dont worry i got this
Tony Stank: NO
gitc: oh god oh fuck
Mr harrington please stop sending memes challenge
spicy: hi im tony starks illegitimate bastard half brother
moonmoon: W H A T
Notes:
tony really said 'im illterate like the rest of you gays'
also. ideas for an avengers reality show? if you have them id love to hear em
PSSST i got nominated for the irondad creator awards
there’s more info on their tumblr - @irondad-creator-awards
your fav's emotional wellbeing is going to be used as leverage for nominations and votes uwu
Chapter 16: robert <3
Summary:
Tony Stank: percy. I hate you
Tony Stank: why did you do this
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: cause
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
baby avenger: percy jackson what the fuck have you done
Tony Stank:
WHAT DID HE DO
Tony Stank:
PETER
baby avenger: [Attached Screenshot]
Tony Stank: PERSEUS JACKSON
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: uwu?
Tony Stank: IM GOING TO FUCKING KILL YOU
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i mean people have been trying since i was 12 but you’re welcome to give it a shot
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: who knows
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: maybe you’ll be lucky number 7243624
Tony Stank:
Tony Stank: im not going to touch that statement right now but rest assured we will be talking about that later
Tony Stank: peter what are the children saying
baby avenger: um
Mr harrington please stop sending memes challenge
Avril lavigne: AYO???????
President Lincoln: EX FUCKING SCUSE ME
The News(™): what did you just say
Murphy's Law: 👁️ 👄 👁️
moonmoon: asdagfdh??? SDHFREHG????
SSEA
baby avenger: [Attached Screenshot]
Tony Stank: percy. I hate you
Tony Stank: why did you do this
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: cause
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: it makes the most sense. its too late to pass me off as someone who works in the labs like peter. while it’s true they already know i’m your bodyguard, it dosen’t really explain why i do things like hang out in the tower, where you are at your most safest.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and if i was just your bodyguard, why would i be interacting with peter so much? they’re reasonably smart kids, they’d notice something was going on eventually.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and bastard half brother is a much better conclusion to get to than secret agent/ex-merc. It’s a classic technique—give them something that’s scandalous enough, and they’ll think they’ve gotten to the bottom of it.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: also i was bored
Tony Stank:
baby avenger:
mindiana jones: huh.
mindiana jones: did not see that coming from you. no offense.
Tony Stank: ok that’s. actually fucking smart but Pepper is still going to kill us.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: nah, pepper loves me
Tony Stank: ok so. she’ll kill m e
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: casualties of war.
Tony Stank: i feel like as my ex-bodyguard you should care more about this
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ex???? bold of you to assume i ever stopped looking out for your wellbeing, regardless of being paid to do so xoxo
baby avenger: he’s crying
Tony Stank:
I AM NOT
baby avenger: [Video Attachment: It’s a short clip. Tony is sitting in the lab, looking down at his phone. He is, indeed, crying a little.]
baby avenger: @percy you can hear his sniffles
Tony Stank: i no longer have a son.
baby avenger: hey that sounds familiar
baby avenger: sure hope i dont wake up in the orphanage again
gitc: PETER
mindiana jones: oh my god
gitc: WHAT THE FUCK
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: update: tony is crying more now
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: peter has been engulfed in Dad Hug(™)
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: he won’t be active for a while.
mindiana jones: so are we just going to ignore that they both acknowledged their father-son relationship?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: for the sake of both of their varying emotional states? yes.
gitc: you got it boss
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: now that the party pooper is gone, you guys wanna help me fuck with your classmates?
mindiana jones: do you even have to ask?
Mr harrington please stop sending memes challenge
moonmoon: PETER BENJAMIN PARKER DID YOU KNOW ABOUT THIS
The News(™): oh my god
Murphy’s law: how could you hide this from us,,,,,,i thought we were friends
Scary Captain: listen up, assholes
Scary Captain: for obvious reasons, this isn’t public knowledge. pj’s relation to tony wasn’t peter’s secret to tell, even if he’d had permission.
Scary Captain: and now that you do know about this, we all expect you to keep it quiet. very, very quiet. NDAs will be involved if necessary. Understood?
moonmoon: yes ma'am
The News(™): yep
Murphy’s law: yeah
Avril lavigne: sure thing
President lincoln: you don’t have to worry about us
moonmoon: flash, on the other hand though
The News(™): oh fuck i forgot about him
nedleedle: oh, dont worry about flash :)
Avril lavigne: oh??????
The News(™): n…ned????
nedleedle: yes, sally? :)
Avril lavigne: i love you
dumb little boy: hey step OFF of my mans
Murphy’s law: thats really what it took to revive peter????????
mindiana jones: clearly you don't know peter and ned that well.
hey robloxxers:
egg:
MR COMMANDER JACKSON SIR
egg:
I FINISHED MY REPORTS LIKE A GOOD LITTLE LAD CAN I GO GET CHIA PET
PJ: yes, mal. you can go get the chia pet.
egg: AJHJDSAAAAAAAAAA IM GOING
unique and unhinged: the lord’s work
roblox hacker: WAIT IM COMING TOO
PJ: no, you are not. mal has been responsible and finished her work early. you, however, have not.
roblox hacker: YOURE NOT MY REAL DAD
PJ: daniel.
PJ: i will take away all your unsolved cybercrime files.
roblox hacker: wait no im sorry please dont
roblox hacker: i love them
PJ: we’ll see.
egg: rip dan but IM IN MY CAR
aspen: Y E S
local milf: i despise this name.
local milf: but also we got a new mission so. Gather round fuckers, aspen, and our surpeme overlord jackson
[jason derulo has changed PJ’s name to ‘supreme overlord jackson’]
supreme overlord jackson: …
supreme overlord jackson: i’ll allow it.
jason derulo: AHFJDKSHAHFDJBURAOJKK
supreme overlord jackson: everyone, sans mal, come to the conference room.
egg: IM BACK AND I GOT THE CHIA PET
egg: I WAS FORCIBLY REMOVED FROM WALMART BUT THATS OK BC I GOT THE DOGG
local milf: what the fuck did you do?????
aspen: WHO CARES
aspen: BRING FORTH THE DOGGIE
jason derulo: we’re still in the conference room!!!
roblox hacker: what do we name doggie
unique and unhinged: something…mighty. Something to strike fear in the hearts of our enemies.
roblox hacker: robert?
unique and unhinged: you understand me <3
egg: everyone good with robert?
unique and unhinged: if you aren’t, come see me after work :)
jason derulo: y,,,,yeah,,,,,robert good
local milf: i agree with robert under severe duress
unique and unhinged: robert <3
[roblox hacker has changed the chat name to ‘robert <3’]
supreme overlord jackson: now that you have all come to an agreement, please focus on the debrief. we’re going to uruguay in two days.
egg: when your job lets you travel 😩
local milf: mal…
local milf: we are literally going to investigate an assasination.
egg: but we are doing so on a private jet, are we not?
jason derulo: shes got a point
aspen: im going to seize control of the jet.
supreme overlord jackson: no, you will not. the pilot will not tolerate nor fall for any of your schemes. i’d recommend not trying anything.
jason derulo: >:)
egg: >:)
unique and unhinged: >:)
supreme overlord jackson: expect no kind words at your funerals.
roblox hacker: woah????????
local milf: ayo?
supreme overlord jackson: phones away. now.
egg: jesus ok
feral boys
blonde superman: this is going to be so funny
blonde superman: ive never been happier to have gone through flight school
blonde superman: but how the fuck did you convince your boss to hire me to fly your top secret ops team’s jet
felon aquaman: oh, you know
blonde superman: i do not know but ok
blonde superman: should i be worried about your team?
felon aquaman: they will most definitely try something when they think i wont notice.
blonde superman: but you always notice
felon aquaman: yep
felon aquaman: they’ll learn that one day
blonde superman: ominous. I like it.
blonde superman: i won’t hold back
felon aquaman: i have zero (0) problems with you barking at and/or biting any of the team members
blonde superman: perfect
Notes:
yeah jason's a pilot lmao
just thought it would be very funny for our fav feral roman boy to exist within the vicinity of a plane's controls
jason 100% bites and i will die on this hill
SWORD team really dosen't know whats coming
*ahem* pov jason piloting a plane for the first time
hazel nico and percy, in the back: DO A FLIPhe became a pilot literally because it was so easy for him. jason just wanted money with little effort. king shit.
Chapter 17: he bite
Summary:
Honeybear: besides, they’re still only on the plane.
Honeybear: how much trouble can they get into? it’s just the team and percy
Notes:
you guys wanted feral jason the pilot content. here it is.
(See the end of the chapter for more notes.)
Chapter Text
robert <3
unique and unhinged: pilot? spotted
egg: it’s time, boys
jason derulo: >:)
local milf: commander?????
local milf: aren’t you going to do anything about this????
supreme overlord jackson: i warned them.
supreme overlord jackson: whatever comes next is their own fault
Tony for fucks sake go to sleep
Honeybear: your conference is tonight, right?
dumbest genius: yeah
dumbest genius: you sure you’re good to stay in the tower?
Honeybear: of course
Honeybear: i just dont see why peter needs watching
dumbest genius: well, i promised him he could use the labs today
dumbest genius: but that child is the secondary incarnation of chaos and should never be left unsupervised
dumbest genius: i just thank every greater power that percy isn’t here
Honeybear: where is he?
dumbest genius: some mission with SWORD
dumbest genius: im sure they’ll be fine
robert <3
egg: THE PILOT ATE MY KNIFE
local milf: what the fuck?
Tony for fucks sake go to sleep
dumbest genius: i know pepper gave you a copy, but heres another just in case
Rules For Keeping Peter Parker
- Don’t let him make another skittle omelet. Please.
- Under no circumstances should ned leeds enter the property. not only will he do literally anything for any form of star wars merchandise, the last time they were released into the R&D labs, we had to pay reparations
- seriously. ned filmed and whispered ‘so, is it any wonder people are afraid of technology?’ and peter, who decided he belonged in the vents in the ceiling, dropped down and screamed ‘TECHNOLOGY’
- Dr. Raan almost had a heart attack. Please, Peter. She’s so old.
- He likes to be in dark corners. Sometimes he naps. This is ok. Don’t fear.
- If he hisses, just nod. It’s easier for all of us.
- NO SPIDER-MANNING AFTER 1
- If he starts sobbing uncontrollably, call may. He probably just misses her.
- Don’t let him out of your sight. Seriously, peter once broke an arm in middle school trying to return a library book.
- He can be easily pacified with those calming videos meant for dogs. just ask FRIDAY, and she’ll pull up his favorite CGI meadow.
- Do not, i repeat, DO NOT, let him have access to the emergency PA system. A week ago, he announced ‘congratulations to ms. suarez for being the first to escape the simulation’ and the interns haven’t stopped twitching since
- Don’t let him play subway surfer. I don't know why he plays subway surfer so aggressively, but last time he almost ended up in prison. How? I don't know. I don't want to know. But percy isn't here to break him out, so it’s banned.
Honeybear: there is something severely wrong with this child
Honeybear: i’d die for him
Honeybear: but, yes. It’s probably best percy is on a strict, organized mission.
robert <3
unique and unhinged: BEEZUS BUCKING CHRIST
roblox hacker: HE BIT ME
roblox hacker: HE FUCKING BIT ME
egg: OH GOD I THINK WE LOST ASPEN
do you normally try to stab people who are blowing their nose?
sneezy: hey i just got a really weird vague prophecy moment
sneezy: i sense like. a great assault on your allies?????
sneezy: are you guys ok?
stabby: thanks for the concern, rachel, but we’re good
stabby: jason just started biting people though
sneezy: oh
sneezy: good luck
stabby: oh, trust me. I dont need it
stabby: my team on the other hand
robert <3
local milf: HES BARKING
local milf: THE PILOT BARKED AT ME
local milf: WHERE ASPEN??????
Tony for fucks sake go to sleep
Honeybear: are you worried?
dumbest genius: about peter or percy?
Honeybear: yes
dumbest genius: i’m worried peter will burn down the building.
dumbest genius: percy’s going into a foreign country to investigate an assassination. im a bit more worried about that
Honeybear: i’ve seen percy get hit directly in the head with a cinderblock and keep walking like nothing happened
Honeybear: i think he and the team will be fine
Honeybear: besides, they’re still only on the plane.
Honeybear: how much trouble can they get into? it’s just the team and percy
As soon as that text was sent, both Rhodey and Tony, in completely different locations, stared up from their phones, eyes wide.
“Fuck,” They whsipered. “It’s just Percy.”
They ran.
They both made it to Tony’s main lab at the same time.
“Fri,” Tony yelled, out of breath. “Connect a call to the SWORD jet, please!”
“One sec, boss.” She replied, chipper. Completely unaware of the impending disaster. Oh, the innocence. The blissful, blissful, innocence.
They waited, breath caught in their throats, as she projected the call onto the wall. It rang for a few seconds before Percy picked up.
Nobody said anything at first. Rhodey and Tony just stared at the hologram.
Percy was sitting calmly in one of the seats, a mug of tea in his hands. He was in comfortable clothes; sweats and a tee, plus a cream colored sweater. Not a hair out of place. He smiled at them.
Tony squinted. “Fri, turn up the volume, please.”
She obliged. And there it was.
Screaming, in the background.
There was a noise directly from under where the phone was on Percy’s end. Rhodey cleared his throat. Eventually, Percy huffed and picked up the phone, turning it so it faced down.
Dan laid face down on the jet floor, making a low groaning noise. There was a bite mark on his shoulder, exposed through torn fabric. He mumbled something, then tilted his head to the side so he could be heard.
“The consequences of my actions have already seeped into my bones and claimed them as their own.”
The screams in the background continued. Percy took a long sip of his tea.
Tony hung up the call.
Silently, he and Rhodey parted ways.
A few minutes later, Tony’s phone buzzed.
Tony for fucks sake go to sleep
Honeybear: mutual agreement we aren’t going to deal with that?
Tony sighed, and rubbed his temple.
dumbest genius: he’s uruguay’s problem now
Judas!!! no!!!!!
One hit KO : update: i will be left unsupervised in the tower
Loser 2: isn’t colonel rhodes going to be with you?
one hit KO: he’s woefully unprepared :)
not a loser: oh lord
one hit KO: what should i do today?
Loser 2: i vote the jetpack idea
not a loser: i hate the jetpack idea
one hit KO: ms. pepper said it would be a fun idea, hypothetically
not a loser: i love the jetpack idea
one hit KO: jetpack idea it is :)
robert <3
local milf: ASPEN
local milf: WHERES MY ASPEN
local milf:
SERIOUSLY NONE OF YOU BUT DAN HAVE EMERGED FROM THE COCKPIT
local milf: I HEAR SOBBING
local milf: DAN PASSED OUT
unique and unhinged: he
local milf: he?
unique and unhinged: bite
local milf: ????
egg: i now believe in god.
local milf: excuse me
jason derulo: i am a changed man
jason derulo: what happened in that cockpit will forever haunt me
local milf: the commander just took a big sip of his tea and went ‘as predicted’
jason derulo: that’s terrifying
jason derulo: where the FUCK did this pilot come from
aspen:
local milf: ASPEN!!!
aspen: .,;kf
[aspen has added local milf, egg, jason derulo, unique and unhinged, roblox hacker, and JG to a chat]
[aspen has changed JG’s name to ‘potential rabies risk’]
local milf: what the fuck
potential rabies risk: hi :)
local milf: whomst
potential rabies risk: pilöt
egg: is your presence punishment for past sins
potential rabies risk: not yet
egg: …..,,,,oh?
aspen: tell them what you told me
potential rabies risk: i know commander jackson?
roblox hacker: wow that weird so do i
unique and unhinged: hey me too wtf
local milf: both of you istfg
aspen: elaborate my guy
potential rabies risk: oh!
potential rabies risk: i’ve know your guys' team lead since we were teenagers
jason derulo: !!!!!!!!!!!
unique and unhinged: 🔫 embarrassing stories
egg: oh my god yes
potential rabies risk: well
potential rabies risk: uh
potential rabies risk: there aren't any
roblox hacker: what do you mean?
potential rabies risk: i mean i’ve known him for over a decade. for a long portion of that time, we were in close quarters every day. after that, we talked weekly. and not once has he revealed any personal information or even smiled.
potential rabies risk: he once told us he was exactly six feet tall. but that’s it. that’s all we have.
egg: oh my god
egg: what the fuck
roblox hacker: is he secretly a robot????
potential rabies risk: i wouldn't be surprised
potentia l rabies risk: I saw him suplex a guy three times his size and there was nothing but a huge fissure in the ground left behind.
potential rabies risk: once he and my sister dueled to the death and nobody is sure who won because the battlefield was completely obliterated.
potential rabies risk: we fought once, in this random field in kansas when we were 17, and my girlfriend had to knock him about because he was about to legitimately murder me
aspen: i think i speak for all of us when i say i’m fucking shaking
potential rabies risk: shrug
[potential rabies risk has left the group chat]
feral boys
blonde superman: you’re right this is SO MUCH FUN
aspen, local milf, egg, jason derulo, unique and unhinged, roblox hacker
local milf: DI D Y OUGUYS SEE THAT
egg: WHAT
unique and unhinged: after the plane landed the pilot and commander went off to the side to speak and ????
unique and unhinged: i swear to god they were just barking
roblox hacker: McScuse me
unique and unhinged: i know im a professional gaslighter but i swear to god they’re barking
unique and unhinged: i thought it was mrs. o’leary at first
egg: wait oh my god
egg: they ARE barking
egg: the shit????
aspen: so i guess they DO know each other
roblox hacker: pilot boy was telling the truth????
local milf: i suppose?
unique and unhinged: ok wait im gonna go after the commander
unique and unhinged: he’s getting off the plane
unique and unhinged:
unique and unhinged:
unique and unhinged:
aspen: bro?
jason derulo: shawty???
unique and unhinged: me: hey do you know the pilot?
jackson: jason? yes. we were trained by the same person.
me: and the barking?
jackson: what barking? lee, are you alright?
roblox hacker: im.
roblox hacker: im too tired for this
roblox hacker: good night
local milf: its 2pm
roblox hacker: i said good night
Notes:
thanks to snufflesthepig and InsomniacForevermore for some of these ideas :)
peter is the second chaos incarnate. percy is the first.
percy and rachel's chat is something i think is very cute-
jason: bark
percy: bark bark
SWORD: ayo?just feral lads
Chapter 18: tungsten dioxide whats this
Summary:
Keeping up with the avengers begins
Notes:
(See the end of the chapter for notes.)
Chapter Text
our family tree is a wreath
horse girl: hey percy
horse girl: can you come over and bake cookies with me?
has a buzzfeed unsolved episode: camnt
has a buzzfeed unsolved episode: hyidia suerpholsdier threww m e tho=rough a buildging
horse girl: oh
SSEA
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: fuck
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: you motherfucking bitch come at me you little shit
Tony Stank: excuse me
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i fucking hate uruguay what the shit why no don’t do that mal i swear to the gods
mindiana jones: …did he leave speech to text on?
gitc: oh my god
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: mal stop that right now do not
baby avenger: huh
baby avenger: wild
robert <3
unique and unhinged: i consider that mission a wild success
local milf: ?????
local milf: your wrist is in a brace??? mal got shot??? jackson’s body literally got used as a wrecking ball???
unique and unhinged: but did we die
jason derulo: he’s gotta point
unique and unhinged: <3
jason derulo: <3
roblox hacker: ew
unique and unhinged: stfu and let us be gay
local milf: actually though
local milf: where is everyone
unique and unhinged: got checked out by the paramedics
unique and unhinged: cleared :)
jason derulo: and i await for my lover to be returned to me
unique and unhinged: omw !!
aspen <3 wendy’s
local milf: what
aspen <3: wanted frosty
local milf: ?????? what the fuck aspen
roblox hacker: oooh oooh get me one
aspen <3: chocolate?
roblox hacker: ofc
roblox hacker: i’m in the van btw
local milf: ill come join you
local milf: commander? Mal?
jason derulo: boy? Retrieved
jason derulo: [Image Attachment: Ross is sitting on the edge of a hospital bed, Lee’s head in her lap. They’re both smiling. Lee is holding up a peace sign, wrist in a thick brace.]
aspen <3: ha gay
aspen <3: mal’s still in surgery. she’s def gonna make it tho
aspen <3: no clue about jackson. probably being wrestled into the ICU or something
roblox hacker: wait seriously?
roblox hacker: how bad is it?
jason derulo: well i mean
jason derulo: im pretty sure there’s a jackson shaped hole in like. at least three concrete walls
roblox hacker: fuck
supreme overlord jackson: don’t worry about it.
jason derulo: lee’s on concussion watch so. no more screens
jason derulo: i will be typing for the both of us
jason derulo: “ AYO?” -lee
supreme overlord jackson: i drank some water. I’m fine now.
local milf: i’m fairly sure your ribs snapped
supreme overlord jackson: i drank some water.
roblox hacker: hydration do be like that i guess
local milf: that sounds fake but i dont know enough about drinking water to dispute it
aspen <3: closing in on your location with dan’s frosty and a bottle of water which you will be drinking
supreme overlord jackson: mal is fine. bullet wound to the thigh, just a graze. didn’t clip any major arteries. she’ll be on desk duty for a while, but she’ll make a full recovery.
local milf: can we see her?
supreme overlord jackson: soon. they’re just getting her room set up.
our family tree is a wreath
mcshizzle: so that’s my opinion on sea cucumbers
sparky: huh
sparky: interesting
pied piper: speaking of sea cucumbers
pied piper: @hasabuzzfeedunsolvedepisode you good
has a buzzfeed unsolved episode: if i had a nickel for every time my ribs stuck clean out of my body, i’d have two nickels. which isn’t a lot, but it’s weird that it happened twice
my chemical ron weasley: what the fuck
my chemical ron weasley: where are you
has a buzzfeed unsolved episode: hospital in uruguay
has a buzzfeed unsolved episode: i’m my teammates medical proxy so
horse girl: is everyone alright?
has a buzzfeed unsolved episode: yeah
has a buzzfeed unsolved episode: lee’s wrist is sprained pretty badly, and mal got shot
has a buzzfeed unsolved episode: but i didn’t raise no little bitches so
has a buzzfeed unsolved episode: mal is already awake and loudly demanding plastic dinosaurs as a reward
mcshizzle: i love these people
sparky: is mal the first one i bit?
has a buzzfeed unsolved episode: no, that was dan
has a buzzfeed unsolved episode: but close enough
SSEA
Tony Stank: just got off the phone with lee and ross
Tony Stank: SWORD’s fine. They’re just going to have to stay in uruguay for a few more days
gitc: nobody got hurt?
Tony Stank: uh
Tony Stank: well
Tony Stank: according to them, lee’s got a sprain, mal got a very small bullet wound thats already stitched up, and percy
Tony Stank: ‘did some freelance demolition with his own body, but gaslight gatekeep girlbossed the hospital into clearing him’
Tony Stank: so take that as you will
baby avenger: i want to be percy when i grow up
Tony Stank: im literally begging you do not
Tony Stank: besides, nobody can match his aura of pure destruction and chaos
baby avenger:
Tony Stank: WAIT
Tony Stank:
NO
Tony Stank: PETER THATS NOT A CHALLENGE
Tony Stank: KID IM BEGGING YOU PLEASE
baby avenger: uwu
mr harrington please stop sending memes challenge
dumb little boy: i have Content
President lincoln
:
moonmoon: jesus christ abe
moonmoon: how did you respond that fast
President lincoln: ; )
The News(™): feed us the content, father
avril lavigne: yes, father. feed your children
murphy’s law: noticeable lack of content :/
murphy’s law: father is…cruel? father is….unloving?
moonmoon: father wishes us to starve?
moonmoon: oh, the humanity!
dumb little boy: [Video Attatchment: The video opens with someone holding up a title card in front of the screen. In crayon, it says ‘keeping up with the avengers’. A little theme song plays on what sounds like the oboe.
The next shot moves to Peter, sitting in a sole chair under a bright light.
Ned: Alright, we’re rolling.
Peter: Ok! Cool. Hi, I’m Peter, and welcome to my sexy new reality show, Keeping Up With The Avengers. Because y’all respect them a little too much.
Ned giggles behind the camera.
Peter: Alright, let’s meet our stars.
The video transitions like a bad powerpoint. Now, Tony Stark is sitting in the chair. He’s visibly cringing under the bright light. At the corner of the screen, it says Tony Stark; Billionaire, Playboy, Philanthropist, Gives Good Hugs.
Tony: Christ, kid. The things I do for you…
He clears his throat.
Tony: Hello, my name is Tony Stark. Also known as Iron Man, in case that’s news.
Peter, now also behind the camera: Tell us some fun facts about yourself!
Tony, sighing: Alright, uh…
He holds up three fingers.
Tony: Number One; I’ve been awake for three days. Number Two; I’m allergic to asparagus but I eat it anyways. Number Three; I’m fully aware both these things could kill me, and I hope they do.
Peter, quietly: Mr. Stark, no.
The video transitions again. Now, Colonel James Rhodes is sitting in front of the camera. The corner of the screen says Colonel James Rhodes; Air Force Pilot, Original Tony Stark Stan, Holder Of The Best Banana Bread Recipe In The Galaxy.
Rhodes: Hey. I’m James Rhodes. People call me Rhodey. I once saw Tony try to consume an entire fistfull of bolts, I can lick my elbow, and my favorite animal is the stegosaurus.
Peter: Fantastic choice.
Rhodes: Thank you.
Peter: …Did he actually eat the bolts?
Rhodes: He most certainly tried.
Now, Pepper Potts, looking radiant as always, sits in the chair. The corner reads Pepper Potts; Glowing Goddess, Girlboss CEO, Literally Queen.
Peter: Hi Ms. Potts :)
Pepper: Hi, Peter.
She smiles at them. MJ swoons behind the camera.
Pepper: I’m Pepper Potts, Tony’s friend and CEO. I’m allergic to strawberries, have a cat named Nutella, and my favorite color is buttercup yellow.
Peter: Everything you do amazes me.
Pepper laughs.
Now, the camera switches again. Peter, MJ, and Ned are squished together in one chair. Words on the screen, in comic sans, say meet the crew!
MJ, in a monotone: Hi, I’m MJ, and these two losers are Ned and Peter.They came up with this idea. I’m just here to bask in Pepper Potts’ presence.
Ned: Pepper Pott’s presence. Try saying that five times fast.
Peter tries. It does not go well.
Peter: Anyways. Hi! This is just a Pilot episode. Everyone’s here but PJ and Lea, but we’ll introduce them soon.
Again, we cut to Tony.
Peter: Before we go, Mr. Stark, is there anything you’d like to say?
Tony sighs for a second, considering. Then,
Tony: Wait, who’s gonna see this again?
Peter: Just my AcDec friends.
Tony: Oh, alright. Then yeah, I have a few things to say.
Peter: Tea?
Tony: First off, PJ, you bastard, I know you’ll see this eventually. Stop with the fucking Moses impression. The interns already have a thing about you. Please.
Tony: Second of all, whoever told him to wink every time he lifts some heavy equipment for said interns down in the labs, you’re dead. Dead, you hear me?
Tony: Uhm, what else… Oh! AcDec kids, you aren’t allowed to meet PJ. Ever.
Tony: That’s it. I think. Wait!
He smiles widely at the camera.
Tony: Pep, Platypus, I love you.
As the video cuts off, you can hear Peter and Ned awww ing.
End of Video]
dumb little boy: jesus christ guys i was just waiting for the video to send
moonmoon: we are fed
The News(™): that was some cute shit eye—
President Lincoln: pepper potts has a cat???
gitc: she does and she’s amazing
avril lavigne: tony stark eats scrap metal confirmed
avril lavigne: god i love it here
moonmoon: send a video of rhodes licking his elbow
moonmoon: for science
Murphy’s law: please tell us there will be more of this
dumb little boy: only if you change my screen name
moonmoon: you drive a hard bargain, parker
[moonmoon has changed dumb little boy’s name to ‘tungsten dioxide whats this’]
tungsten dioxide whats this: this is so much worse
The News(™): too late you gave us your word
tungsten dioxide whats this: dammit
President Lincoln: also why arent we allowed to meet pj in person?????
moonmoon: and what was with all the stuff stark said??? moses impression?? lab interns??
tungsten dioxide whats this: oh uh
gitc: hes hot
tungsten dioxide whats this: n e d
gitc: why are you booing me?? Im right
gitc: whenever he goes down to the r&d labs for whatever reasons the interns all lose their minds
moonmoon: its now occurring to me we actually havent seen his whole face
tungsten dioxide whats this: yeah…
tungsten dioxide whats this: i heard from mr. stark once he wore a crop top and
tungsten dioxide whats this: many very expensive things were dropped that day
Avril lavigne: …
Avril lavigne: ok i want to meet him
Murphy’s law: yeah me too
moonmoon: I Will Find Him
tungsten dioxide whats this: god please no
tungsten dioxide whats this: im begging you dont
gitc: you shouldve listened to mr. stark
tungsten dioxide whats this: 😔
Notes:
nobody:
percy: hydrate or diedratepercy is def the gaslight portion of gaslight gatekeep girlboss
also. he's hot. we know it. they know it. the interns know it. the only one who does not know it is percy.
poor hazel just wanted to bake cookies :/
and in case you missed it, i made a playlist for my version of percy :)
plumbing baby. goodbye.
https://open.spotify.com/playlist/5sKSwyVzRWA718FPuswNcS?si=38e7a74ef2654b84
Chapter 19: oh no. hes hot
Notes:
(See the end of the chapter for notes.)
Chapter Text
robert <3
local milf: mal
local milf: mal where are you
egg: ;)
local milf: mal please
unique and unhinged: mal this is serious
local milf: there is a HOLE in your LEG
local milf: dont be playing these games
egg: you'll never take me alive
unique and unhinged: so be it.
unique and unhinged: you will severely regret your words in about three minutes.
local milf: wait what
local milf: you are literally at walmart with me what are you going to do
unique and unhinged: oh, nothing
unique and unhinged: it's not me they need to be worried about.
roblox hacker: o.O
egg: your threats mean nothing to me
egg: i refuse to rest
unique and unhinged: wait for it
egg: HOLYY FYUCK PERCYU JACOSON IS STANDINH BEHIND ME REMEMBER MEFHUHGVREJKQJABHOVWIBEVDHIASBGRWO
jason derulo: what the everloving fuck
jason derulo: why am i suddenly scared
local milf: lee is currently picking out a squash but said
local milf: “i don't know, have you been resting like you are supposed to?”
local milf: you did get banged up a bit, you should take a break.
jason derulo: says YOU i’m working on these reports until i drop dead
jason derulo: fuck
jason derulo: oh my god why did it get so quiet
jason derulo: guys i think our boss is coming to kill me
jason derulo: i can hear him comingbgehraiuwefbhAGWH
roblox hacker: 0-0
local milf: aspen?
local milf: are you still working?
roblox hacker: they are!!!!!!
roblox hacker: i saw them at their desk while i was leaving!!!
aspen <3: you fucking SNITCH
aspen <3: betrayal cuts deeper than any mortal blade. it draws blood like never seen, causes pain like never before felt, beyond compare. its agony lingers; a dark shade upon a once shining soul.
aspen <3: i shall never be the same again. this day, the actions of a man i thought honorable, one i considered a dearest comradeghreoafijwehr4ut35gtrgfbt
supreme overlord jackson: mal, aspen, and ross have all lost phone privileges for the time being. they have also all been put to bed like the children they are.
supreme overlord jackson: attempts to liberate them will be met with severe consequences.
roblox hacker: can i work???? im Not Injured
roblox hacker: and why did lee escape???? he got his wrist McFucked
supreme overlord jackson: lee is at walmart picking out produce. he isn’t even carrying any bags. they got a cart.
local milf: wait how the fuck did you know that last part
supreme overlord jackson: i take my employee’s safety and recovery very seriously.
local milf: …ok
supreme overlord jackson: and yes, dan. you can get some work done as long as you leave at a reasonable hour.
roblox hacker: FUCK yes
roblox hacker: im about to cybercrime my way to internet glory on a 2005 barbie laptop
local milf: …have fun with that
roblox hacker: i most certainly will
our family tree is a wreath
has a buzzfeed unsolved episode: the kid im babysitting has asked me to participate in a reality show
pied piper: you’re babysitting?????? aren’t you like. living in stark tower?
has a buzzfeed unsolved episode: well yes
has a buzzfeed unsolved episode: but im babysitting his child
sparky: he has a kid?
has a buzzfeed unsolved episode: legally? maybe. biologically? jury’s out. emotionally? yes.
has a buzzfeed unsolved episode: his name is peter and he is very small
mcshizzle: ah
horse girl: how are your ribs?
has a buzzfeed unsolved episode: pretty much healed. my team on the other hand
has a buzzfeed unsolved episode: three of them have been forcefully put to nap time
framk: oh gods
horse girl: not the imposed rest
my chemical ron weasley: i still have nightmares
my chemical ron weasley: not even will is as bad as you
has a buzzfeed unsolved episode: well, someone had to keep you alive <3
my chemical ron weasley:
my chemical ron weasley: <3
horse girl: aw
my chemical ron weasley: hazel if you were anyone else i would stick an army of the undead upon you
horse girl: i know :)
nick fury @12yearoldterrorist
hydra was responsible for america’s got talent but the president just didn't want you to know
UN @UnitedNationsOffical
mr fury?????
WSC @WorldSecurityCouncilOffical
sir please respond to our dms
mr harrington please stop sending memes challenge
tungsten dioxide whats this: for you, lil uzi, a rob zombie poster
moonmoon: RREEEEEEEEEE
president lincoln: RYEEAHHHHHH?????
The News(™):
what do you have for us
tungsten dioxide whats this: :]
tungsten dioxide whats this: [Video Attachment}
[Video Description: We once again get the Keeping Up With The Avengers title card and theme song. We then move to a shitty plastic chair sitting in the middle of an empty room.
Peter, from behind the camera: PJ’s home now, but I don’t trust you guys to know what he looks like.
The camera moves closer. There is a cellphone on the seat. It rings. Peter reaches out and accepts the call.
Peter: Hey, PJ.
PJ: Hi, Peter.
Peter: Thanks for agreeing to this.
PJ: With how vague and suspicious you were? How could I not?
Peter: Fair. Introduce yourself, please.
PJ: Hey. I’m PJ, and I threw a printer at my teacher in the fifth grade.
Peter: Ouch. Was it deserved?
PJ: Undoubtedly.
Peter: Sick. Before you go, do you have any advice for my friends?
PJ: Hm.
PJ: If a hot older guy asks you to go into the woods with him, say no. Don’t get into elevators with chihuahuas. Uh, don’t go to Alaska.
PJ: Lastly, friends murder each other all the time.
PJ: That’s it.
Peter:
Peter: That was unsettling. Thank you.
PJ: Anytime.
The line goes dead.
End of video description.]
moonmoon: im
moonmoon: WHY WONT YOU LET US SEE HIS FACE
tungsten dioxide whats this: YOU KNOW WHY
murphy’s law: his voice 😩
tungsten dioxide whats this: SEE THIS??? YOU SEE THIS BEHAVIOR???
avril lavigne: HE SOUNDS HOT
nedleedle: its better in person
president lincoln: REAL SHIT???
tungsten dioxide whats this:
tungsten dioxide whats this: yall have issues.
moonmoon: your opinion is invalid here
moonmoon: obviously you don’t find your surrogate father’s illegitimate brother hot
tungsten dioxide whats this: thats a lot of words
tungsten dioxide whats this: too bad im not reading them
Judas!!! No!!!
one hit KO: I FORGOT ABOUT THE BROTHER THING JFREBVFUIBQIEWAU
Loser 2: oh my god me too
Loser 2: WAIT
Loser 2: OH MY GOD PERCY IS IN THIS CHAT
one hit KO: …
mr harrington please stop sending memes challenge
murphy’s law: peter you can’t deny it
murphy’s law: from an objective standpoint
tungsten dioxide whats this: you 👏 havent 👏 seen 👏 his 👏 face
moonmoon: ned says hes hot!!
tungsten dioxide whats this: NED IS A WHORE
president lincoln: yikes
nedleedle: no hes right
avril lavigne: we need a tie breaker
avril lavigne: mj?
mindiana jones: hm?
mindiana jones: oh
tungsten dioxide whats this: mj please
mindiana jones: that man is a masterpiece of a human. absolute 15/10.
tungsten dioxide whats this: NO
Judas!!! No!!!
not a loser: why are you guys using the private chat?
not a loser:
not a loser:
not a loser:
not a loser:
not a loser:
Loser 2: oh god shes buffering
one hit KO: mj,,,,,,,,
not a loser: parker.
not a loser: fix this.
not a loser: p l e a s e
one hit KO: i swear ill do my best
Loser 2: godspeed
Rowdy Boys
Small™: hey percy
Small™: do you ever check the acdec chat???
jalapeno eating king: no
jalapeno eating king: i say this as nice as possible
jalapeno eating king: if i wanted to hear the equivalent of eight wombats screaming at each other i’d visit my family
jalapeno eating king: i dont even know why im in that
jalapeno eating king: i only show up when summoned
jalapeno eating king: why?
jalapeno eating king: should i check it?
Small™: NO
Small™: nope. everything is fine
Small™: I was just wondering
Notes:
i genuinely dont know what this is. i was listening to the backstreet boys the entire time and my hands have gone numb
uhhh two new playlists!!! one for peter and one for tony.
peter: https://open.spotify.com/playlist/2qPXxv8bh8PdsOYOKppDU7?si=29e7a13b5eb748b4
tony: https://open.spotify.com/playlist/2GD4dxL3LpXD7304WURPTl?si=56148907c2094df9you can also find these ones, plus percy's, on spotify @denimbeans
i am also still taking song recs!!! drop em if you have em :)
plumbing baby. goodbye
Chapter 20: cube earth
Notes:
(See the end of the chapter for notes.)
Chapter Text
The Boys
none pizza left beef: has mj recovered
strawbebby: i dont think he checked the chat. but.
strawbebby: its bad, ned
strawbebby: [Video Description: Peter is sitting on his bed, filming MJ, who is standing in his bathroom. “I…I think you’re blowing this out of proportion.”
“Am not,” MJ’s muffled voice replies.
“There’s not even enough water for you to drown in. You’re just getting your face damp.”
The video cut off as MJ reached for the tap.]
none pizza left beef: oh god
robert <3
egg: i return
jason derulo: we have been freed
aspen <3: can’t believe dan helped jackson euthanize me
jason derulo: fuckin narc
[jason derulo has changed roblox hacker’s name to ‘class traitor’]
[jason derulo has changed their name to ‘certified monster fucker’]
local milf: …
egg: was venom on the news again
certified monster fucker: you know it
class traitor: i despise this name change but i'll ignore it for now
class traitor: cause like
class traitor: that tongue
certified monster fucker: RIGHT?????
certified monster fucker: dear god the things i’d let that man(?) do to me
aspen <3: friendly, gentle, and loving reminder that this is a group chat and i possess the ability to kill someone and not get caught
certified monster fucker: teacher!!!! teacher, they’re threatening me!!!
certified monster fucker: this is harassment! I have the right to free speech >:(
class traitor: @supremeoverlordjackson
supreme overlord jackson: and yet, you choose to say this.
supreme overlord jackson: unfortunately, i have suddenly lost the ability to read. i will be looking into this immediately. in the meantime, it seems i will be of no assistance.
certified monster fucker: HEY MAN WHAT THE FUCK
egg: he really just said ‘fuck horny rights’ and dipped
egg: king
certified monster fucker: i will claw my way out of this mortal prison and one day assume my place as it’s rightfull ruler.
egg: what
Coolest Intern @peterparkour
I got my lab privileges revoked for telling my friends tony stark is secretly bald
Coolest Intern @peterparkour
“eat the rich” you all say. but where were you when i needed you
merp @lowla
I?????? Hello????
Frogsareneat @littlegreenboy
HES BALD?????
Coolest Intern @peterparkour
no but imagine if he was lmao
merp @lowla
EYE—
mossboy @localfungi
did. did THE tony stark G R O U N D you???
Coolest Intern @peterparkour
yes he did the BASTARD
mossboy @localfungi
…does he ground all his interns or????
Coolest Intern @peterparkour
NO
Coolest Intern @peterparkour
JUST ME
You Know Who I Am @TonyStark
that’s because none of the other interns randomly look at the security cameras and go ‘this is it, viewers. this is my villain origin story’ whenever something slightly inconvenient happens. you’re not on a reality TV show, and you’re scaring the other interns
Coolest Intern @peterparkour
not my fault they’re little weenie punk bitches
weenie @cissiesmith
im sorry this entire thread is fantastic but TONY STARK SHOWED UP TO TELL OFF HIS KID??????
mossboy @localfungi
dr stark is this your illegitimate child im begging you
mossboy @localfungi
@peterparkour is this man your father
Coolest Intern @peterparkour
bro i have so little parents right now
weenie @cissiesmith
??????
You Know Who I Am @TonyStark
he is an orphan.
mossboy @localfungi
OH
Coolest Intern @peterparkour
yeah no one day i came home and tony stark was just sitting in my apartment flirting with my aunt. he told me i had an internship and now he has brunch with my aunt and my friend’s moms :/
ferris wheel fighter @uhov4hiorei
im sobbing
Rowdy Boys
Small(™): at this rate im going to post that video of mr. stark sobbing while watching coco
jalapeno eating king: i’ll forge your name back on his will after you are inevitably removed
Small(™): IM IN THE WILL????
mr harrington please stop sending memes challenge
president lincoln: peter if you give us more Hot Man content i’ll do your english assignment
tungsten dioxide what's this: …
Judas!!! No!!
Loser 2: you know he’s still in this chat
one hit KO: i do
one hit KO: but he never checks it
one hit KO: and honestly?
one hit KO: i think percy ‘get that bag’ jackson, the same man who kept a straight face while tony gave me fifty dollars to, and i quote, go get a bag of chips or something, would respect me for doing this
Loser 2: if you say so
tungsten dioxide what’s this: [Video Description: It’s an audio recording with a timestamp. While they vary as the video goes on, they are all marked somewhere around 2:00 AM.
PJ, sounding tired: I’m awake, right?
FRIDAY: Correct
PJ: …And snakes don’t have legs?
FRIDAY: Right again
PJ: Oh thank fuck
PJ: What do people think really happened at the Hoover Dam in 2006?
FRIDAY: A series of technical malfunctions. According to reports, two large statues were also stolen.
PJ laughs.
PJ: Hey, FRI?
FRIDAY: Yes?
PJ: Hypothetically, if I admitted to Tony I only had half my genes, do you think he’d be concerned?
FRIDAY: …Yes. As would I. Do you only have half of them?
PJ: …No?
PJ, mumbling: Gods, who does Dr. Phil think he’s kidding?
FRIDAY: What?
PJ: What?
End of video description.]
tungsten dioxide whats this: he likes to talk to FRIDAY when he can’t sleep
moonmoon:
murphy’s law:
president lincoln:
tungsten dioxide whats this: WAIT
tungsten dioxide whats this: NO NO NO NO FUCK
moonmoon: HIS VOICE IS ALL LOW
president lincoln: ITS SO RASPY
avril lavigne: what?
avril lavigne: oh
avril lavigne:
avril lavigne: h ol y fu c kk
tungsten dioxide whats this: SHIT
tungsten dioxide whats this: I DIDNT THINK THIS THROUGH
tungsten dioxide whats this: NED I GAVE THEM MORE AMMO
nedleedle: f
nick fury @12yearoldterrorist
the earth is not flat. it’s actually a cube. the mountains are the corners.
nick fury @12yearoldterrorist
there is satellite footage to confirm this.
Trending:
#WHERESTHEFUCKINGFOOTAGE
#nickfuryaccount
#giveusthefootage
#realearthshape
#suckthisflatearthers
Tony for fucks sake go to sleep
Honeybear: why did one of my coworkers just ask me to ask you to build a space ship
Dumbest genius: probably the same reason i keep getting tweets asking me to go to space and see what shape the earth is
Honeybear: that fury parody account???
Dumbest genius: THE FURY PARODY ACCOUNT THAT JUST POSTED A SELFIE???
Honeybear: what
Dumbest genius: ITS FURY
Dumbest genius: HOLY FUCK ITS HIM
Dumbest genius: THERES NO EVIDENCE OF PHOTOSHOP
Honeybear: are you fucking kidding me
Dumbest genius: I DONT KNOW
Dumbest genius: rhodey im about to lose my shit
Dumbest genius: im at my wits end
Dumbest genius: im in the labs with peter and im trying to figure out how to tell him that all the storms we’ve had this week aren’t because the earth is mourning with MJ’s dignity (????) but because percy’s cousin has been in a losing streak in minecraft bedwars and keeps getting his ass kicked by middle schoolers
Dumbest genius: i cant deal with this right now
Dumbest genius: i need a nap
Dumbest genius: just an hour. that’s all i ask for
we had a bonding moment!!! I cradled you in my arms!!!
crack dealer: and so i arrived like a group of feral hogs at the retirement home picnic
Dumbest genius: scratch that
Dumbest genius: i need to sleep for at least a few weeks
Honeybear: thats a coma
Dumbest genius: so be it
Notes:
i dont know if any of you caught this but the 'we had a bonding moment!! i cradled you in my arms!!' chat between percy and tony is a reference to the first book when tony held percy after he got shot at the gala---
ALSO WHO THE FUCK COMMENTED THE IDEA OF PERCY AND FRIDAYS CONVERSATIONS BECAUSE FOR THE LIFE OF ME I CANT FIND THEM AND IM GOING INSANE
UPDATE snuffles the pig has taken credit for this. mystery solved. it was a cold case for two years but we did it, boysyall: fury account reveal???
me: : )plumbing baby. goodbye.
Chapter 21: it's either coding, or crack
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
Tony Stank: big announcement
baby avenger: omg
baby avenger: are you coming out of the closet
Tony Stank:
Tony Stank:
Tony Stank: i think i came out when a photo of me making out with the prince of england made the front cover like 20 years ago
baby avenger: oh right lmao
Tony Stank: i worry about you, kid
Tony Stank: anyways. I got barnes a phone
gitc: sergeant barnes?????
Tony Stank: yep
[Tony Stank has added James Barnes to the chat]
Tony Stank: im sure i’ll regret this later
gitc: now why on earth would you regret t h i s
gitc: also!! hi sergeant barnes!! im ned!!
James Barnes: hi
gitc: you
gitc: you turned his autocaps off?
Tony Stank: i felt a vibe
[baby avenger has changed James Barnes’s name to ‘skrunkly raccoon’]
skrunkly raccoon: ok
skrunkly raccoon: its very nice thank you peter
baby avenger: :D
gitc: the other two people are our friend MJ, and percy
gitc: @mindianajones @ ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ
mindiana jones: im busy what you want bitch
mindiana jones: oh
mindiana jones: hello, sergeant barnes
Tony Stank: hey percy isnt answering his phone
Tony Stank: do you know where he is?
mindiana jones: hm
mindiana jones: percy. rise.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: Hello
Tony Stank:
Tony Stank: ok
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: hi, james
skrunkly raccoon: hi, percy
gitc: hows the phone working out for you?
skrunkly raccoon: confusing
skrunkly raccoon: downloaded facebook
skrunkly raccoon: messaged the president
Tony Stank: excuse me what
skrunkly raccoon: i dont like him
Tony Stank: what the fuck did you say
skrunkly raccoon: the truth
Tony Stank: b a r n e s
skrunkly raccoon: hey wait
skrunkly raccoon: i just learned to take a screenshot
skrunkly raccoon: [Photo description: A screenshot of a DM to the official POTUS account. Bucky texted only one thing: “I will see you hanged.” ]
gitc: EYE-
gitc: IM FUCKING SHAKING
mindiana jones: barnes i have never respected a white man more
skrunkly raccoon: thank you
Tony Stank: oh god
Tony Stank: pepper is going to kill me
skrunkly raccoon: oh
skrunkly raccoon:
gitc: you
gitc: you're getting used to this 21st century thing really well
Tony Stank: its true
Tony Stank: you're doing better than percy, who i had to help publish the only tweet he’s ever made
Tony Stank: the man is technologically illiterate
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :(
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i learned to text!!!
Tony Stank: and we’re very proud of you
Tony Stank: but we cant even complain about the nick fury conspiracy account because you dont know how to access his tweets
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :/
skrunkly raccoon: im sorry the what
mindiana jones: just scroll up
mindiana jones: you’ll find it eventually
baby avenger: uhh wait
baby avenger: dont scroll up–
gitc: too late he’s doing it
James Barnes and PJ
James Barnes: youre not a very well put together person are you
PJ: 😔 ✊ no
PJ: how far did you get
James Barnes: tony stark’s illegitimate brother???
PJ: heh
PJ: yeah
James Barnes: …
James Barnes: keeping up with the avengers??
PJ: peter got bored
James Barnes: you threw a printer at your teacher when you were 10?
PJ: it was therapeutic
James Barnes: alright then
James Barnes: hey have you like. actually seen tony today??
James Barnes: i know he’s texting but i dont think he’s been out of his lab
PJ: no. i have not seen tony today
James Barnes: oh ok
PJ: or ever
James Barnes: FUCK
James Barnes:
James Barnes: i forgot my bad
James Barnes: friday describes the pictures for you right
PJ: vividly
[PJ has changed James Barnes’s nickname to ‘court jester’]
PJ: :)
court jester: you are a very strange person
PJ: thanks i think it’s because my cousin wont stop trying to murder me
court jester: which one?
PJ: not one i talk about
PJ: hes a dickhead whos started shit with me when i was literally twelve
PJ: sometimes he just shows up in the middle of the day to try and kick my ass
PJ: i find it soothing to blame all my problems on him
court jester: thats fun
PJ: i think so
PJ: but to answer your question
PJ: tony’s just on a coding binge
court jester: should i be worried?
PJ: i mean you should always be a little worried when tony’s in his lab
PJ: but he just watched Wall-E and he codes when he’s sad. I’d tell him to stop, but i think at this point it’s either coding or crack
court jester: ugh
court jester: back in my day doing crack was an average part of your morning routine but people are so stingy about it now
court jester: re-normalize doing hard drugs when you have the slightest cough
PJ:
PJ: you know
PJ: i think we’re going to be great friends
We had a bonding moment! I cradled you in my arms!!
Father of Five: why did i just get a chill down my spine
crack dealer: don’t worry about it
robert <3
local milf: i. hate family reunions
class traitor: awww poor little meow meow <3 <3 little skrungly blorbo <3 :,(
local milf: excuse me
aspen <3: bridgette just took psychic damage
local milf: no because this is an actual problem
local milf: my aunts are asking me what i do for work
local milf: and i can't tell them that i work for a super secret international agency alongside the avengers????
local milf: so i just fucking
local milf: evade the question
egg: but you’re horrible at deflection!!
local milf: a fact i am very aware of right now
certified monster fucker: rip lmao
local milf: you know. I think you would really get along with one of my cousins
local milf: theres a snack table, and she took the entire tray of little sandwiches and is eating them outside
local milf: just. grabbed it and just exited the building
certified monster fucker: oof drop her number
local milf: thats 100% not what i meant
class traitor: elise, right?
local milf: yeah
certified monster fucker: e l is e ? ( ͡°👅 ͡°)
local milf: no.
class traitor: elise is happily married and has a stable job as a librarian at a local elementary school
class traitor: but yeah maybe she’d be interested in a 24 year old mental patient with a haircut that looks like sonic the hedgehog
certified monster fucker: sonic????
certified monster fucker: MENTAL PATIENT???
aspen <3:
certified monster fucker: aspen???? defend me???
aspen <3: you want me to lie?
certified monster fucker:
certified monster fucker: ok he’s not wrong but its still rude
aspen <3: wait a sec
aspen <3: dan why did you know all that???
aspen <3: did you cyberstalk bridgette’s cousin????
class traitor: no!!
class traitor: lee told me about her
aspen <3: oh yeah??
aspen <3: when
class traitor: just now!!!!
aspen <3 lee isn’t active right now
class traitor: not in this chat :)
certified monster fucker: LEE
certified monster fucker: are you texting dan while ignoring the rest of us????
team rocket
james: you need to learn when to shut your mouth
jesse: yeah fuck you too
robert <3
unique and unhinged: yes
Aspen <3: rude ass
egg: hurtful :(
egg: even then, why does LEE know about bridgette’s cousin??
local milf: probably cause he’s the one who convinced elise to steal the sandwiches for the both of them
certified monster fucker: wait
certified monster fucker: is lee at the family reunion with you????
local milf: yeth
certified monster fucker: and you didnt invite the rest of us???
unique and unhinged:
local milf: i invited lee to help me get through this.
local milf: to keep me CALM
local milf: with that goal in mind why would i invite any of you
egg: WOW
class traitor: words hurt :,(
Aspen <3: o u c h
unique and unhinged: hah
egg: you know what
[egg has changed unique and unhinged’s nickname to ‘thor understudy’]
thor understudy: :/
thor understudy: if anything he’s the fake
thor understudy: he’s not even actually norse
egg: cry about it
thor understudy: no
egg: oh
egg: well i dont know what to say here now
thor understudy: i do :)
thor understud y: tía olivia just showed up and she has polvorosas
certified monster fucker: you lucky bitch
thor understudy: later, fuckos
thor understudy: im going to go flirt with bridgette’s aunt B)
Notes:
bucky barnes, leftist icon and legend
friendly reminder this fic is currently set in 2017 :) and the president of the US is horrible :) and that it's not based on any loudmouth cheeto :) at all ;)
am i aware that bucky doesn't know about peter at ALL in the main fic? yes. do i also know that this chatifc threw canon in a blender? also yes
...i just. i feel like you people need to know the fact that when i was picking heights for the SWORD members i made lee 6'9 cause i thought it was funny. well im an idiot and didn't realize how tall that was cause inches are confusing, and now he's just built like lebron james
also! i made an insta account. story updates and art will all go on there! you can find me @beansofdenim
to anyone who can't find my art there, here's a image link: https://ibb.co/7R6CXn9
plumbing baby. goodbye
Chapter 22: Toxic Traits
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
skrunkly raccoon: tony
skrunkly raccoon: tony
skrunkly raccoon: i want a twitter, tony
Tony Stank: hell no
Tony Stank: after what you did on facebook?
skrunkly raccoon: >:(
baby avenger: let him have a twitter mr. stark
gitc: give the man what he wants
Tony Stank: this is peer pressure
mindiana jones: indeed it is
mindiana jones: give him a twitter
Tony Stank: i will not be swayed
gitc: twitter! twitter!
baby avenger: twitter! twitter!
mindiana jones: twitter! twitter!
skrunkly raccoon: twitter! twitter!
Tony Stank: percy back me up here
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: twitter! twitter!
Tony Stank: you dont even USE twitter why do you care
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i side with the underprivileged masses
Tony Stank: :/
Tony Stank: goddamnit
Tony Stank: FINE
skrunkly raccoon: :D
scientists hate this local new yorker @jbarnes
1 Follower | 0 Following
mooshroom @pianoman
TONY STARK JUST FOLLOWED A NEW ACCOUNT
mooshroom @pianoman
JAMES BARNES????????
lola @merp
AYO???
toby starch @TSarkStan
omg hi @jbarnes
scientists hate this local new yorker @jbarnes
hello :)
You Know Who I Am @TonyStark
sergeant barnes got a twitter. @jbarnes
You Know Who I Am @TonyStark
please be nice to him. he’s old.
scientists hate this local new yorker @jbarnes
a hundred years old and still looking better than you
You Know Who I Am @TonyStark
bitch
paperclip dealer @behindyou
love the fact that stan twitter noticed james barnes had joined before stark himself even got to make the announcement
Iron Man Was Right @loppol
god works hard but we work harder
Iron man please marry me @starklover
Bucky barnes twitter era!!!
Iron man <3 @starkswife
fuck yeah!!! welcome to twitter you funky funky man!!!
Captain America Hate Blog @teamironman
you know what? Im done being hateful
Bucky Barnes Stan @teamironman
new day new me B)
tony stark stan account @ilovehim
hi sergeant barnes!! :D :D :D
scientists hate this local new yorker @jbarnes
stan twitter found me but they’re really nice so it’s okay
robert <3
egg: hey
egg: commander jackson
egg: can we get a twitter too??
aspen <3: really, mal?
class traitor: i mean
class traitor: the CIA has one
local milf: ugh
local milf: don't compare us to the CIA
certified monster fucker: but we could make sure our twitter is infinitely funnier and sexier than theirs
local milf: mmm fair point
egg: commander jackson?
egg: 👉 👈
supreme overlord jackson: the day i give you a twitter is the day i abandon humanity.
certified monster fucker: your toxic trait is not letting us run wild like the feral pack of hogs we are
egg: wait what’s mine
certified monster fucker: dressing like a frat bro who lives off his daddy’s money
egg: you take that back
certified monster fucker: you own three tanktops that say ‘suns out guns out’
egg:
egg: i concede.
certified monster fucker: my toxic trait is that i make sims out of all of you and have them make awful life choices when im mad at you
local milf: wait what
certified monster fucker: your toxic trait is the sheer amount of cakes you’ve stress baked and snuck into my house
egg: into all of our houses, actually
class traitor: i once found a banana bread loaf right next to me when i woke up
class traitor: it was terrifying
class traitor: anyways my toxic trait is going on competitive learning games for children and absolutely DECIMATING random first graders
aspen <3: you never fail to amaze me
aspen <3: mine is that i religiously play candy crush. I’ve finished the game and now i anonymously write emails to the game developers pressuring them to make more
egg: you
egg: you finished the game?
aspen <3: yes
aspen <3: all 9,673 levels that are currently out
class traitor: holy fuckin shit dude
class traitor: you have problems
aspen <3: never say words at me again
egg: what’s lee’s?
certified monster fucker: oh
certified monster fucker: uh
certified monster fucker: i’d say his height is toxic but he uses it for the common good
aspen <3: its true
aspen <3: he drops everything when i ask him to get something off the top shelf for me
aspen <3: he literally once drove to my house to grab me a tupperware from the top of my fridge
egg: its how he shows affection
certified monster fucker: wait so what IS his toxic trait???
aspen <3: shit man
aspen <3: does he have one????
local milf: yes.
local milf: lee van keppel falls asleep on roller coasters and the world deserves to know
egg: IM SORRY WHAT
class traitor: excuse me
local milf: we went to an amusement park in anchorage
local milf: waited twenty minutes to go on the biggest attraction in the park
local milf: finally get on the ride, we’re literally going upside down half the time, at ungodly speeds
local milf: i look over to my left
local milf: and this motherfucker is dead asleep next to me.
class traitor: l e e
class traitor: what the everloving hell
SSEA
baby avenger: i hate it here
gitc: you’re literally sitting next to me :(
baby avenger: wait no
baby avenger: not you ned you’re doing amazing
gitc: :)
baby avenger: i mean i hate american lit
baby avenger: why did i take this
gitc: cause MJ told you to
baby avenger: oh right
baby avenger: mj how could you do this to me
mindiana jones: im confident you’ll get over it
baby avenger: i will not
baby avenger: i hate reading
Tony Stank: god me too
midiana jones: as expected
Tony Stank: excuse me
skrunkly raccoon: i like reading
Tony Stank: nerd
skrunkly raccoon:
skrunkly raccoon: im not even going to address that, coming from you
baby avenger: the english majors are rising up against us
mindiana jones: :/
mindiana jones: ned whats your stance on basic reading skills
gitc: yeah im not getting involved in this
skrunkly raccoon: damnit
skrunkly raccoon: @( ̿ ̿▀‿▀)▬▬ι═══════ﺤ
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: what
skrunkly raccoon: reading; yes or no
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: uhhh
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: book good reading bad
baby avenger: elaborate?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: book make brain go brr
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but brain also put the sexy in dyslexia
skrunkly raccoon:
Tony Stank:
gitc:
baby avenger:
mindiana jones:
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: wait
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: fuck
skrunkly raccoon: is it bad that im laughing
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :/ yeah, laugh at the disabled guy
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: ableist scum
skrunkly raccoon: i
skrunkly raccoon: i literally have one arm
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and yet you still bully the blind guy smh
gitc: hey wait
gtic: you read braille, right?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: no i read via aura and smoke signals
Tony Stank: ffs just say yes like a normal person
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: yes
gitc: so does your dyslexia still bother you???
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: yeah dyslexia still works on braille lmao
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: reading kinda sucks
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: also finding braille books hard :(
mindiana jones: wait thats actually kinda awful
baby avenger: i guess i never really thought about that
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: not a lot of people do, its alright
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: but honestly? being blind is fucking expensive
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: braille displays are thousands of dollars, books are more expensive, even canes can cost a lot of money
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: and not everyone has radar senses and a Mrs. O’Leary to help them get by
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: books are typically the least of my worries, y’know? and i don't have a lot of time to read, anyways. just never seemed worth putting in all the effort, to me
Tony Stank: oh
Judas!!! No!!
One Hit KO: guys
Loser 2: ?
One Hit KO: so im walking to the lab
One HIt KO: and
One Hit KO: [Image Description: Percy and Bucky are sitting in the common room. Percy is stretched across most of the couch, his head next to Bucky’s legs. In his hands, Bucky is holding a book, and he appears to be reading aloud. Percy is smiling slightly, eyes crinkled in the corners]
Loser 2: awwwww
CNN @CNN
Stark Industries to release a groundbreaking new braille display—for free. “Everyone deserves to be able to afford what they need,” Stark quoted.
we had a bonding moment! I cradled you in my arms!
crack dealer: thank you
Father Of Five: i have no idea what you could possibly be talking about
crack dealer: of course not
crack dealer: you’re a good person, tony
Notes:
ok so i'd like to start out by saying: obviously, blind people do not need people to read to them. audiobooks and braille books. percy just has issues with braille (which dyslexia DOES affect) and isn't really an audiobook guy---he just doesn't care enough to really get into them. bucky reading to him was just a cute little thing
i'd also like to bring some awareness to the costs of being blind, or really having any sort of disability. like, seriously, look up how much a braille display costs. shits wild.
and yes, bridgette does stress bake and then break into peoples house to leave them whatever she made. this includes putting a tray of cupcakes in aspen's pantry, banana bread on dan's pillow, pastries on ross's dresser, and on top of mal's coat rack. nobody knows how or when she does this.
she did it to percy Once. only once, because when she was on her way out, he appeared behind her and gave her a container of blue cookies in return. he's the only person to have ever caught her.
peter's toxic trait is threatening to bite people and inject them with his venom
tony's toxic trait is doing giant things for the people he cares about and then pretending he has no idea what they are referring to
bucky's toxic trait is that he keeps breaking microwaves
percy's toxic trait is how much he enjoys being vague and cryptic about his familyplumbing baby. goodbye.
Chapter 23: senator weiner
Chapter Text
SSEA
Tony Stank: who the fuck was it
skrunkly raccoon: whatever do you mean ٩(˘◡˘)۶
Tony Stank: it was you, you little bitch
skrunkly raccoon: i have an alibi for the entire morning :) :)
skrunkly raccoon: ask fri
Tony Stank: alright your story checks out
Tony Stank: peter? Was this you?
baby avenger: hey now
baby avenger: ive never done anything wrong in my life and id like that on record
Tony Stank: you are a vigilante
baby avenger: well its ok when i do it
Tony Stank: i already checked with pepper and rhodey
Tony Stank: and i know whoever this was couldn't have acted alone
Tony Stank: @( ̿ ̿▀‿▀)▬▬ι═══════ﺤ answer for your crimes
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: you'll never take me alive
Tony Stank: …
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: sorry, reflex
Tony Stank: concerning
Tony Stank: but was this you, you little fucknugget
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i have no idea what you could possibly mean, dearest birthday boy
Tony Stank: do not.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: birthday boy. evicted from the womb anniversary.
Tony Stank: stop
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: on this day, your wrinkly, pudgy little baby face met this ugly, ugly world for the first time.
Tony Stank: i hate you so much
baby avenger: wait
baby avenger: this isnt about the confetti cannons??? they havent gone off yet
baby avenger: i checked
Tony Stank: the what
baby avenger: uh
baby avenger: nothing
baby avenger: percy did something
baby avenger: lets focus on that again
skrunkly raccoon: wig?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i gave him a little festive treat and nothing more
Tony Stank: YOU REPLACED MY PILLOW WITH A SHEET CAKE IN THE MIDDLE OF THE NIGHT
Tony Stank: I WOKE UP COVERED IN FROSTING
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i bak a cak for u
Tony Stank: you disgust me and i refuse to believe you acted alone
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: well
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i baked it at my cousin’s house
skrunkly raccoon: and while he was finagling the cake under your cranium
skrunkly raccoon: i stood to the side in case you woke up and needed to be nerve striked back into unconsciousness
Tony Stank: there is something deeply wrong with you two and also frosting in my nose
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: happy birthday :)
mr harrington please stop sending memes challenge
Scary Captain: alright, AcDec group retreat is coming up
Scary Captain: we will be brainstorming ideas and voting
moonmoon: cheese factory
Murphy’s law: im lactose intolerant
moonmoon: oh sorry
moonmoon: cheese factory without charles
Murphy’s law: you bitch
nedleedle: lets go catch subway rats and rehabilitate them like last year
President lincoln: that WAS fun
President lincoln: but sally did get that wacky mutated rabies case
nedleedle: and? she was arguably alright in the end
Avril lavigne: when i sneeze the power goes out
The News(™): we should go feral
The News(™): revisit our roots
The News(™): go live in a forest for a bit
tungsten dioxide whats this: we could prepare our survivalist skills for when society finally crumbles and people begin to eat each other and mitch mcconnell starts training the pigeons
The News(™): that too
moonmoon: hmmm
moonmoon: i like forest
moonmoon: can look at bùgs
nedleedle: valid point
murphy’s law: and i can finally go rematch that bear
Avril lavigne: and if flash gets wind of it we can always drown him in a creek and label it a tragic accident, then get together on the ten year anniversary and watch the dedicated new segment about it and laugh like old rich people talking about the economy
nedleedle: ok im down
tungsten dioxide whats this: and id follow ned to the ends of the earth so
moonmoon: time to be raccoon boys?
mr. harrington: i suppose, since you all agreed
moonmoon:
moonmoon: sometimes i forget mj isn't the only authority figure in this chat
Scary Captain: you lot require two of us.
mr. harrington: you can say that again, michelle.
Scary Captain: i will, probably within the hour, roger.
Scary Captain: alright, we need an extra chaperone to sign up. legally, i dont count.
Judas!!!! No!!!!
Loser 2: peter
One hit KO:
One hit KO: you have the WRINKLIEST brain
mr harrington please stop sending memes challenge
Scary Captain: alright, we have the chaperones and the campsite booked. everyone, please make a packing list. and abe?
Scary Captain: dont fill your suitcase with nothing but chex mix again.
president lincoln: i know my rights
mr harrington please stop sending memes challenge
The News(™): i do really feel bad for mr. harrington sometimes
avril lavigne: like that one time we built an elmo statue out of microscopes, gel pens, and abe’s shoes?
The News(™): yeah exactly like that
moonmoon: or like that one time he had to tell me off for rapping the constitution on the school announcements?
nedleedle: or when charles said mr. harrington needed to give him an A or he’d start taking shots of sharpie ink
tungsten dioxide: or that one time sally brought in the ouija board because abe told her the boiler room was haunted and she wanted out find out if the ghosts were gay or not
Murphy’s law: or when betty tried to buy that ostrich online with a credit card number she found in the bathroom of a hobby lobby
Scary Captain: these are all prime examples of why none of you should reproduce. the trip is next weekend. clear your schedules.
Rowdy Boys
Small(™): hey can i bring lea on a school trip to the forest so when the others eventually decide to recreate the hunger games i have a chance
jalapeno eating king: i dont see why not
SSEA
gitc: i am just a simple boy
gitc: taking a little jaunt through the tower to retrieve the terrarium i made out of a arizona tea bottle to keep my pet imaginary roach, senator weiner, in
gitc: when i walk past one of the labs
gitc: and hear tony stark, iron man himself, laughing like he's on his joker arc
gitc: god? anyone? explain?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i procured him some magic weapons to play with
gitc: you gave him weapons for his birthday?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i give everyone weapons as gifts
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: my sister even helped me pick out a bow for it
mindiana jones: tony stark with magic weapons
mindiana jones: i see no way for this to go wrong
Notes:
acdec content acdec content
poor mr harrington lmao
throughout various field trips, something always happens to one of the acdec members that results in them getting minor superpowers, like sally's power outage sneezes. this happens to them all, even mj and ned. all of them, except peter.
naturally, they make it their mission for peter to make it to graduation without having some sort of Accident.
little do they know. he was the first. he kickstarted this whole trend.
nobody:
tony w a magic spear: >:)also: loving reminder you can find me on insta @beansofdenim for art and lawn care tips
plumbing baby. goodbye.
Chapter 24: Spray Cheese
Notes:
username rundown:
mr harrington please stop sending memes challenge:
president lincoln: abe
murphy's law: charles
The News(TM): betty
moonmoon: cindy
avril lavigne: sally
tungsten dioxide whats this: peter
Scary Captain: mj
nedleedle: nedJudas!!! no!!!
Not A Loser: mj
Loser 2: ned
One hit KO: peterWe had a bonding moment!! I cradled you in my arms!!!
Father of Five: tony
crack dealer: percytony stark's murder friends
court jester: bucky
45 grapes: percy
(See the end of the chapter for more notes.)
Chapter Text
mr harrington please stop sending memes challenge
president lincoln: my shit? Packed
murphy’s law: how much of it is chex mix
president lincoln: ;)
murphy’s law: ok.
Scary Captain: if everyone’s not on the bus at 9:00 sharp i will be in your closet when you come home
moonmoon: jesus christ ok
moonmoon: am now departing early
Scary Captain: good
Scary Captain: do we need to talk about seating assignments?
nedleedle: DIBS ON SITTING NEXT TO PETER
tungsten dioxide whats this: DIBS ON SITTING WITH NED
nedleedle: omg
tungsten dioxide whats this: awwwww ned <3 <3 <3 <3
nedleedle: <3 <3
The News(™): those two are scarily in sync
nedleedle: thanks its the undying love
tungsten dioxide whats this: :)
tungsten dioxide whats this: im already on the bus and ill save a seat for you
Judas!!! No!!!
Not A Loser: is he with you?
One hit KO: yep. So is lea, but she’s sitting with him
Not A Loser: percy was really alright with you taking her?
One hit KO: well i didnt dognap her if thats what you're asking
Not A Loser: : /
One hit KO: but yes he said i could take her as long as nobody fed her 35 marshmallows
One hit KO: 36 or more is fine, as is 34 or less
One hit KO: just not 35
Loser 2: what an interesting man
One hit KO: i know, right?
Mr harrington please stop sending memes challenge
Avril lavigne: WHY IS TONY STARK ON OUR BUS
Avril lavigne: PETER
tungsten dioxide whats this: owo?
Avril lavigne: DR TONY STARK??? IRON MAN??? SITTING ON OUR BUS WITH A DOG???
tungsten dioxide whats this: oh
Avril lavigne: yeah OH
tungsten dioxide whats this: thats my cousin ed
President lincoln:
President lincoln: peter what
tungsten dioxide whats this: ed. my cousin.
tungsten dioxide whats this: hes visiting and agreed to chaperone for us
tungsten dioxide whats this: very nice of him, wasn’t it?
Murphy’s law: peter that is clearly tony stark
nedleedle: uhm why would tony stark be sitting on a schoolbus?
The News(™): i dont know PETER why is he????
tungsten dioxide whats this: hes not
tungsten dioxide whats this: my cousin ed on the other hand
avril lavigne i am going to beat you to death
tungsten dioxide whats this: right in front of my cousin??? rude
President lincoln: you know what?
President lincoln: i cant deal with this
The News(™): what does ed do for work??
tungsten dioxide whats this: hes a mechanic :)
The News(™):
The News(™): a mechanic?
The News(™): does he perhaps
The News(™): build stuff
tungsten dioxide whats this: sometimes, i suppose
The News(™): like, maybe, a fancy metal suit?
tungsten dioxide whats this: hmmmm
tungsten dioxide whats this: no that doesn't sound right
moonmoon: FUCK FUCK FUCK FUCK
moonmoon: EVERYONE GET ON THE BUS
moonmoon: PETER GO SIT IN THE VERY BACK
Avril lavigne: what wrong????
moonmoon: IM PULLING UP TO THE SCHOOL AND FLASH IS IN THE CAR BEHIND ME
nedleedle: FUCK
Murphy’s law: how the hell did he find out about this????
mr harrington: he didn’t hear it from me.
The News(™): ok icon but
The News(™): peter go sit in the very back with ned
The News(™): everyone else but cindy is here and we’ll fill out the surrounding seats so he won’t be anywhere near you
tungsten dioxide whats this: you guys dont have to do that
tungsten dioxide whats this: ill be fine
nedleedle: if flash so even looks at you im going to paint the bus red with his blood
tungsten dioxide whats this: 0-0
Murphy’s law: damn
Murphy’s law: we stan a protective husband
President lincoln: ok charles and i have the seat in front of peter and ned
Avril lavigne: im across the aisle from them, saving a seat for cindy <3
moonmoon: <3
The News(™): im in front of charles and abe
Scary Captain: ill sit next to you, betty, if you don't mind
The News(™): not at all
moonmoon: ok!!! Im here
moonmoon: hey is that tony stark
tungsten dioxide whats this: nope
tungsten dioxide whats this: whos tony stark
moonmoon: ok
We had a bonding moment!! I cradled you in my arms!!!
Father of Five: hey that little shitheel transphobic kid just showed up on the bus
crack dealer: say the word and i’ll order a missile strike
Father of Five: you can do that???
crack dealer: unquestioned, yes
Father of Five: comforting
Father of Five: what are you doing while i’m out?
crack dealer: bucky and i are seeing how many grapes i can fit in my mouth
crack dealer: we’re at 24
Father of Five: have fun
Father of Five: please don’t destroy my company and or tower
crack dealer: i only promise to try
Mr harrington please stop sending memes challenge
moonmoon: hes here
nedleedle: god i forgot how ugly he was :/
The News(™): PFT–
Scary Captain: ok hes sitting across from me and betty
Scary Captain: he gets the entire seat to himself and he looks so smug about it
moonmoon: im right behind him. I could start kicking his seat
Avril lavigne: do it
mr harrington: i’d prefer if you didn’t, cindy.
President lincoln: MR HARRIGTON IS SITTING NEXT TO FLASH
Murphy’s law: HA
The News(™): flash is pushed up against the window—
Scary Captain: aw, he looks so miserable :)
President lincoln: peter’s cousin ed, who is a mechanic, is petting the giant wolf dog like a bond villain with a cat
tungsten dioxide whats this: hes like that dont worry
moonmoon: hey, wait
moonmoon: isnt that the dog from the girlboss, gaslight, gatekeep video you sent us?
tungsten dioxide whats this: yep!
tungsten dioxide whats this: that’s lea, she’s pj’s dog
Murphy’s law:
Murphy’s law: pj’s?
President lincoln: (͠≖ ͜ʖ͠≖)
tungsten dioxide whats this: stop
Avril lavigne: why does your cousin ed, who is a mechanic, have tony stark’s illegitimate brother’s dog?
The News(™): yeah why DOES he
tungsten dioxide whats this: oh, i just asked if i could take her
nedleedle: yeah, in case we have problems putting up tents
nedleedle: shes great at it
Scary Captain: its true. Ive seen it.
moonmoon: i dont even know what to say anymore
Scary Captain: well, buckle up
Scary Captain: because we’ve got almost five hours of driving to go
moonmoon: oh god
tony stark's murder friends
court jester: hey where are you
45 grapes: saying hi to the SI people
45 grapes: the interns are fun
45 grapes: i get to judge their dance offs
court jester: ooh fun
court jester: do you think i could eat an entire raw onion?
court jester: and i found something in the pantry called easy cheese?
45 grapes: IM ON MY WAY
Notes:
flash is here. boooo!!!! hissss!!!!!
percy isn't the trip chaperone, sorry. 'twas tony
mr harrington is an icon
percy, commander of SWORD: i have the power of god (my mom) and anime (the government) on my side!!!
want to know what suit size the axeman of new orleans wore? follow me on insta @beansofdenim
(theres also character art too, but i mean. whatever.)plumbing baby. goodbye.
Chapter 25: camping trip
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
Tony Stank: teenagers scare the living shit out of me
skrunkly raccoon: pack it up mcr stan 🙄
Tony Stank: excuse me
Tony Stank: listen man i dont have time for this peter and his little friends are going apeshit
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh worm?
Tony Stank: [Video Description: Tony is sitting in a foldable camping chair, wearing a pair of sunglasses and sipping from a Capri Sun. He flips the camera around to show a forest clearing, the AcDec kids standing, huddled shoulder to shoulder in a circle in the middle.]
Tony Stank: i dont know what the fuck they’re talking about and i dont want to know either
Tony Stank: ignorance is bliss and theres a five hour energy in this capri sun
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh wow
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: enjoy that i guess
skrunkly raccoon: yeah good luck
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: is lea enjoying herself?
Tony Stank: i think?
Tony Stank: she climbed a tree
Tony Stank: i didnt even know dogs could do that
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: they cant
Tony Stank: oh
robert <3
aspen <3: why is bts playing
Local milf: ?
aspen <3: why has all my music been replaced with bts, the cats soundtrack, and one episode of a podcast about mesopotamian farming practices
aspen <3: where are my fucking playlists
class traitor: lmao
aspen <3: YOU
egg: oh no
certified monster fucker: dan why would you do this
class traitor: did you guys know that aspen has ten hours of mcr songs downloaded
egg: i-
egg: aspen
aspen <3: WELL I MOST CERTAINLY DON'T ANY MORE
local milf: aspen is on the floor
aspen <3: DO YOU KNOW HOW LONG IT TOOK ME TO DOWNLOAD ALL OF THAT??
local milf: i think they’re crying
aspen <3: AND I HAD IT ALL ORGANIZED TOO
local milf: yep those are definitely tears
egg: dan my man
egg: why would you commit such a heinous crime
aspen <3: IVE DONE NOTHING TO YOU
class traitor: literally yesterday you invited me to your house for dinner and when i arrived you knocked me out with a kitchen aid and when i woke up i was covered in panko breadcrumbs and grated zucchini while mambo no.5 was playing on loop outside the closet you locked me in
aspen <3: oh right lmao
aspen <3: i did do that
local milf: aspen…
aspen <3: but this means war, daniel.
class traitor: kiss my ass
class traitor: you probably can't reach that high, on second thought
aspen <3: lee?
thor understudy: what
aspen <3: you with dan?
thor understudy: yeah he asked to film me eating that raw potato i found that looks like elvis presley
aspen <3: tell him i will be searching for him.
thor understudy: mk
egg: im suddenly terrified
aspen <3 good
aspen <3 im 5 feet tall and the idea of self control is foreign to me
supreme overlord jackson: if you damage the building, you’ll regret it
aspen <3: understood, i will find a way around property damage
Tony Stank: the children are gone
Tony Stank: i texted peter asking where he was but i heard the buzzing real close by so i looked to my left and turns out the kids left their phones in a pile with a note that says they’re abandoning modern technology to return to their monkey roots
skrunkly raccoon: interesting
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh thank the gods
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: teenagers all go through a go feral and run into the woods phase
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: we’ve all been there
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: honestly i was getting a little worried that peter hadn't yet
Tony Stank: your family needs to undergo some sort of case study
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: its best that we dont
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: for the psychiatrists sake
Tony Stank: one of the children just wandered by, covered head to toe and leaves and sticks
Tony Stank: i feel unsafe
Tony Stank: if i start videoing this and get murdered on film will you show it to the police
skrunkly raccoon: probably not
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: unlikely
Tony Stank: wow
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: we’ll buy and dedicate a applebees to you though
Tony Stank: acceptable
Tony Stank: [Video description: He’s still sitting in a lawn chair, drinking a capri sun. This one is different, though, as shown by the small pile of empty juice pouches under his feet. Something moves in the background, and he slowly swivels around.
Cindy, covered head to toe in various plant matter, is crouched a few feet away from him.
“What are you doing?” Tony whispers.
The girl stares at him for a long time. “Why do you have an arc reactor in your chest, Peter’s cousin Ed, who is a mechanic?”
It’s silent for a long moment. Finally, Tony says, “I’m a big Iron Man fan.”
The girl nods.
“Now you answer my question.” Tony prods.
“Hunting for food.”
Tony slowly points to the cooler five feet away from him. “There’s tin foil wrapped sandwiches right there.”
She shakes her head. “We crave a fresh kill.”
“Alright, kiddo.”]
skrunkly raccoon: aw, they’re learning to provide for themselves
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: reminds me of my camp counselor days
Tony Stank: who on earth let you be a camp counselor
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: my sixth grade latin teacher who armed me to kill my math teacher
Tony Stank: one day im going to learn to stop asking questions
Tony Stank: oh my god
Tony Stank: they’re building a fire
Tony Stank: its huge
robert <3
class traitor: really, aspen?
Local milf: what?
class traitor: you put a fake spider in my lunch
class traitor: how more basic can you get
class traitor: you talk a big game for someone who gets their pranks from a fucking wikipedia article
egg: damn
class traitor: SHIT
certified monster fucker: not a fake spider?
aspen <3: not a fake spider :)
class traitor: what the FUCK
class traitor: this thing is HUGE???
certified monster fucker: thats what she said lmao
thor understudy: no, it really wasnt
egg: PFFT–
certified monster fucker: hey man what the fuck
thor understudy: i heard spider. where is it.
class traitor: ITS MENACING ME FROM THE BREAK ROOM
thor understudy: omw
SSEA
Tony Stank: [Video description: The kids are back in the clearing, standing in a circle around the bonfire, which is upwards of six feet tall. Mrs. O’Leary is there, too, sitting regally in the grass.
“Peter,” Tony says cautiously, “You good, bud?”
After a beat, Peter turns away from the fire to look at Tony. There’s smudges of paint on his face. “Peachy.”
“What’s with the fire, Underoos? And the face paint?”
“To show my allegiance,” Peter gestures to his face. He then turns back to the fire. “This? This is for advancement as a society.”]
Tony Stank: alright peter gave up the opportunity to say the bonfire was just his hot mixtape and/or burning desire for optimus prime something is really wrong
skrunkly raccoon: he looks fine to me
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: me too
Tony Stank: you’re a little bitch, percy
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :)
We had a bonding moment!!! I cradled you in my arms!!
Father of Five: fri did describe the videos for you though right
crack dealer: 👍
SSEA
Tony Stank: [Video description: Once again, the camera is pointed at the kids huddled around the fire.
“Peter, you sure you’re alright? You’re acting a bit off.”
He waves off Tony. “It’s just the starvation getting to me. Once Cindy and Charles return with that bear he was having a rematch with, we will be fed.”
“Pete, kiddo, you literally ate seven packages of sliced deli ham with your bare hands on the bus, not even an hour ago.”
“Oh.” Peter squints. “Must be the blood loss, then.” He nods, accepting his own explanation.
“The WHAT–” ]
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i stand by the fact that they’ll be fine
skrunkly racoon: me as well
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: i spent three months eating raw deer in a forest with a wolf pack and it bettered me as a person
Tony Stank: no, it just made you bark at passing cars
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: :/ youre joking but i have a cousin who actually does that
Tony Stank: of course you do.
robert <3
class traitor: LEE JUST FUCKING CAME INGTO THE BREAK ROONM AND SCOOPED UP THE SPDUER EWITH HTEIR BARE HANDS
Local milf: oh god not again
Local milf: lee you need to stop with the spiders
thor understudy: i will not.
class traitor: STOP HOLDING THE SPIDER UP CLOSE TO YOUR FACE
thor understudy: oh relax you big baby
thor understudy: its a brazilian wandering spider. they bite without venom sometimes
thor understudy: this is a really cute one, too. they’re rare to find out of south and central america. where on earth did you get her, aspen?
aspen <3: i know a guy
thor understudy: amazing.
thor understudy: oh, wow! she’s pregnant!
class traitor: WHAT
Local milf: NO
egg: ive never been more scared
thor understudy: luckily, i have a spare terrarium that will be perfect for her! commander, do you mind if i take my lunch break early to go take her somewhere safe?
Supreme overlord jackson: go ahead
thor understudy: ill be back soon!
certified monster fucker: …
egg: …
local milf: ok that was horrifying
certified monster fucker: but thats also the most we’ve ever seen lee smile?
local milf: mhm
SSEA
Tony Stank: i shouldve stayed home
Tony Stank: charles got a scratch fighting the bear(???????????) and now they tied him to a tree with their sweaters in case he goes rabid
skrunkly raccoon: hes a man now
skrunkly raccoon: yknow i fought a bear once in the siberian wilderness
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: oh, really? how’d it go?
skrunkly racoon: bit it
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: sick
Tony Stank:
Tony Stank:
Tony Stank: oh my god i just remembered there are, in fact, nine kids and not eight.
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: is the thompson kid really a human being though
Tony Stank: hm. Fair.
Tony Stank: either way they just pulled out a rope they made of pipe cleaners and tree bark and have tied him up and are dangling him over the fire as a sacrifice to mrs. o’leary
Tony Stank: percy you have experience with children
Tony Stank: should i do something?
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: nah
( ̿ ̿▀‿▀)▬▬ι═══════ﺤ: let the bitch burn
Tony Stank: not about that, about the fact that they abandoned their humanity so easily
Tony Stank: percy they’re chanting now
Tony Stank: percy
Tony Stank: percy please
Tony Stank: theyre dancing around the fire
Tony Stank: percy
Notes:
YES tony's long silence is him thinking 'damn these bitches perfect for eachother, huh'
aspen <3 mcr
lee <3 spiderslee and peter should probably never meet
charles did defeat the bear btw
want to know the secrets of the printing press? follow me @beansofdenim on insta
plumbing baby. goodbye.
Chapter 26: improved furby
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
[skrunkly raccoon has changed ( ̿ ̿▀‿▀)▬▬ι═══════ﺤ’s nickname to ‘percenary’]
Tony Stank: barnes what the fuck
Tony Stank: i get you might be up late but TWO IN THE FUCKING MORNING and this is what you do??
skrunkly raccoon: i thought it was funny
baby avenger: and you were right lmao
percenary: hhgrdwha
gitc: hello??
Tony Stank: give him a minute
percenary: h3eowd
percenary: mmmok
percenary: good morninf
baby avenger: its like almost noon
percenary: i said what i said
skrunkly raccoon: let the man have his rest
percenary: thank you JAMES
percenary: <3
skrunkly raccoon:
skrunkly raccoon: <3
baby avenger: aw
baby avenger: but why were you in bed so late??
percenary: sleeby
percenary: was up late
baby avenger: ah
Tony Stank: doing what?????
percenary: my cousins were roleplaying founding fathers again
gitc: AGAIN???
percenary: again
percenary: and they always make me be there to rate their performance
Tony Stank: jesus
percenary: no hes not invited just me
percenary: also james did you Get Sufficient Rest?
skrunkly raccoon: oh yeah i woke up in a cold sweat, changed your nickname, then went right back to sleep
mindiana jones: inch resting
gitc: hey, wait
gitc: why is sergeant barnes the admin?
Tony Stank: well
Tony Stank: peter can’t be trusted with naming abilities
baby avenger: :(
Tony Stank: michelle would probably just kick everyone out
mindiana jones: shrug
Tony Stank: i know myself. i’d do on a power trip and be a ruthless dictator
Tony Stank: and percy is too technologically illiterate that even Fri couldn’t help him run a chat
percenary: too many buttons
Tony Stank: so. barnes
skrunkly raccoon: good to know i only received my throne via process of elimination
mr harrington please stop sending memes challenge
moonmoon: FUCK FUCK FUCK
moonmoon: I FORGOT TO DO MY MATH ASSIGNMENT
president lincoln: lmao charles is doing mine
murphy’s law: charles is NOT fuck you
president lincoln: consider: please?
murphy’s law:
murphy’s law:
murphy’s law:
murphy’s law: ᶠᶦⁿᵉ
The News(™): charles you are pathetic
moonmoon: not the time!! i am in distress!!
moonmoon: this assignment is worth so many points
avril lavigne: why don’t you just get charles to do it lmao
murphy’s law: why don't you go get some bitches????
avril lavigne:
The News(™): oh sis really went off huh
nedleedle: snapped
Scary Captain: sally has absolutely NO hoes
avril lavigne: MJ?????
tungsten dioxide whats this: maybe cindy can calculate you some bitches while she’s doing that assignment
avril lavigne: P E T E R ? ? ? ? ? ?
mj and the dumbass
mj: fantastic coordination
the dumbass: :D
SSEA
Tony Stank: whoever left a puddle on the kitchen floor needs to fess up
gitc: oh worm?
percenary: he slipped and ate shit on the way to the fridge lmao
Tony Stank: you little bitch YOU KNEW THE WATER WAS THERE
percenary: mhm
Tony Stank: i hate you so much
Tony Stank: im going to eat the jello you left in the pantry
percenary: IF YOU SO MUCH AS LAY A SINGLE FINGER ON MY JELLO STASH I WILL EXECUTE YOU
mindiana jones: o-o
percenary: I PUT UP WITH A LOT OF SHIT
percenary: THIS IS WHERE I DRAW THE FUCKING LINE
baby avenger: 0.0
percenary: I HEAR YOU OPENING THE WRAPPER
percenary: YOU'RE A DEAD MAN STARK
skrunkly raccoon: rip anthony edward stark, avenger, inventor, and father
skrunkly raccoon: he will be missed but not forgotten
baby avenger: mother FUCKER
baby avenger: THIRD TIME
gitc: what?
baby avenger: loss of father figure number strike three
baby avenger: does this mean im out??
gitc: HJDFBDJKSF PETER
our family tree is a wreath
pied piper: so, completely hypothetically
pied piper: how would someone hire an assassin?
pied piper: specifically me
has a buzzfeed unsolved episode: you tell me who you want dead and why and if it’s a good enough reason i do it for free
pied piper: oh worm
pied piper: sometimes i forget my silly goofy friend is an assassin
has a buzzfeed unsolved episode: first off, im a mercenary, not an assassin
has a buzzfeed unsolved episode: assassins typically do stuff for political reasons, and mercenaries are military or ex-military
mcshizzle: you served in the military?????
has a buzzfeed unsolved episode: three months in the argentine navy under a fake name
has a buzzfeed unsolved episode: i also like to think the legion most definitely counts
mcshizzle: oh right
has a buzzfeed unsolved episode: and second, EX mercenary, thank you very much
horse girl: why do you want someone dead, piper?
pied piper: thank you for asking hazel
pied piper: so im in court right
framk: oh gods for a second i forgot you were a lawyer and i was about to start asking how much bail is
pied piper: thank you frank but even if i do get arrested, dont worry about bail, percy and his big three dream team will break me out <3
has a buzzfeed unsolved episode: <3
pied piper: anyways im doing my thing, defending a child
pied piper: and this other lawyer is being a little BITCH
pied piper: not even in a lawyer way. just being a right piece of shit.
pied piper: he was arguing that putting the kid through conversion therapy isn’t abuse???
sparky: he w h a t
has a buzzfeed unsolved episode: i can have his body hanging in front of the courthouse in an hour
pied piper: <3 thank you friendly murder man
mcshizzle: since we’re doing hypotheticals
mcshizzle: i hypothetically have made something i call Improved Furby
my chemical ron weasley: NO NO NO NO NO
sparky: LEO WHY
mcshizzle: I WAS BORED
horse girl: wait how is this hypothetical?
mcshizzle: here comes the hypothetical part
mcshizzle: hypothetically, lets say, i, oh, i dont know, wanted to improve its stealth and now it’s invisible and also on the run
horse girl: n o
framk: leo where are you
mcshizzle: bunker nine
framk: oh im in california thank god
framk: good luck to the rest of you though
pied piper: INVISIBLE STEALTH FURBY???
pied piper: leo that better be it
mcshizzle:
mcshizzle: it…may….have….AI
sparky: WHAT
my chemical ron weasley: leo do you want us all dead
mcshizzle: no just frank
framk: <3
pied piper: and he’s the only one who’s out of state
pied piper: congrats you dumb bitch
mcshizzle: i recruited the ares and hermes cabins to try and help me catch it
sparky: ill help too. the sooner we get that thing out of camp the better
mcshizzle: gods bless you jason
sparky: ITS SO FUCKING FAST
sparky: I WAS SO SURE I HAD IT
mcshizzle: yeah hes a zoomy little guy
mcshizzle: and i cant deactivate its camouflage mode
my chemical ron weasley: i hate you so much
mcshizzle: im sorry!!
mcshizzle: on the bright side everyone is running around grabbing at air and its very funny looking
sparky: HOW AM I SUPPOSED TO CATCH IT
sparky: I CANT FUCKING SEE IT
has a buzzfeed unsolved episode: wow jason that must be so hard for you i cant imagine :( sending thoughts and prayers
sparky: NOT the time percy
sparky:
mcshizzle:
RARA: you guys are all idiots
RARA: except hazel and percy
horse girl: :)
has a buzzfeed unsolved episode: :)
mcshizzle: perce
mcshizzle: my man
sparky: my bro
sparky: light of my life
sparky: will you please come to camp and geT THIS FUCKING INVISIBLE FURBY
has a buzzfeed unsolved episode: took you long enough
has a buzzfeed unsolved episode: ill be there in ten
mcshizzle: [Video Attachment: Percy is standing in the middle of the cabins, perfectly still. He doesn’t even look like he’s breathing. Then, suddenly, he lunges forward and hits the ground, arms wrapped around something invisible. He tightens his grip against the struggling creature, holding until movement ceases. ]
mcshizzle: gods bless
sparky: our lord and savior
[my chemical ron weasley has changed has a buzzfeed unsolved episode’s nickname to ‘furby slayer’]
furby slayer: you guys would all be taken out by a mildly dark room
furby slayer: except hazel obviously
mcshizzle: hey man not everyone can be a fucking bat
mcshizzle: dolphin sonar having ass
sparky: meh
sparky: you’d save me anyways right bro <3
furby slayer: ofc bro <3
RARA: nasty
RARA: gwen asked who i was texting and i had to tell her i was in a chat with my girlfriend piper and my boyfriend jason and jason’s husband percy and percy’s little siblings nico and hazel, and hazel’s boyfriend frank and frank’s boyfriend leo
furby slayer: :)
pied piper: you love us
RARA: correction: i love hazel, tolerate you and jason, respect percy, and think nico is a case study at best
furby slayer: the two of you literally went to chuck e cheese last week
RARA: and i was taking notes the entire time
my chemical ron weasley: percy how the fuck did you know that
furby slayer: oh nico
furby slayer: you know better than to be asking questions
my chemical ron weasley:
Notes:
happy gay wrath month everyone
also: june 22 marked my one year anniversary on ao3!! ive gotten so much support and grown so much in this past year, and i love all you stinky bitches <3 have an extra long chapter
shoutout to Tabaxi_Power for the amazing percenary pun. thank you for enlightening me with it.
plumbing baby. goodbye.
Chapter 27: fake dating trope time
Notes:
(See the end of the chapter for notes.)
Chapter Text
robert <3
class traitor: MAL?????????
egg: owo?
class traitor: WAS THAT YOU I JUST SAW????
egg: no
class traitor: oh
class traitor: sorry
class traitor: HEY WAIT
class traitor: I SEE THE KOOLAID MAN ASPEN DREW ON THE BACK OF YOUR ELBOW EARLIER
egg: the what
egg: ASPEN
aspen <3: :)
local milf: wait dan did you get sidetracked or?
class traitor: no!! im at the party city picking up the balloons for your cousin like you asked
class traitor: and mal is here
certified monster fucker: why is mal buying balloons
class traitor: shes not
class traitor: she’s standing behind the counter with a uniform and badge
class traitor: she gave me a discount on the streamers
aspen <3: mal did you beat up a party city employee and steal their clothes
egg: no
egg: i work here
egg: im the manager
certified monster fucker: wh
certified monster fucker: but
certified monster fucker: h?????
thor understudy: you broke ross
certified monster fucker: YOU HAVE A FULL TIME JOB AS A GOVERNMENT AGENT
certified monster fucker:
WHY AND HOW DO YOU HAVE A JOB AT PARTY CITY
egg: hey man ive been managing this establishment for seven years
egg: just because i got a new job doesn't mean i was going to quit on my fellow party personnel
certified monster fucker: ????????????????????
certified monster fucker: is this where you go during all those bathroom breaks
egg: yeah
certified monster fucker: im gonna
certified monster fucker: fucking
certified monster fucker: fjregbqrjkebgfkjagvhjrebgvhqu
aspen <3: why are we exposing mal
aspen <3: ross you literally have a list of senators to seduce
aspen <3: mal’s well-run party city does not even compare to that
certified monster fucker: ive made progress on that list, ill have you know
certified monster fucker: significant progress ;)
certified monster fucker: and at least im not DAN
class traitor: bruh???
certified monster fucker: ive seen your fucking tramp stamp
local milf: his WHAT
certified monster fucker: he has his ex’s name tattooed on his back
local milf: …
local milf: wow
class traitor: WHAT THE HELL MAN
class traitor: I TOLD YOU THAT IN CONFIDENCE
class traitor: and my tramp stamp is better than ASPENS FUCKING SLEEP COOKING
egg: sleep COOKING???
aspen <3: i make pasta in my sleep
class traitor: no, you BURN pasta in your sleep
class traitor: ive showed up at your house to put out fires like a dozen times
aspen <3: ¯\_(ツ)_/¯
aspen <3: and ill take my fucking burnt ass pasta over lee’s fucking LA CRIOXS
egg: :o
certified monster fucker: la croixs????? L e e
thor understudy: will not apologize for liking the bubble
thor understudy: and bridgette once got pulled over for speeding and she beatboxed until the cop was so impressed he let her go
class traitor: she can beatbox??????
thor understudy: she can not. but he appreciated the tenacity.
egg: i would say its time to expose jackson but we have nothing on that man
Supreme overlord jackson: in the name of team bonding, i will offer up a fact about myself
local milf: !!!!!!!
class traitor: oh god its happening
certified monster fucker: everyone get ready
Supreme overlord jackson: ive been to jail over fifteen times. they haven’t built a cell that can hold me yet, and i doubt they ever will.
egg:
aspen <3:
class traitor: ʷʰᵃᵗ ᵗʰᵉ ᶠᵘᶜᵏ
mr harrington please stop sending memes challenge
moonmoon: spider-man hot
tungsten dioxide whats this: why would you start the day like this
president lincoln: why are you booing her??? Shes right
president lincoln: have you seen those ARMS????
murphy’s law: AMEN
nedleedle: you guys just like him for his arms?
The News(™):
UM NO??
The News(™):
boy have you seen those thighs???
avril lavigne: i’d let him choke me out with those
The Boys
strawbebby: fuck you you instigating little bitch
none pizza left beef: 🥰
mr harrington please stop sending memes challenge
nedleedle: idk. peters just not really a spider-man fan
tungsten dioxide whats this: ned leeds i am going to kill you
moonmoon: peter are you BLIND
moonmoon: he’s built as hell and he’s also so nice???? he saved our class like multiple times
The News(™): hey wait
The News(™): peter wasn’t actually there for any of those times
president lincoln: wait yeah
president lincoln: thats….really weird
The Boys
strawbebby: NED
none pizza left beef: f u c k
none pizza left beef: wait a sec
none pizza left beef: i got this
none pizza left beef: time to channel my inner percy jackson
strawbebby: FOR THE LOVE OF GOD NO
mr harrington please stop sending memes challenge
nedleedle: peter, didn’t you meet him???
nedleedle: at the internship
avril lavigne: GASP
avril lavigne: I TOTALLY FORGOT SPIDERMAN AND IRON MAN WERE BUDDIES
murphy’s law: PETER HAVE YOU MET HIM???????
tungsten dioxide whats this: uh
The News(™): THAT SILENCE MEANS YES
moonmonn: he’s met him and doesn’t like him? Cap.
president lincoln: why would peter lie???
president lincoln: oh my god
president lincoln: unless
The News(™): ABE I AM PICKING UP EXACTLY WHAT YOU ARE PUTTING DOWN
The News(™): PETER REALLY LIKES SPIDERMAN
The News(™): like….really likes him ( ͡°👅 ͡°)
tungsten dioxide whats this:
NO
tungsten dioxide whats this:
NO NO NO
moonmoon: if not true…why panic??
mindiana jones: peter has a crush on spider-man?
mindiana jones: makes sense
nedleedle: !!!!!
nedleedle: you know peter has been disappearing a lot recently
nedleedle: and it matches up with every time spider-man’s been active near here 👀
Judas!!! No!!!
One Hit KO: WHAT ARE YOU PEOPLE DOING
One Hit KO:
STOP
mr harrington please stop sending memes challenge
moonmoon: holy fuck
moonmoon: peter do you skip class to go watch spider-man
Murphy’s law: he does carry that camera around a lot
mindiana jones: now that i think of it, he never does show me his photos
Judas!!! No!!!
One Hit KO: YOU FAKE BITCH I SHOW YOU THEM ALL THE TIME
Rowdy Boys
Small™: PERCY HELP
Small™: THE GROUP CHAT IS MAKING IT SEEM LIKE IM IN LOVE WITH SPIDERMAN AND MJ AND NED ARE HELPING THEM
jalapeno eating king: gods i love this generation
mr harrington please stop sending memes challenge
president lincoln: has he met him more than once at the internship???
nedleedle: now that i think about it
nedleedle: he gets real shifty about it sometimes when i ask what he does some days
avril lavigne: h o l y s h i t
Rowdy Boys:
Small™: percy please
jalapeno eating king: alright kid
jalapeno eating king: im gonna level with you
jalapeno eating king: theres no getting out of this one
Small™: im sobbing
jalapeno eating king: that leaves only one option
Small™: ignore it until it goes away and they drop it?
jalapeno eating king: what?
jalapeno eating king: no
jalapeno eating king: lean into it. confirm you and spider-man are an item. make THEM regret this. turn the tables.
Small™: are you telling me to invent a fake relationship between me and my alter ego
jalapeno eating king: absolutely. think of how funny it’ll be
Small™: you’re incredible. thank you.
mr harrington please stop sending memes challenge
tungsten dioxide whats this: please stop guys
tungsten dioxide whats this: ill tell you the truth
tungsten dioxide whats this: just. Stop
Judas!!! No!!!
not a loser: peter?
Loser 2: dude what are you doing
mr harrington please stop sending memes challenge
tungsten dioxide whats this: im dating spider-man.
Notes:
i decided to expose every single sword member, just a little, as a treat
acdec kids got all the right numbers but came up with the wrong answer
percy being a chaotic nuetral influence on them is something that can be so personal-
not pictured: bucky frantically concered as to why percy is suddenly laughing so hard he can't breath
plumbing baby. goodbye.
Chapter 28: liquid soap
Notes:
warning!!! spoilers for up to chapter 39 of the lost soldiers!!
(See the end of the chapter for more notes.)
Chapter Text
mr harrington please stop sending memes challenge
The News(™): well
The News(™): we haven't used this in forever
President lincoln: yeah no shit
President lincoln: how are you guys?
murphy’s law: peachy.
moonmoon: still concussed 🤪
avril lavigne: yikes
moonmoon: yeah i definitely should not be on my phone but whatever
moonmoon: ive been playing papas freezeria for hours
The News(™): …are we really not going to talk about it?
Murphy’s law: well no
avril lavigne: wasn't planning on it
President lincoln: doesnt sound very fun
The News(™):
The New(™): fuck this im sorry
The News(™): PETER I CANT FUCKING BELIEVE YOU
moonmoon: betty what the hell
moonmoon: none of what happened was his fault
Murphy’s law: yeah what the fuck betty
The News(™): what?
The News(™): oh my god no thats not what im talking about
The News(™): i MEAN
The News(™): I GRILLED HIM FOR HOURS ON WHAT DATING SPIDER-MAN WAS LIKE
The News(™): HE ANSWERED ALL MY QUESTIONS
The News(™): AND I MEAN A L L OF THEM
tungsten dioxide whats this: hey man, i just finished what you people started
murphy’s law: oh holy shit
murphy’s law: NED AND MJ
murphy’s law: THEY KNEW
Scary Captain: of course we did, peter is terrible at keeping stuff from us
moonmoon: YOU LET US BE SO INVESTED IN THEIR RELATIONSHIP
moonmoon: NED WAS TEXTING ME, SHADING SPIDERMAN WHEN HE WAS ON THE NEWS FIGHTING CRIME FOR “DITCHING PETER”
avril lavigne: I SPENT HOURS DRAWING SPIDEYPARKER FANART
avril lavigne: ARE YOU FUCKING KIDDING ME
President lincoln: all that fucking photoshop work
President lincoln: ALL THAT WORK TO MAKE FAN EDITS OF THEM
President lincoln: YOU'RE A PIECE OF SHIT, JONES
Scary Captain: not my fault you guys are weird
nedleedle: yeah im going to have to agree and say this is all on you guys
murphy’s law: oh mg fogrefd
murphy’s law: remember these?
murphy’s law:
avril lavigne: peter you couldn't lie to save your life
murphy’s law:
murphy’s law: dude you cant keep anything a secret
murphy’s law:
avril lavigne: even though you couldnt keep a secret if your life depended on it
The News(™): oh lord
The News(™): im going through the entire chat history
The News(™): so much makes sense now
The News(™): that time you skipped out on acdec practice because you said you forgot to walk your fish???
tungsten dioxide whats this: fighting lizard man in the streets
moonmoon: when you said you needed to leave because you left your oven on when we all KNOW you cant cook?
tungsten dioxide whats this: bänk røbbery
moonmoon: jesus
President lincoln: three weeks ago when you came to class late because you said you needed to prune your apple tree?
tungsten dioxide whats this: was getting thrown through concrete walls by some guy with a mohawk and super strength
moonmoon: your excuses are absolute ass how did we not see this
tungsten dioxide whats this: stupid
moonmoon: >:0
Murphy’s law: last christmas??? You disappeared after lunch????
tungsten dioxide whats this: taking nap in vents
tungsten dioxide whats this: i get sleepy sometimes
avril lavigne: what about last spring when you supposedly caught the flu in the middle of may?
tungsten dioxide whats this: raiding a hydra base with the boys 💯💪 🙏🔥 the grind never stops
moonmoon: ive decided i hate this, actually
murphy’s law: the boys????
murphy’s law: BITCH DO YOU MEAN THE AVENGERS
tungsten dioxide whats this: mr. stark, colonel rhodes, vision, and pj yeah
The News(™): s
The News(™): speaki
The News(™): speaking of
[The News(™) has changed the chat name to ‘percy’s bimbos’]
moonmoon: RT RT
murphy’s law: on GOD
President lincoln: SAYING WHAT WE’RE ALL THINKIN 😩
Avril lavgine: FR
moonmoon: when he carried me i think i ascended
moonmoon: deadass no cap
moonmoon: im a new person now
The News(™): god i wish it were me
nedleedle: ive seen him in a tank top and lemme tell you
President lincoln: THE HOLY GRAIL
Avril lavigne: ned i have never been more jealous of a person in my entire life
nedleedle: good
tungsten dioxide whats this: if you guys can stop being WHORES for one second
tungsten dioxide whats this: i feel like we should talk about this in person
tungsten dioxide whats this: if you swear to not make thirst comments about my emotional support older brother figure you can all come over and we can have an actual conversation
moonmoon: …i suppose i can hold back for a bit
moonmoon: ill be over in ten
The News(™): me too
murphy’s law: x2
President lincoln: x3
avril lavigne: x4
Scary Captain: ned and i are already here. we’ll be waiting.
robert <3
[aspen <3 has been removed from the chat]
SSEA
Tony Stank: hey pete and i are testing out the lightsabers he made if you guys wanna come up and watch
skrunkly raccoon: as cool as that sounds
skrunkly raccoon: percy and i have plans
Tony Stank: plans?
skrunkly raccoon: yeah!! we’re going to go listen to this podcast about the history or liquid soap he found
skrunkly raccoon: its over 12 hours!!!!!
Tony Stank: ok
The queen and her jesters
I dont have doe eyes shut the fuck up: guys oh my god this is bad
tony stark has been using his doe eyes to convince me to do terrible things since i was in MIT: whats wrong tony?
I dont have doe eyes shut the fuck up: ok first off
[I dont have doe eyes shut the fuck up has changed tony stark has been using his doe eyes to convince me to do terrible things since i was in MIT’s nickname to ‘rocky rhoad’]
I dont have doe eyes shut the fuck up: never again
I dont have doe eyes shut the fuck up: and second
I dont have doe eyes shut the fuck up: barnes just told me he couldnt go play with lightsabers with me and peter because he was going to listen to a PODCAST
our lord and savior: let me guess
our lord and savior: with percy?
I dont have doe eyes shut the fuck up: DING DING DING GOT IT IN ONE PEP
I dont have doe eyes shut the fuck up: GIVE THE LADY A PRIZE
rocky rhoad: a PODCAST?
I dont have doe eyes shut the fuck up: you heard me
I dont have doe eyes shut the fuck up: its about the history of liquid fucking soap
I dont have doe eyes shut the fuck up: and it gets worse
rocky rhoad: how can it get any worse???
I dont have doe eyes shut the fuck up: he used excalamation points
I dont have doe eyes shut the fuck up: i have literally never seen him do that
I dont have doe eyes shut the fuck up: he was genuinley excited about this
rocky rhoad: oh sweet jesus this is bad
I dont have doe eyes shut the fuck up: I KNOW
I dont have doe eyes shut the fuck up: theyre all EMOTION-Y
our lord and savior: tony…
I dont have doe eyes shut the fuck up: no pepper you dont get it
I dont have doe eyes shut the fuck up: they got FEELINGS all over my LAB
our lord and savior: :|
I dont have doe eyes shut the fuck up: i swear to god i see bucky reading to percy while laying on the couch together i WILL be using the eject button
our lord and savior: i think its sweet
I dont have doe eyes shut the fuck up: sweet?????
I dont have doe eyes shut the fuck up: you know what. sure.
I dont have doe eyes shut the fuck up: lets encourage the world’s deadliest assasin to befriend the felon who is the power equivalent of a nuke. and it’s sweet. why not.
rocky rhoad: percy’s a felon?
I dont have doe eyes shut the fuck up: hes never been caught but there is not a single bone in my body that does not believe he’s commit at least fifteen
our lord and savior: im sorry??
our lord and savior: “befriend”?????
I dont have doe eyes shut the fuck up: what
our lord and savior: oh sweetie
Notes:
uhhhh when does this take place you ask????? uh....*checks notes* somewhere past chapter 39?? but also bucky is here??? so before he got Snatched??? but that happened before all this and--
yeah man i dont even know. just take your happy fun times and leave.
I HAD TO SLIP THE LITTLE BIT OF ANGST IN AND IM NOT SORRY
pepper rhodey and tony chat is something so underrated-
enjoy bucky being an absolute SIMP
it must be known that
-him reading to percy has become a regular thing, percy often falls alseep listening to his voice. even when he does, bucky keeps reading because he seems to have less nightmares
-they DO in fact snuggle while listening to the podcast
and also
-the acdec team was so fucking invested in spideyparker. fanart, edits, the whole nine yards. peter was having the time of his life, ned helped him make up fake relationship drama.yeah uh. ill probably be going back to my regular posting schedule so. that means more of this though!! which will absolutely be ignoring my canon for the most part!
enjoy ig
plumbing baby. goodbye.
Chapter 29: husband shaped :)
Notes:
(See the end of the chapter for notes.)
Chapter Text
percy’s bimbos
moonmoon: EVERY TIME I THINK HE CANT GET HOTTER
president lincoln: I WAS LITERALLY ON THE G R O U N D
president lincoln: THERE'S ‘PRESIDENT’ IN MY USERNAME MR JACKSON SIR WILL YOU YELL AT ME NEXT
Murphy’s law: LIKE JESUS FUCKING CHRIST THE BIG DICK ENERGY
The News(™): every time he shut down landry i opened up a new tab for wedding venues
avril lavigne: RT RT
avril lavigne: SHE JUST LIKE ME FR
nedleedle: yeah it was pretty hot
mindiana jones: ive literally never been more attracted to somebody
tungsten dioxide whats this: can you guys shut the fuck up please
moonmoon: literally never
Murphy’s law: not even after death
tungsten dioxide whats this: you know what
tungsten dioxide whats this: i didn't want to do this
tungsten dioxide whats this: but you savages leave me with no choice
avril lavigne: oh ?
avril lavigne: will peter finally show up in a bloodstained cape and put us all out of our thirsty, thirsty misery?
tungsten dioxide whats this: @spicey
mindiana jones: NO
avril lavigne: oh god
avril lavigne: cant decide if this is better or worse
mindiana jones: percy dont read up
mindiana jones: please
spicey: yeah ok
murphy’s law: HE SPEAKS
spicey: sometimes
tungsten dioxide whats this: percy.
spicey: peter?
tungsten dioxide whats this: would you be interested in marrying seven science nerds?
tungsten dioxide whats this: be honest.
spicey: im sorry?
tungsten dioxide whats this: just answer the question
spicey: i am interested in marrying one (1) science nerd
moonmoon: oh god oh fuck we have to fight now
moonmoon: abe im sorry youre my biggest competition im coming for you first
president lincoln: i will obliterate you
The News(™): sally,,,,
The News(™): forgive me for what has to happen
avril lavigne: oh no
avril lavigne: i accept the fact that my deadly peanut allergy would make me an insufficient partner and will therefore be my demise. at least make me go with a reese's cup?
The News(™): you got it babygirl
spicey: what are you people talking about
murphy’s law: dont worry your pretty little head about it <3
spicey: ??????????
tungsten dioxide whats this: more importantly what are YOU talking about???
tungsten dioxide whats this: you want to marry one??? YOU WERE SUPPOSED TO DIFFUSE THE SITUATION BY SAYING NO
spicey: WHAT SITUATION????
tungsten dioxide whats this: wait you dont
tungsten dioxide whats this: oh my god
tungsten dioxide whats this: WHO WERE YOU TALKING ABOUT
spicey: WHAT????
tungsten dioxide whats this: THIS
spicey: i am interested in marrying one (1) science nerd
tungsten dioxide whats this: HOLY SHIT PLEASE DONT TELL ME YOU MEAN TONY
tungsten dioxide whats this: FUCKING SHIT PLEASE
tungsten dioxide whats this: I CANNOT HANDLE HAVING TWO FATHER FIGURES AT ONCE
spicey: of course i do not mean tony???
spicey: peter are you okay
tungsten dioxide whats this: NO
tungsten dioxide whats this: WHO WERE YOU TALKING ABOUT
spicey: my boyfriend???????
moonmoon:
The News(™):
murphy’s law:
avril lavigne:
nedleedle:
mindiana jones:
president lincoln: ʸᵒᵘʳ ʷʰᵃᵗ
spicey: boyfriend
tungsten dioxide whats this: oh this worked out so much better than i could've hoped
murphy’s law: you
murphy’s law: you’re dating someone?
spicey: yeah!
spicey: :)
moonmoon: i want to be mad but i cant.,.,.,.he sounds so enthusiastic.,.,.,.
president lincoln: it was our mistake to assume a piece of ass like that would not have other suitors
avril lavigne: we were, devastatingly, too late
spicey: what?
tungsten dioxide whats this: forget that
tungsten dioxide whats this: who is this mysterious boyfriend??
spicey: here wait
spicey: hi peter
tungsten dioxide whats this: hewwo??
spicey: i have percy’s phone because he doesnt want to figure out how to do this
spicey: give me one second
[spicey has added James Barnes to the chat]
[spicey has changed James Barnes’s name to ‘terminator’]
nedleedle: DEADASS?
[spicey has left the chat]
The News(™): NOOOOOOO
terminator: he said you people were confusing
terminator: and scrolling upwards, i think i agree
murphy’s law: p l e a s e tell me that we havent been thirsting after the WINTER SOLDIERS BOYFRIEND
terminator: i hate to break it to but you most definitely have
moonmoon: oh lord he’s still scrolling
terminator: wow some of these are explicit
avril lavigne: tell my cats i love them
terminator: do you guys not have hobbies?
terminator: charles i dont even think the human body can move like that
murphy’s law: …..thinking back? I dont even know which message ive sent that got that response
murphy’s law: there are many options
nedleedle: hey cheer up
nedleedle: maybe we can get group tombstones
The News(™): all i ask of you sergeant barnes
The News(™): please dont get my blood on my moms new carpet
terminator: what?
terminator: jesus im not going to kill you guys
moonmoon: we literally have a groupchat dedicated to lusting over your boyfriend
tungsten dioxide whats this: remember the good old days when this was about ACDEC STUFF
mr president: ah, the dark ages
terminator: yeah and?
terminator: fr i would too
terminator: art is meant to be appreciated and all that
moonmoon: i-
avril lavigne: well hes not wrong but
avril lavigne: this just isnt how i expected this conversation to go
president lincoln: his JAWLINE looks like its carved from MARBLE
president lincoln: im so sorry i couldnt hold it in any longer
[terminator has changed their name to ‘terminator (percy simp)’]
terminator (percy simp): I KNOW RIGHT
moonmoon:
avril lavigne:
The News(™): WE GOT ANOTHER ONE BOYS
terminator (percy simp): hes so CUTE
terminator (percy simp): LOOK AT HIM
terminator (percy simp): [Image Attachment: The phone is pointed down at Bucky’s lap, where Percy is laying, eyes closed. He has headphones on, and is wearing one of Bucky’s sweatshirts. His hair is messy, and he looks content as he sleeps.]
murphy’s law: SCJQEGFEWJBFSJKFQREJH
moonmoon: JLKNLBLASAGDF
The News(™): FINALLY
The News(™): SOMEONE WHO ISNT STINGY WITH CONTENT
president lincoln: *cough*peter*cough*
tungsten dioxide whats this: really
president lincoln: yes REALLY
terminator (percy simp): to each their own i guess
terminator (percy simp): but this right here is most definitely my own
terminator (percy simp): hes husband shaped :)
tungsten dioxide whats this: WOAH WOAH W O A H
tungsten dioxide whats this: SLOW DOWN THERE BUSTER
tungsten dioxide: YOU'VE KNOWN HIM FOR LIKE A FEW MONTHS
terminator (percy simp): and? i have EYES peter
mindiana jones: oh my god you two are like u-hual lesbians
terminator (percy simp):
terminator (percy simp): yeah pretty much
terminator (percy simp): we did skip the ‘asking out’ part and went straight for love confessions and almost dying for eachother
avril lavigne: i mean me too
moonmoon: yeah i’d do the same
tungsten dioxide whats this: i fucking hate it here
Unknown Number and TS
Unknown Number: This isn’t funny, Stark.
TS: wha
Unknown Number: Take down the fake account.
TS: the FUCJK afe yoi talking about
Unknown Number: Are you drunk?
TS: no iys just THREEW IN THR GODDAMND MORNINF
Unknown Number: Ah, right. Just take it down.
TS: WHASR are yoh TALKIJNG ABOUT
Unknown Number: The Twitter account.
TS:
TS: wait
TS: FURUY???
Unknown Number: Yes, Stark. I’m telling you to take it down.
TS: I DONT RUN IT
Unknown Number:
Unknown Number: Is this a joke?
TS: NO
TS: IVE BEEN TRYINF TO FIGHURE OUT WHOS BEHIND THAR FOR MONTHS
Unknown Number: Are you serious?
TS: YES
TS: I THOUGHT IT WAS YOU????
TS: THEY POSTED PICTURES OF YOU THAT I CANT FIND ANYWHERE ONLINE
Unknown Number: Hm.
Unknown Number: Go back to sleep, Stark.
Notes:
bucky is a fucking NERD okay???
the acdec kids gearing up to hold a hunger games even though they all have peanut allergies and asthma
bucky and percy are so head over heels in love with eachother its actually kinda gross
do i call the next installment of this fic after TLS 'the babygirlification of percy jackson' yes or no
more cryptid fury account content :)
ANYWAYS I NEED HELP MAKING A SHIP NAME FOR THEM
IVE BEEN USING WINTERSEA IN MY HEAD BUT IDK
IM TAKING SUBMISSIONSplumbing baby. goodbye.
Chapter 30: yes chef
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
Tony Stank: so i was cleaning out an old storage closet and i found an old box of my dad’s stuff
baby avenger: >:(
Tony Stank: who wants to help me build a bonfire and toss it in
baby avenger: >:)
mindiana jones: disrespecting howard stark?
mindiana jones: ill be there in 10
Tony Stank: dont you live like 45 minutes away
mindiana jones: i said ill be there in ten
Tony Stank: yeah ok
skrunkly raccoon: i knew something was up with that asshole when i woke up decades later and there was no flying car
skurnkly raccoon: he promised me a flying car tony
Tony Stank: i am aware yes
Tony Stank: he was a piece of shit in many ways
skurnkly raccoon: percy and i are on our way
skrunkly raccoon: hey perce do you have anything of your dads i can burn too
percenary: what
percenary: no
gitc: your dad sucks too?
skrunkly raccoon: yes he does
percenary: hes a god they all suck a little
percenary: but no i will not be contributing to the burning pile
skrunkly raccoon: :|
perccenary: james, darling,
percenary: he is a GOD
percenary: he didnt exactly leave stuff behind or send gifts for dia de crianças
baby avenger: thats
baby avenger: thats actually pretty sad
percenary: hey focus on tony’s daddy issues not mine
Tony Stank: hey fuck you
percenary: bitch
baby avenger: OKAY
skrunky raccoon: im having ned do a crayon drawing of your dad and tossing it in
gitc: im honored to be involved
percenary: hes not that bad
percenary: once he lent me his trident so i could kill his grandma
baby avenger: paternal or maternal?
percenary: irrelevant, same lady
skrunky raccoon:
skrunky raccoon: you've got to stop saying stuff like that if you expect people to not be concerned
skrunkly raccoon: anyways the only good thing percy’s dad has done was have a hot son
skrunkly raccoon: ned get the crayons
gitc: on it
robert <3
egg: guess what i just got my grimy little hands on :)
local milf: im scared
egg: good!
egg: [Photo Attachment: It’s a photo of Bridgette, looking around 12. She’s wearing a loose, flowy dress, and is sitting slumped over on a porch step, glaring at the camera, arms crossed in front of her chest. Behind her, someone is standing with a comb and a pair of scissors, trying to deal with the absolute mess of her hair. It’s frizzy and knotted, and she looks a combination of miserable and enraged.]
certified monster fucker: awwwwww little angry bridge <3
class traitor: i can feel the preteen rage
local milf: stop this madness
egg: but seriously what is going on here
local milf:
local milf: ᶦ ᵍᵒᵗ ᵍᵘᵐ ᶦⁿ ᵐʸ ʰᵃᶦʳ
certified monster fucker: im sorry what was that
local milf: I GOT GUM STUCK IN MY HAIR OKAY
egg: someone stuck it in your hair?
local milf: no
local milf: it was a bubble gone wrong alright
certified monster fucker: i-
local milf: how did you even GET that
egg: oh you know
egg: my man on the inside
local milf: wait you mean
class traitor: ✨ 𝓂𝑒 ✨
local milf: Y O U
local milf: [Image Attachment: This time, it’s Dan. He’s about 14, spotted with acne and with neon green braces. His face looks to be in a permanent wince. He’s sitting on the floor of what looks like a dorm room, holding a video game controller in his hands.]
class traitor: NO
class traitor: I THOUGHT I ERASED ALL EVIDENCE OF MY CROSSBITE
thor understudy: ┬┴┬┴┤ ͜ʖ ͡°) ├┬┴┬┴
class traitor: LEE
certified monster fucker: i actually enjoy this
egg: [Image Attachment: Ross, age 11, hanging upside down from a thick tree branch. Theres a gap in his teeth, and he’s wearing a sweatshirt with a cartoon character on it. His smile is so wide his eyes are crinkling.]
egg: [Image Attachment: It’s the same photo, but Ross is now just a downwards heading blur.]
egg: [Image Attachment: Now, it’s just Ross facedown in the dirt.]
certified monster fucker: nvm
class traitor: well, in the interest of fairness
class traitor: [Image Attachment: Mal, age 13, covered head to toe in bright orange paint. They’re holding a single paintbrush in their hand, and are stunned still, eyes wide.]
egg: THIS ISNT FUNNY ANYMORE
certified monster fucker: oh yes it IS
egg: I DIDNT MEAN TO KNOCK OVER THE PAINT CANS OKAY I JUST WANTED TO MAKE A LITTLE PICTURE
local milf: oh you certainly made a picture alright
thor understudy: pfft
egg: DAN
egg: DAN GIVE US LEE BLACKMAIL
egg: I WILL NOT STAND FOR THIS INEQUALITY
class traitor: GOT IT
class traitor: [Image Attachment: Lee, bundled up in a parka, standing in what looks like an arctic wasteland. She’s standing on a dog sled, a team of malamutes, samoyeds, and, worryingly enough, what looks like a wolf, leashed up to the front. She’s wearing so many layers she can barely put her arms down.]
egg: I MEANT A CHILDHOOD PICTURE
class traitor: yeah she’s like 13 in that
egg:
egg: lee how tall were you in the seventh grade
thor understudy: 6’3
egg: i hate you so much
certified monster fucker: forget lee’s slendermen genes, is that a DOG SLED?
thor understudy: yeah
thor understudy: i was going to school
certified monster fucker: cut the shit
thor understudy: im serious
class traitor: it fucked me up too, but that’s how she got around
class traitor: not a car nor gas station in that town
thor understudy: hey
thor understudy: one (1) truck that belonged to the police
certified monster fucker: the police had a truck. A truck. ONE truck.
thor understudy: yeah, his name was oskar and he also gave the driving tests, officiated weddings, and occasionally delivered a baby
egg: what the fuck
thor understudy: he also helped run the polar bear defense league
thor understudy: they’d have eaten the elderly if not for oskar and his truck
class traitor: ok thats not the thing i wanted to bring up by sending this photo but
class traitor: lee, what were the names of your dogs
thor understudy:
thor understudy: betong
egg: you named a dog betong
class traitor: correction, she named SIX dogs betong
certified monster fucker: all six???
class traitor: all six.
thor understudy: they knew who i was referring to when i called their names
thor understudy: they knew who i meant
egg: ok but betong is a cute name
class traitor: lee.
thor understudy:
thor understudy: 😔
thor understudy: it means concrete in norwegian
egg: oh my fucking god
supreme overlord jackson: a noble name.
thor understudy: :)
certified monster fucker: your favoritism disgusts me
local milf: hey commander do you have any fun childhood photos
supreme overlord jackson: hm
supreme overlord jackson: i suppose. of what age?
local milf: mmmm about 11-14
supreme overlord jackson: this is one of my mother’s favorites
supreme overlord jackson: [Image Attachment: It’s a 14 year old Percy, curled up on the floor with Mrs. O’Leary, taking a nap. One of her paws is thrown over his body, and his face is squished into her fur.]
local milf: awwwwwww
certified monster fucker: i KNEW you were a mamas boy
supreme overlord jackson: well, of course i am. my mother is fantastic.
thor understudy: 15/10 mom
class traitor: fr fr, i was in her presence for like two seconds and it made me a better person
egg: awww what no fair i wanna meet her
supreme overlord jackson: no
egg: :(
supreme overlord jackson: you guys have work to do. Dan, you need to finish filing those reports from Kathmandu. Lee and Mal, you’re still on that investigation from last week. Bridgette, Ross, you’re cataloging evidence.
local milf: yes, chef!
class traitor: yes chef!!
thor understudy: yes chef
egg: yes, chef
certified monster fucker: yes chef!!!!!!!
supreme overlord jackson: you people exhaust me.
Notes:
bucky hates poseidon so much asdfhkfs
also howard stark hate party ✨
in conclusion
lee, speeding across the snow of a desolate norwegian town with a population of like 8: FUCK YEAH, CONCRETEplumbing baby. goodbye.
Chapter 31: chloe the spider and pepperkaker
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
baby avenger: mr stark
baby avenger: mr stark
baby avenger: M R S T A R K
Tony Stank: jesus christ kid
Tony Stank: Is something wrong?
baby avenger: yes!!
Tony Stank: I'm on my way.
baby avenger: wait no
baby avenger: not like that
baby avenger: im fine i swear
skrunkly raccoon: he was already in the suit-
skrunkly raccoon: but whats wrong, kid?
baby avenger: SOMEBODY
baby avenger: never told me about antman >:(
Tony Stank: huh
baby avenger: mr. lang!!! ANTMAN!!!!
baby avenger: my bug bro!!!
baby avenger: and you didnt tell me about him :(
Tony Stank: kid you FOUGHT him
percenary: ah, yes, the walmart parking lot fist fight
Tony Stank: percy shut up
baby avenger: i didnt know he was called ANTMAN
baby avenger: he was just some dude
Tony Stank: …okay? well now you know
baby avenger: he can talk to ants mr. stark
baby avenger: thats so cool
baby avenger: i want to talk to ants
Tony Stank: literally why
baby avenger: they seem wise
percenary: ocean bugs know some shit
baby avenger: see!!! unexpected buggy wisdom
Tony Stank: god your so weird
Tony Stank: and why would you be able to talk to ants? shouldn't you talk to spiders?
baby avenger:
baby avenger:
Tony Stank: you didn't consider that did you
baby avenger: nope
baby avenger: brb
percenary: are you proud of what you raised
Tony Stank: yes shut up
percenary: just checking
Tony Stank: and the ocean bugs?
percenary: helped me pass calc
baby avenger: i cannot find a spider to befriend :,(
baby avenger: time to go lay down in a puddle of soup face first
Tony Stank: jesus christ
percenary: hey wait
percenary: gimme a sec
drinking groundwater is good for the soul
pj masks: hey lee
teletubblees: yes
pj masks: want to help spider-man figure out if he can communicate with his brethren
pj masks: he needs some spiders
teletubblees: im already in the car
Bridgette Lehey has created a new chat
Bridgette Lehey: why did my lee just stop in the middle of his baking, grab a terrarium, and get in his car
Commander Jackson: i have no idea what you’re talking about, sorry
percy’s bimbos
tungsten dioxide whats this: guys
tungsten dioxide whats this: get ready
tungsten dioxide whats this: im about to meet a big fluffy tarantula to see if i can speak to it
tungsten dioxide whats this: and maybe get some new friends who have some SHAME :)
moonmoon: i said what i said about his thighs.
tungsten dioxide whats this: god i hate you people
tungsten dioxide whats this: one of percy’s coworkers just showed up to my house with a terrarium
tungsten dioxide whats this: spiders name is chloe
president lincoln: i love her
tungsten dioxide whats this: oh my god shes so soft
murphy’s law: peter if you start hanging around spiders i will use raid on you i swear to god
murphy’s law: you are the only spider i can deal with
nedleedle: wow charles that's so speciesist
The News(™): so not cool, charles
avril lavigne: yeah man wtf
murphy’s law: ?????
murphy’s law: i'm ARACHNAPHOBIC?????
moonmoon: okay and? Im heterophobic but you don't see me kicking out straight people
murphy’s law: you’re the one that started a petition to get flash removed from the chat
murphy’s law: when he tries to talk to you, you just stare at an invisible camera like you’re on the office and never respond
moonmoon:
moonmoon: oh fuck right lmao
tungsten dioxide whats this: the spider man is very nice
nedleedle: peter what have we said about referring to yourself in the third person
tungsten dioxide whats this: :|
tungsten dioxide whats this: the spider man, not the spider-man, ned. god.
nedleedle: shit how could i forget about the hyphen
nedleedle: peter, love of my life, im so sorry
nedleedle: please forgive me
tungsten dioxide whats this: mmmm bring me some skittles and we’re even
nedleedle: done <3
tungsten dioxide whats this: <3
tungsten dioxide whats this: but yeah the man who brought me chloe is very nice
tungsten dioxide whats this: he left us to play and is now baking
Scary Captain: okay but
Scary Captain: peter can you or can you not speak to chloe
tungsten dioxide whats this: maybe???
tungsten dioxide whats this: she did a little chirp thing and i got the message
tungsten dioxide whats this: but it wasn't like. words? I just knew what she meant
The News(™): oh my god are you serious
The News(™): thats so cool
tungsten dioxide whats this: she likes fiddle music?????
tungsten dioxide whats this: why does this spider have a norwegian accent
The News(™): oh my god peter you can’t just ask people why they have a norwegian accent
Scary Captain: ask her, idiot
Scary Captain: thats a thing you can do, apparently
tungsten dioxide whats this: shit u right
Scary Captain: dumbass
tungsten dioxide whats this: shes an immigrant from norway!!
tungsten dioxide whats this: this spider has so much life experience and wisdom for me
tungsten dioxide whats this: !!!! aunt may’s home !!!!
avril lavigne: show her chloe!!
President lincoln: yes!
President lincoln: share the nordic arachnid wisdom
tungsten dioxide whats this:
tungsten dioxide whats this:
tungsten dioxide whats this:
nedleedle: buddy?
nedleedle : you okay?
tungsten dioxide whats this: h
moonmoon: …peter?
tungsten dioxide whats this: he’s flirting with may
tungsten dioxide whats this: chloe's father is flirting with my aunt
tungsten dioxide whats this: he’s in my kitchen, baking cookies, and flirting with my aunt.
president lincoln: PFFFTTTTTT
The News(™): SFJDLBGFKJSBVJREBGVHRGVIRUEQJDFJK
tungsten dioxide whats this: dont LAUGH
moonmoon: mays a milf, idk what you want man
tungsten dioxide whats this: S T O P
nedleedle: you better start bonding with chloe, cause i think you’re about to get a new sister
tungsten dioxide whats this: MAY IS BLUSHING
tungsten dioxide whats this: SEND HELP P L E A S E
tungsten dioxide whats this: oh my god this is terrible
murphy’s law: are his pickup lines bad or something?????
tungsten dioxide whats this: no they're TERRIFIC and they're WORKING
Scary Captain: there are worse things
Scary Captain: at least you know he will accept you for your spidery self
nedleedle: he will feed you bugs <3
tungsten dioxide whats this: I DON'T EAT BUGS
tungsten dioxide whats this: thank fuck another one showed up
moonmoon: please tell me its Him
tungsten dioxide whats this: don't capitalize that jesus christ
tungsten dioxide whats this: and no, its bridgette
tungsten dioxide whats this: she’s really nice! and shes here to reign lee in
tungsten dioxide whats this: she just watched him hand me a cookie and call me champ
The News(™): and how did that make you feel
tungsten dioxide whats this: very gender affirmed but also very conflicted
nedleedle: ask him to play catch with you
tungsten dioxide whats this: bridgette has inserted herself into the conversation, all is well
president lincoln: give us the transcript king
tungsten dioxide whats this: ok ok
tungsten dioxide whats this: bridgette: you stopped baking and left and i wanted cookies, so now i'm here
tungsten dioxide whats this: (they are really good cookies so)
tungsten dioxide whats this: lee: had to bring chloe to a playdate. and this is may (said in a way i do NOT like)
tungsten dioxide whats this: bridgette is looking at her
tungsten dioxide whats this: ma’am please. please take him away from here.
moonmoon: your lord and savior, bridgette
tungsten dioxide whats this:
tungsten dioxide whats this:
tungsten dioxide whats this: charles is that option for raid still open
The News(™): ?
tungsten dioxide whats this: i assumed bridgette was going to save me. to put a stop to this madness.
tungsten dioxide whats this: but this FOUL WOMAN has JOINED IN
tungsten dioxide whats this: she is TAG TEAM FLIRTING WITH MY AUNT
tungsten dioxide whats this: IM TAKING CHLOE AND IM LEAVING
president lincoln: im fucking sobbing
avril lavigne: THIS is queer excellence oh my god
avril lavigne: the TEAMWORK
tungsten dioxide whats this: my aunt was tag team flirted by a nonbinary 6’9 norweigan spider dad and his pretty gf who can sniff out pepperkaker cookies like a bloodhound.
tungsten dioxide whats this: this is my homophobic origin story.
Notes:
peter's really going through it huh
every time i write lee it physically pains be cause he is 6'9 for some godawful reason and i cant even imagine a human being that tall
and YES i am very proud of 'teletubblees'
lee fr stopped in his baking, grabbed chloe and his mixing bowl, drove to peter's, gave him chloe, and resumed his baking in their kitchen
anyways, teaming up with your partner to flirt with a milf IS queer excellence, i dont take criticism.plumbing baby. goodbye.
Chapter 32: halloweenie
Notes:
(See the end of the chapter for notes.)
Chapter Text
Halloween was always a big deal at Stark Tower.
The entire place, from the lobby to the penthouses, was opulently decorated with fake spiderwebs, jack o’ lanterns, and fake bats hanging from the ceiling. Animatronic witches and scarecrows lurked behind corners, jumping out and repeating recorded lines at unsuspecting employees. Peter was fairly sure that they were under FRIDAY’s control, and after a terrifying experience with the witch on the 32nd floor (in which his spidey-sense was of zero help), he did his best to keep the AI in a good mood.
Rumor has it that one of the legal department heads who’d been unnecessarily critical to the interns, had been under constant bombardment. Sometimes, Peter worried about how vindictive Fri could be. But, then again, she had very good judgment, and, well, who was he to interfere?
Even the elevator music had been replaced for the month—as he ascended to the top floors, Monster Mash was playing from the speakers. Peter rocked back and forth on the balls of his feet, watching the floor number tick up. He checked his watch as the doors opened. MJ and Ned were coming early so they had time to set everything up, but he wanted to get a head start, just in case.
When he stepped out into the common room, he was greeted with the sight of Mr. Stark in one of Colonel Rhodes’s shirts and jackets. He was craning his neck up at the ceiling and debating something with FRIDAY, giving Peter a distracted wave as he spoke with his AI.
Peter wandered into the kitchen, grabbing a juice box from the fridge and hopping up on the counter to sit. “Are you Colonel Rhodes?” He asked after taking a long sip.
Mr. Stark looked over. “Yep. He’s Pepper, and she’s me. For some reason, she drew the line at getting part of her sternum carved out and replaced with an electromagnet, though.” He said with a shrug.
“Weird.” Peter agreed.
The engineer looked him up and down. “What’s going on here?” He asked after a second. Peter looked down at himself, then back up at Mr. Stark. “I’m Po.”
He wrinkled his nose. “What the shit is a Po?”
Peter’s eyes widened. “Oh, you are in for a treat, Mr. Stark,” He said, pulling out his phone and opening it. For the next ten minutes, he showed Mr. Stark photos of the teletubbies, outlining their various strengths and weaknesses.
“—and I’m the red one over there, Po. Personally, I think she’s the best one. She’s one of the shorter ones, sure, but she’s scrappy. She’s also bilingual! She speaks Cantonese, Mr. Stark, how cool is that? And she has a scooter, which is way better than the other things the rest of them have. She has the widest range of skills and abilities, and I want to be just like her.”
Mr. Stark leaned slightly away from him. “Alright, then.” He said after a second. “I guess I’m getting you a scooter for your birthday.”
Peter’s eyes widened. “I’m ready for my ankles to be obliterated, sir. I was born ready.”
MJ and Ned showed up next. They, like Peter, were dressed in giant, monochromatic costumes. MJ was Tinky-Winky because he was the tallest of the four, and she enjoyed the controversy around him and his purse. Ned was Dipsy, because he had a cool hat. Ned also had a cool hat. So, Dipsy,
None of them were Laa-Laa.
They hated Laa-Laa.
The three of them, with the help of Mr. Stark, set up the rest of the decorations and laid out the snacks on the coffee table. FRIDAY contributed with a playlist she lovingly cultivated, which started off strong with a Shakira song and moved onwards to a recording of Godzilla roars remixed into the Home Depot Beat.
Peter had never felt more strongly about his love for this AI.
By the time they were finished, spiderwebs covered the majority of the walls and ceilings. Unfortunately, Peter’s teletubby costume was quite thick, and he did have some difficulties sticking to the ceiling. He’d only fallen on his head three times, though, and the padding was probably enough to protect his cranium.
Then, everyone else showed up, which is where the problem began.
First, it was Cindy. After saying hello to everyone, she went to the bathroom to fix her makeup, her bag in her hands.
Charles showed up not a minute after her. MJ blinked, then slowly turned to Ned, who shrugged. “Hey, did I leave my hat here last week?”
Peter nodded faintly. “It’s in the coat room.” He said, pointing down the hall. Charles gave him a thumbs up and wandered out of the room.
After that, Abe. “Hey, can I get a glass of water?” He asked as he stepped out of the elevator. Ned choked on his juice as he caught sight of him. Peter pat him vigorously on the back as MJ nodded and directed Charles to the kitchen, lowering herself down onto the loveseat as she did so. “I need to sit down.” She whispered.
Then, Sally, who walked into the living room, only to immediately drop her phone. “Shit,” She muttered, getting down onto the carpet to retrieve it from under the couch.
It was then that Betty showed up. At this point, MJ was still on the couch, numb to the world, and Ned was wheezing.
It fell apart all at once. Cindy returned from the bathroom. Charles walked in with his hat. Abe came in with a glass of water. Sally stood up from her stop behind the couch. Betty stepped out of the elevator.
For a very long moment, it was deadly silent. Each of the standing AcDec members looked around the room, taking in the others. Abe’s cup slid out of his lax fingers and hit the carpet.
“You’ve got to be fucking kidding me.” Cindy burst out.
Charles whipped around to stare at her. “We’ve got to be joking? This was my idea first!”
“Like hell it was!” Sally butt in. “I told you guys I was going to be doing this!”
“You most certainly did not!” Abe said shrilly. “If you had, none of us would look like this!”
MJ’s head was in her hands, shoulders shaking. Peter wasn’t sure if she was laughing or sobbing. Peter wasn’t sure if he was laughing or sobbing. Ned’s wheezing got louder.
“This,” Betty said, eyes wide, “Is terrible.”
“No shit, Sherlock.” Charles snapped.
“Fuck you, it’s King Bob to you, cretin.” She bit back.
Cindy tugged at her hair. “We can’t refer to you as King Bob, Betty, we’re all King Bob.”
Betty sniffed. “With that shade of yellow? I think the fuck not.”
And just like that, Peter, Ned, and MJ watched as five teenagers dressed as minions devolved into fist fighting.
Peter opened his mouth, closed it, then opened it again. “Are you dressed as Pitbull?”
Ross, in a bald cap and suit, nodded from his spot leaning against the doorframe. “What about it?”
“Nothing.” Peter said quickly. “Just…can we come in?”
Ross looked over his shoulder at the other two teletubbies and the disheveled minions behind him. He squinted, then shrugged, stepping back to let them in. “Sure.”
They filed into the bullpen gawking shamelessly. Should they be in a top secret government facility? Probably not. But by God are they.
Everything was decorated, too. Like Stark Tower, spiderwebs, pumpkins, and bats seemed to be the main themes. In the corner, there was a leafless tree in a large pot that had been decorated with what looked like violets with eyes stuck in the middle and a skull on top. On each of the desks, there was a carved pumpkin. The artistic skills ranged considerably; Bridgette’s had the neat outline of a ghoul, Lee’s had a perfectly symmetrical frowny face that was oddly reminiscent of him, Ross’s had a shaky rendition of Venom, Mal’s had what looked like Mothman, and Dan’s…looked like someone had taken a chainsaw to a poor pumpkin.
There were jumbo bags of candy scattered around, and someone had set up a projector playing what looked like one of the Halloween episodes of Lab Rats. All in all, it looked like a pretty good Halloween party.
Ross raised an eyebrow at them. “What happened to you guys?”
The minions exchanged weary glances. “We don’t want to talk about it.” They all chorused. Then, Cindy, who’s yellow face paint had been rubbed off by the carpet Abe had ground her face into, hefted up a grocery bag. “We did bring bean dip though.”
That seemed to seal the deal for Ross, who took the bag and placed it on one of the desks. Peter looked around, doing a mental headcount. “Where’s Percy?” At his name, the others behind him perked up. Disgusting.
“We were walking to the tower to get ready when he got a call from one of his cousins. Apparently, somebody got their hands on a summoning how-to that was a bit too accurate, and now one of Percy’s half siblings is rampaging somewhere in the Gulf of Mexico.” Sergeant Barnes said, walking down the steps from Percy’s office. “He just called—he’ll be here in ten.”
Though he was lacking the cowl, Sergeant Barnes’s Batman costume was scarily good. The plated armor fit him perfectly, and the dark lining around his eyes dramatized the steely blue. Behind him, Abe made a choking noise and Peter grit his teeth. Cindy wasn’t even trying to be subtle as she looked him up and down, eyes resting on the man’s thighs. Peter’s hand curled into a fist.
Teletubbies do not use violence as a first resort. Teletubbies do not use violence as a first resort. Teletubbies do not use violence as a first resort.
He stopped in front of Peter, brow raised. “What are you guys doing here?”
“I’d like to know that as well, please!” Mr. Stark called from one of the couches. “I specifically left the tower so whatever you little shits did wouldn’t end up damaging my person.”
Peter winced. “Well…” He dragged out, scratching the back of his neck. Or, well, he tried. The Po suit was very large. Mr. Stark narrowed his eyes. He looked at Sally’s hair, which had been ruthlessly pulled out of one of its pigtails, the giant slap mark on Charles’s face, the rip in Betty’s sleeve. The man grit his teeth. “What did you do.” It wasn’t a question.
“There was an altercation. We…thought it best to leave the scene of the crime.” Peter said diplomatically.
“Crime?!” Mr. Stark yelled.
“Bad choice of words.” MJ amended for him. “We just thought leaving was a good idea.”
Mr. Stark put his head in his hands. Colonel Rhodes rubbed a soothing circle on his back. Sergeant Barnes just sighed.
Cindy clapped her hands together. “Enough about our potential Geneva Conventions violations!” She chirped. “What are you guys dressed as?”
The SWORD members all exchanged looks before shrugging in sync. Dan, who was wearing a crop top and platforms, raised a hand. He was wearing a bald cap and was bright blue. “Slutty Megamind.” He said easily. “This is fabric dye. I didn’t have skin paint. It won’t be coming off. But that’s okay, because I’m serious about my slutty Megamind lifestyle.”
Ned nodded. “Live your truth.”
Then, Mal spoke up. “I’m a Furby.” She was in a fuzzy, bright pink sweater with white spots. A pair of blue plastic ears resting atop her head. She was also covered in what was most likely fake blood. Sally took a careful step back.
Bridgette, whose hair had been dyed a rich orange-red color, smiled at them. “I’m Starfire.” She said. Then, she pointed at Lee, who was in dark cargo pants and red kevlar. “And he’s Robin.”
Sally cooed quietly from behind MJ. Abe was still staring at Sergeant Barnes, who looked up. “Batman.” He said simply. “Little different than how I remember him, but that’s probably for the best.” Peter pulled up the mental image of the ‘40s version, then nodded.
Mal passed them a bowl of candy, though it looked like all the Milk Duds had been picked out. Peter eyed the suspiciously full pouches on the sides of Lee’s pants. The pathologist met his gaze head on and raised a challenging eyebrow. Peter looked away and made a grab for some jelly beans.
They heard the slam of the entrance door and his voice before they saw him. “Can somebody please tell me why there’s a fucking cacodaemon in the middle of the godsdammned tower?” Percy’s furious voice rang out.
The entire AcDec group cringed, slowly turning around to face the man.
This was…this was so much worse, actually. Peter didn’t even want to look at the rest of his friends, but, unfortunately, he was in the back of the group now.
Percy was standing in front of them, arms crossed, an eyebrow cocked. His sword was strapped to his hip, next to a long coil of golden rope. The chest plate left his arms and shoulders bare, and there was a metal circlet resting on his forehead.
Behind them, Sergeant Barnes walked into a wall.
“Wonder Woman.” Cindy got out, sounding slightly woozy. Percy blinked. “...yeah. But that’s not what I asked.”
Mr. Stark, who was watching the drool leave a track in Abe’s yellow face paint with a slightly disgusted facination, made a noise in the back of his throat. “I’m sorry, did you say demon?”
“ Cacodaemon.“ Percy corrected with gritted teeth. “It was sitting in the living room. It totally wrecked the place.”
The AcDec group collectively cringed.
Tony’s eyes widened. “Is it contained?”
Percy rubbed a hand over his face. “It’s not really something you can lock in the pantry, Tony.”
Bucky crossed his arms, tearing his eyes away from Percy. “My question is how it got there in the first place.” Slowly, he swiveled towards the assembled teenagers. “You wouldn’t happen to know anything about that, would you?”
The SWORD members exchanged looks, loosely congregating behind Tony. Percy tilted his head, expectant. Charles broke first. “We didn’t think it’d stay!” He blurted out.
Sally buried her head in her hands. Bucky took in a deep, calming breath. “You…didn’t think it’d stay?” He repeated incredulously.
“No,” Betty mumbled. “It said it would leave when it was finished.”
“The demon?” Ross asked dubiously.
Sally mumbled something into her hands. Tony’s frown deepened. “What was that?”
She let out a shaky exhale. “The WikiHow article.” She admitted. “It said that once the demon finished what we summoned it for, it’d go back home.”
Percy looked a second away from crushing the metal plating around his knuckles with his fist. “You summoned a cacodaemon from a fucking WikiHow article.”
They nodded, heads hung low. Bucky stepped up to stand next to Percy, and gently unfurled his fist, intertwining their hands. The demigod did seem to calm down slightly at that, but was nowhere near done. “I don’t know what even possessed you to do something that stupid,” He said tiredly. “But you did it, you’re fixing it.”
Abe winced. “Right. Uh, how?”
Percy fingered the hilt of his sword. “They can only be sent back to where they belong through a magical blade.” He gave them a strained smile. “Lucky you—-I’ll take care of that part. All you guys gotta do it catch it.”
Charles swallowed.
“I miss Lab Rats.” Mal muttered as she flipped on her flashlight. Beside her, Bridgette snorted. “You agreed to this.” She said.
The tower was dark when they spilled out of the elevator, the illuminated buttons providing the only light in the area. They’d floundered around the living room for an embarrassing moment before Percy had rolled his eyes and found flashlights in the nearby closet. Not enough for everyone, but one for every pair.
“Isn’t splitting up, like, the worst thing to do?” Cindy asked nervously, staring down one of the dark hallways.
“Keeping you urchins from one another is the best course of action, no matter what.” Tony said firmly. Peter was by his side, checking the batteries of their flashlight. After that, he began to nervously fiddle with his webshooters.
Abe frowned slightly, but didn’t dispute that. Instead, he gave a shaky smile and a wave as Ross clapped him on the shoulder and began to drag him down one of the hallways. Dan followed suit, Charles dragging his feet alongside the cybersecurity specialist.
The remaining teenagers gave each other wide-eyed looks before they were dragged off by their respective partners. Cindy and Mal took the elevator up to the very top with Betty and Bridgette, agreeing to split up and cover the private apartments and rooms on the 93rd floor, while Peter and Tony took Rhodey and Ned to the 92nd to scour through the labs.
After a moment of discussion, Lee and Sally went through the service doors of the lab to begin looking through the stairwells and storage closets. That left MJ and Pepper, who decided to go down to the public floors and make sure all the employees were alive and whole.
As everyone split up, Bucky turned to Percy. “Are you sure this is safe?”
Percy shrugged. “I mean, I was doing this stuff when I was twelve.” Bucky nodded acceptingly. “Alright then. Where are we going?”
“Nowhere. I’ve been chasing my father’s demonic spawn across a Mexican beach for the past hour. I’m not doing shit until they find that thing.” He said flatly, leaning back into the couch. “Also, I missed you.”
Bucky’s face turned soft. “Missed you too.” He said, joining Percy on the couch and wrapping an arm around his shoulders. His boyfriend leaned into him, cheek pressed against the chestplate of his black armor. “And I like your costume.” He said with a grin.
Percy laughed. “Reyna and her sister thought it’d be funny.”
Funny wasn’t the way Bucky would put it when he was staring at Percy’s bare thighs, but whatever.
Cindy was regretting this so, so much. She knew they shouldn’t have started using WikiHow. That never got anybody good, ever. They should have just had a deathmatch in the kitchen and settled their issues like men.
The Furby, Mal, her name was, walking in front of Cindy, pointing the flashlight around as she walked, humming a tune under her breath. Her hair was quite long, and was done in an elaborate braid that swung back and forth like a pendulum as she walked.
“So,” Mal said, casting a glance over her shoulder. “What happened to your face?”
Cindy sighed. “Abe.” Was all she said.
The woman made a vague noise and opened the door to the first empty apartment. There wasn’t much in there; just dusty furniture and drawn shades. As they stepped inside, Cindy coughed at the displaced dust from their footprints.
The tables and chairs were all covered with sheets, sucking all the saturated colors from the room. Like the rest of the tower, the lights had gone out, FRIDAY unresponsive. The flashlight illuminated a tiny circle of the walls, reflecting off the dust particles in the air. Cindy peered around, suddenly very unsettled. Mal was halted in the entryway, a slightly creeped out look on her face.
The door creaked shut behind them.
“Well then,” She muttered.
Charles looked over at Dan. “So,” He said after a second. “You play CoolMathGames?”
Dan didn’t hesitate. “I designed it.”
“Oh.”
Ned and Peter held hands the entire way to the labs. Ned was squeezing his hand like a stress ball, but Peter didn’t really mind. Ahead of them, Tony and Rhodey, a flashlight with each, scanned up and down the empty lab.
“Right,” Tony said after a long moment, breaking the silence. “I’m going to try and get Fri back online. Pete, you’re with me. Honeybear, take the cybercriminal and make sure the demon isn’t possessing the Mark L, I’m quite fond of that one.”
Rhodey snorted and gave him a mock salute before he and Ned, shooting Peter a terrified look, walked off to the other end of the lab. Peter inched closer to Tony. “Do you really think it can do that?” He whispered urgently.
Tony shrugged. “No clue.”
Peter swallowed and readjusted his web shooters.
Down in the stairwells, Sally scampered after the man in front of her. “Why are we running?” She asked desperately as they descended another flight. His legs were long enough to be taking steps four at a time, but hers were most definitely not. The man, Lee, blinked. “Efficiency.” He said blandly.
“Right.” Sally muttered as they barged into another storage closet. Lee took a quick look around before he gave the box stacks a light nudge. She opened a large plastic bin, only to find it full of various cords that looked like a nightmare to untangle.
They closed and locked the door behind them. Percy’s words still echoed through her head.
They’re not ghosts—lock doors, and it’ll keep them out. Unless, of course, someone lets them in. That last part was aimed at them, and Sally’s cheeks still burned with embarrassment. How were they supposed to know? WikiHow hadn’t really included that part.
The point was that cacodaemons weren’t actually all that supernatural. Sure, they could be summoned, bargained with, and were inherently malevolent, but they couldn’t pick locks, apparently. Abe could pick locks, for fucks sake. They couldn’t walk through solid barriers, like walls, either.
Unfortunately, Stark Tower didn’t keep all its doors locked, especially not when they were open, which was always, and especially not on the top three private floors.
She and Lee checked another closet, and locked another door. “So…” Sally ventured. “Robin?”
The man sighed. “Bridgette’s idea.” He muttered. “I wanted to be a sunchoke.” He prodded at another box.
Sally blinked. “A sunchoke?”
Lee shrugged. “It’s my favorite root vegetable.”
Abe did not like this.
Ross seemed to be enjoying himself. Abe was not.
They’d left the group first, and were now wandering through the gyms. Ross was overturning gym mats and throwing basketballs at the wall. There wasn’t really any rhyme or reason to how he went through things, but Abe stayed close anyways. They’d been through the adjourning locker rooms and had found nothing, leaving them to investigate the rest of the gym.
The man, still in his bald cap, had begun to start hitting random objects to see if it would call the cacodaemon’s attention. Abe winced with every noise that reverberated around the room.
“I’m going to try and seduce this thing.” Ross finally decided.
Abe looked at him consideringly.
Pepper leaned back at her desk. “At least nobody’s missing.” She offered.
MJ sighed, slumping across the office chair opposite from the woman. “I kind of want that thing to bite Charles.” She mumbled. “I blame him.”
Pepper gave her a consoling look. “I’m sure it’ll be fine.” She said, “We sealed off the entrances to all the upper floors, so the others will find it eventually. It won't get down here.”
That got her a shrug. “I wanted to be scaring elementary schoolers with fake guts by now,” MJ commiserated. “Not looking for a WikiHow demon.”
Pepper smiled. “A worthy goal.” She agreed. “In the meantime, would you like to help me with a proposal I was given? Some fresh eyes would be nice.”
MJ sat up ramrod straight. “I would be honored.” She said seriously. Pepper gestured for her to roll her chair over.
Betty liked Bridgette. Her hair was really pretty—not just the dye. The rich, warm red was beautiful, but she also admired the soft, shiny curls it fell down her shoulders in. It didn’t even look heat-treated. As they entered another empty apartment, Betty ran a hand through her flat blond strands.
Bridgette seemed really nice, too. Most of the SWORD people did, but especially her. Her boyfriend seemed a little scary, but given the fact he was wearing a Robin costume that clearly wasn’t his idea, Betty figured he was alright.
This was oddly boring. While Betty was glad no creature had jumped out at them to, like, eat their faces or something, she was kind of hoping something exciting would happen. It seemed like she was out of luck.
The woman in front of her looked over as she bolted the door to the empty bedroom door. “Nothing.”
Betty, who was holding the flashlight for her, tried to smile. “Better than something, I guess.”
Bridgette smiled. “I suppose so, yes.” As the two began to walk back to where they started, she looked over at Betty. “You know, your hair is the perfect type to do this really cute bun thing I saw.”
Betty glanced up, eyes wide. “Really?”
A nod. “It doesn’t really work well with my curls, but your hair is so straight, it’s not even frizzy, wow, that it’d work perfectly.” She said conversationally.
Staring at her with wonder, Betty touched the tips of her hair. “Show me?”
Bridgette’s smile crinkled her eyes.
Tony sighed, pushing himself out from under one of the holotables. “Nothing’s turning on.” He said, frustrated. “Every time I give it a jump, it just fizzles out. It’s like it just wont take a charge anymore.”
Peter frowned. “That’s…really weird. And also impossible. Why?”
Tony threw his hands up. “Beats me. I stopped asking questions when it came to Percy’s weird supernatural shit a long time ago.”
A loud crash sounded from across the labs, and a twinge went down Peter’s spine. He and Tony exchanged panicked looks before running in the direction of Rhodey and Ned. When they skidded into the room, they saw the two standing behind one of the workbenches. On the other side…Peter blinked, rubbing at his eyes. When he opened them again, he took an immediate step back.
It was on its hands and feet, all four limbs spindly and disproportionate. Its knees and elbows jutted out at odd angles, and the ridges of its spine were deformed and misshapen. It had hair, but it was in greasy clumps, bald patches spotted throughout its scalp. When it looked up, Peter could hear all four heartbeats pick up in a horrified synchronization.
It looked like it may have had a face, at one point, but flesh was pulled tautly across its skull, leaving only a vague indentation where eye sockets and a mouth may have once been. Instead of a nose, two deep gouges were centered in the middle of its face, like it had clawed them open itself.
Tony shifted, pushing Peter behind him. “This,” He hissed, “Is what you summoned?”
Peter swallowed. “It…it didn’t look like that before?” He offered faintly.
Ned made eye contact with him, breath coming in harsh pants. The cacodaemon tilted its head to the side, regarding them. Its neck twisted unnaturally as it moved back and forth between the two groups.
Another jolt went down the back of Peter’s neck. “Ned, Colonel,” He said softly. “Run.”
As soon as the word left his mouth, the cacodaemon lunged. It moved unnaturally fast, pushing off with its back legs. It launched itself over the table separating it from Rhodes and Ned. Peter started forward, letting loose two webs. The first one hit it directly in the chest, knocking it out of the air. The second stuck right on its face, muffling the blood-curdling screech that followed not a second later. It writhed and struggled against the webs, and Peter hurriedly shot two more to anchor it to the ground.
Stumbling in their haste, Ned and Rhodes following them to the exit, they piled into the elevator. Peter viciously jabbed the button to close the doors, eyes not leaving the creature as it began to tear at his webs.
The doors slid shut just as it freed one of its limbs.
Cindy’s head snapped up at the sound. It was terrible, a bone-chilling scream that sounded grotesquely close to human. It echoed through the empty apartment they were in, coming from everywhere and nowhere.
When the distant sound elevator doors dinged, Cindy jumped a foot in the air. She exchanged an uneasy look with Mal, who’s grip on the flashlight became white-knuckle tight. The agent took a deep breath before taking the plunge, stepping out of the apartment and into view of the lift.
Cindy, after a moment to steel herself, went after her.
Tony, Peter, Ned, and Rhodes spilled out of the elevator, shaky and horrified. “We need to find the others.” Tony said without preamble. “Now.” His tone left no room for argument, and Mal nodded. “Betty and Bridgette are around here somewhere. Come on.” She said quickly, not bothering to try and hide the distance she was trying to put between them and the elevator.
Every corner they turned seemed darker and darker, the shadows cast by the covered furniture and their own bodies most twisted.
The sound of two voices made Peter perk up, and Cindy watched as her friend tilted his head. She wasn’t sure if he was listening with his ears or that freaky sixth sense, but either way she was grateful of his ability to do so.
When they stepped into the apartment the sound seemed to be coming from, they were met with the sight of Betty sitting on one of the dusty couches, Bridgette behind her, bobby pins in between her lips as she tucked in strands of Betty’s hair to an elaborate bun.
“Sorry to interrupt,” Mal greeted. “But we’re getting the hell outta dodge.”
Bridgette’s brows raised, but she placed the last bobby pin and nodded. “Is it just you guys?” She asked as Betty grabbed the flashlight.
Rhodes nodded. “Everyone should be down below.” He said.
As they stepped into the elevator, the four men tensed as they passed floor 92. Peter listened carefully, but he couldn’t hear a single thing from the lab as the car went down. He wasn’t sure if that was a good or bad thing.
The common floor was empty. Mal swung the beam of her light back and forth, but the only sight that greeted them was empty couches. She took in a ragged breath before stepping out of the elevator. The second her foot touched the floor, a distant bang sounded. She flinched.
Peter suddenly looked up, a look of dawning horror taking over his features. “Go, go, go!” He screamed, pushing everyone out of the elevator. They all tumbled out, and Peter slammed the button for the 93rd floor as he stepped out. The elevator doors closed, and a high pitched screech, like nails on a chalkboard, was sealed behind them.
“Did…” Ned swallowed. “Did it get into the elevator shaft?”
Slowly, Tony’s lips parted. “One of the locks on the lab doors is broken.” He realized. Rhodey swore viciously.
“I’m sorry,” Bridgette said, strained. “It?”
Ned looked over at her. “We found the cacodaemon.” Was all he said, letting the expression on his face and the tremor in his voice explain the rest.
Bridgette turned white and nodded quickly. “So, as long as nobody calls the elevator, it should be fine. Like Jackson said, those things can’t go through locked doors unless someone opens it for them.”
Nobody mentioned the fact that elevator doors being closed might not count as locked.
“Okay,” Mal said after a second. Lee and Sally are somewhere in the stairwells. Charles, Dan, Abe, and Ross are all on this floor somewhere. Barnes and Jackson too. Ms. Potts and MJ are below, so they should be fine, since the elevator won’t go down there after they sealed it off.”
Rhodey nodded. “We go for Jackson and Barnes first.” He said finally. “Jackson’s the one that can actually get rid of the damn thing. After that, we find the others. Good?”
He got a round of agreements, though none of them seemed to like it much. Betty shone her flashlight down one of the halls. “Let's do this, I guess.” She muttered.
Not a single sound met them as they went down the corridor. Once again, Peter was unsure if that was better or not. They passed the living room, then the kitchen. It was at the gym they struck gold, almost running directly into Ross and Abe, who both seemed vaguely disgruntled.
“Demon’s playing hard to get.” Ross said. “What are you guys doing here?”
“Demon’s trying to fucking kill us, Ross.” Bridgette said testily. “I get that the slutty spirit of Mr. Worldwide is coursing through your veins, but it’s not the time. We need to find the others and send that thing back to wherever the fuck it came from.”
Mal looked taken aback at Bridgette’s language choice—she almost never swore. That seemed to get Ross on the same page, though, and he straightened up. “Right. Okay. Uh, Dan and Charles should be around here somewhere—”
It was almost like ripping tissue paper. The sound of shredding, effortless and pathetically easy, reverberated down the halls. Cindy, who was in the back of the group, turned around, the beam of light trembling in her hand.
“It’s coming from the stairwell.” Peter whispered. Bridgette and Mal’s eyes widened. “Shit,” Mal hissed. “Lee and Sally are in there.”
“Oh, Gods.” Tony whispered. A scream, this one decidedly human, erupted from the stairway. A door slammed open, so hard that it bounced off the wall. They didn’t even look at each other before breaking out into a sprint towards the stairwell entrance.
Skidding to a stop around the corner, only to see Lee and Sally pressing their bodies up against the door, struggling against something on the other side. There was a thin stripe of blood across Sally’s arm. Another death-cry sounded from the stairwell. Peter lurched into action, sending a few webs to seal the door shut.
Lee and Sally backed up from the door as it rattled from the force of the cacodaemon’s body. “Are you two okay?” Rhodey asked. Sally rubbed her arm. “If I get some weird Hell rabies from this, I’m going to be very upset.” She muttered in reply. When he looked to the other, Lee just shrugged, grip on his bo staff painfully tight. It was then that Peter noticed there was a gray sludge on it, almost like blood.
The blonde man gave Bridgette a look. “And you said that bringing an actual weapon to Halloween would be weird.”
She rubbed her temples. “In my defense, the reason you cited was a childhood staple of fending off wild animals.”
Lee just shrugged. Then, “Hey, where’s Dan?”
“With Charles.” Cindy supplied.
“Where’s Charles?”
“Oh, no idea.”
Lee groaned, then looked around. “DAN!” He bellowed.
Somewhere across the floor, a response. “WHAT?”
“COME HERE!”
“OKAY!”
Sally and Abe stared at him for a second. Lee just raised a brow. “What, you think I was gonna spend an hour looking for him? That fucker clearly knows we’re here, anyways,” He said, jabbing a thumb towards the webbed door.
Dan and Charles came into view a second later. “Hey.” Charles paused and looked around at them. “What happened to you guys?”
Cindy sighed heavily.
Meanwhile, Percy and Bucky sat at the kitchen counter, silently going through the remains of the Halloween candy in the dark. Bucky unwrapped a Kit-Kat and shoved the entire thing in his cheek. “Hey,” He said, breaking the silence. “Do they still sell Coconut Groves?”
Percy shook his head. Through a mouthful of M&M’s, he said, “Never heard of ‘em.”
“Damn,” Bucky muttered as he unwrapped a Snickers.
A loud thud, followed by a guttural roar that raised the hair on the back of their necks. Bucky blinked. “That…doesn’t sound good.” He said. Percy shook his head. “Nope.”
Another beat of silence.
“We should probably go check up on that.”
“Yep.”
They stood up, walking past the island counter that separated the kitchen from the dining room, when a stampede of footsteps grew closer and closer. Tony and Peter burst into the room first, followed by the SWORD agents and Peter’s friends. They were breathing heavily, and Percy could hear their hearts jackhammering in their chests, threatening to crack open their ribs.
They stood in the doorway, catching their breath, before Ned spoke up. “That thing,” He said after a second, “Is not capturable.”
“I almost pissed myself,” Sally said seriously. “I don’t know what kinda shit you think we’re capable of, but I’m calling my mom’s priest.”
Percy raised a brow. “It’s, like, the size of a small dog.” He said flatly.
The round of incredulous looks he got was tangible. “Do you know what a fucking dog is?” Tony burst out. “Christ, Jackson, that thing was bigger than me!”
“That’s not hard, Tony.” Bucky inputted. Tony flipped him off.
Percy frowned heavily. “Are you sure?”
“Yes,” Sally hissed. “Yes, I am sure.” She was holding the cut on her arm, and Percy took a step forward. “Is that blood?” He said, sniffing the air. Sally lifted her arm, and he ran his fingers over her skin with surprising gentleness.
“Something’s definitely wrong here.” He said after examining it. “What you guys described should have been basically harmless.”
“Didn’t you see it?” Dan asked.
Percy gave him a dry look. “No, no I didn’t. Summonings have a smell, though. I knew you guys called something, and what you guys said you did should’ve resulted in a demon that had the temperament and bite of a Yorkie.”
Bucky made a considerable noise. “Is there any chance you guys mixed up the summoning?”
Cindy opened her mouth, then closed it. “No. We got it right. The first one was messed up, but we didn’t finish it. The second one worked perfectly, though. At least, according to WikiHow.”
A beat. “The first one?” Rhodey repeated.
Percy inhaled deeply. “You did a summoning and didn’t finish it?”
“...Yes. But I’m getting the feeling the answer should be no.” Charles said.
Percy leaned his face into Bucky’s shoulder and screamed. Tony winced.
“Alright,” Percy said after letting out his internal torment, Bucky rubbing a soothing hand on his shoulder. “I’m just going to tell you guys this now so you never do it again; when you summon something, the end is the most important part. The beginning forms the connection, but the end part of it is what specifies what you want.”
Mal frowned. “What exactly does that mean?”
Percy made a frustrated noise. “The first part opens the metaphorical gate, the where you're summoning from, and the last part is what directs what gets let through, the who you're summoning. So when you guys didn’t finish, it just…left a doorway open for anything to come through. Which, apparently, it did.”
While that settled over them, Percy turned to Bucky. “Jamie, dear, how do you feel about fistfighting a demon?”
Bucky grinned widely. “Absolutely ecstatic.”
“Woah, woah.” Tony said. “We don’t know what the fuck this thing is. I don’t think bare-knuckle bloody is the way to go here.”
Percy waved him off. “Trust me, with my family, it’s always the way to go.”
“Family?” Mal repeated.
“Yeah, I’m definitely related to whatever’s trapped in that stairwell. Don’t know how, don’t really want to know how.” He turned to Bucky, holding a hand out. “Shall we?”
Bucky laughed, surprising the rest of the group. Never had they imagined seeing the former Winter Soldier laugh, and especially not one as round and full as this one. He took Percy’s hand. “We shall.”
Sally shifted slightly. “I hate to interrupt your guy’s romantic moment, but that thing is the thing of literal nightmares. Are you sure about this?”
Percy shrugged, pulling his sword out of its sheath. “Don’t worry about it.” Next to him, Bucky pulled out a long, curved blade to which Abe took a step back. “I didn’t just go as Batman to keep snacks in these pockets, you know.”
The group easily parted for the duo, who walked down the darkened hallways. The group shared a few uneasy glances before grabbing their flashlights and following. As they trailed behind in the darkness, Cindy realized that while Percy obviously had no issues getting around, Bucky probably would. She shone the beam on the two of them, revealing how Bucky had an arm looped around Percy’s, letting the Enhanced guide him down the hallways.
“Aw, that’s actually kinda cute—” An enraged roar cut her off. “Nope, nope, nope, not cute anymore.” She amended hurriedly, hiding behind the tall man with the staff—Lee? The door to the stairwell was still coated in Peter’s webs, but they were straining, some stands having fallen to the ground.
The entire wall shook with the force the creature was using against the door, trying to break it down, to get at them. It let loose another high-pitched wail, and Percy stopped, his lips parting in recognition.
“Perce?” Bucky asked softly.
“Well, I know what you guys summoned.” He said quietly. “They’re creatures of the damned. Physical manifestations of tortured souls, of violence and pain and strife. These things aren’t supposed to be here.”
“Christ,” Tony muttered.
“They’re so rare that they don’t even have names. There’s only one person who’s ever come into contact with one and survived.” He said. “And you guys trapped it in a stairwell.”
In unison, Sally and Lee shrugged unapologetically.
Percy raised his sword—it was different than the one he usually carried. This one was a soft bronze color, and it glowed in the darkness, bathing his hands and face in a golden light. “This thing needs to go back, now.”
Bucky nodded, and looked at the assembled people behind them. “It’s probably best if you guys step back.” Not having to be told twice, everyone stepped back. The SWORD members shifted in front of the AcDec kids, pushing them further towards the back wall.
Satisfied with their distance, Bucky grabbed ahold of the webs with his vibranium hand and ripped them away in one, smooth motion. The door slammed open hard enough to rattle the walls, and the creature came spilling out.
It was even worse looking, now. Its face was covered in its own imitation of blood, like it had been bashing its head against the door. Where there used to be nothing but smooth skin, thin, vertical slits ran up its maw. It swiveled around to regard them, then unhinged its jaw. As it did, the skin around it thinned out and ripped, splitting open to reveal a long row of teeth. The longer they looked, the worse it seemed to get. There were no gums or tongue, just solid, dark bone.
It took one slow step towards the clustered against the wall. It didn’t have hands or feet, its limbs instead ending in sharp points. Then, Percy was there, his sword nothing but a glowing arc of bronze as he separated the offending limb from its body.
The creature howled in agony, turning on him. The demigod grinned at it, lowering himself into a fighting stance. Behind it, Bucky flipped his knife in his hand, then ran at it, carving a long, deep line across its too-thin torso. Gray liquid rose up and spilled down, viscous and shiny.
He came to stand next to Percy, both looking incredibly at ease in their proximity. Percy, sword and shield, Bucky, metal plated knuckles and a wicked blade.
They watched in a mix of fascination and horror as they two battled the thing. The creature’s swings were wild and almost desperate, unhinged in a way that made Cindy shiver. It was strong and extraordinarily fast, with screams to raise the dead.
Every time Percy brought his sword up, the creature shied away from the glow, like it knew what the blade could do to it. The demigod didn’t let up, pushing forward and downwards, not giving it a moment to rest. Bucky was beautifully brutal, decades of precision in each hit and jab.
In a few minutes, there was nothing left but a disfigured corpse leaking gray.
Percy leaned against the wall, taking a few steadying breaths. It was almost funny; he was still in his Wonder Woman costume, but now they all noticed how finely it was made, as if it was real armor. He wrinkled his nose at the viscera on his sword.
Bucky, too, made a face at the mess. “I cannot believe you’re related to that.” He said with a frown. Percy ran a hand through his hair. “Trust me, it's really best to just not think about it.”
As the creature’s body cooled, the lights began to flicker on, illuminating the room in a way that, somehow, made the whole situation seem a little ridiculous. Abe and Betty stepped from around their human blockade to look at the body on the floor, disgusted curiosity written on their faces.
Then, Percy tilted his head. “Hey, why did you guys summon this thing in the first place?”
“Oh,” Charles said easily. “We wanted it to judge who was the best minion. Only one of us could be King Bob, you know.”
Notes:
26 fucking pages of this bullshit
happy halloween, dipshits. im so tired.
so yeah all the other acdec kids showed up in a minion costume, had a fist fight, then decided summoning a demon judge was the only logical solution.
(they did summon a cacodaemon, the little weak sauce demon. it left while they were gone cause it got bored. they also summoned the Creature, though, and that stuck around.)everyone fighting for their mf lives while percy and bucky snuggle and eat halloween candy is couples goals
lee is dressed more titans robin btw, not teen titans robin.
and percy is wonder woman. gal gadot wonder woman.
bucky is rob pattinson batman, minus the cowldeleted scene:
the acdec kids, close to tears: are you mad at us
percy:
percy, sighing: no, no im not mad.while all this is happening, pepper and mj are relaxing downstairs like the queens they are. they deserve it.
plumbing baby. goodbye.
Chapter 33: get a load of these losers
Notes:
yeah yeah i know i didn’t update this for a month, i was playing tetris ok
(See the end of the chapter for more notes.)
Chapter Text
spidey @spidey-official
life tip! If someone asks you what you’re doing, respond ‘orphan hijinks’, and they won't question you further!
You Know Who I Am @TonyStark
why are you like this
spidey @spidey-official
trauma 😜
mimi @wheresmybeans
in times like this i remember that not only do the avengers have twitter accounts, but so do i
james @jimmyjammy
mimi do not
mimi @wheresmybeans
@TonyStark do YOU have any life tips for us??
You Know Who I Am @TonyStark
don't do crack
mimi @wheresmybeans
alright then
mimi @wheresmybeans
@jbarnes tips tricks and hacks to share with the class?
scientists hate this local new yorker @jbarnes
beheading is generally frowned upon
scientists hate this local new yorker @jbarnes
also pokemon go SUCKS
meep @lowla
sergeant barnes has beef with nintendo??
You Know Who I Am @TonyStark
oh my god ignore him hes still mad
scientists hate this local new yorker @jbarnes
THE APP KEPT YELLING AT ME FOR PLAYING WHILE DRIVING
scientists hate this local new yorker @jbarnes
I WAS R U N N I N G
bearbi @bearbi3
HFHFHJDSFKJDSBFKJDBV
scientists hate this local new yorker @jbarnes
DONT LAUGH AT ME IT WAS UPSETTING
scientists hate this local new yorker @jbarnes
IT KEPT HAPPENING
You Know Who I Am @TonyStark
jfc get off twitter and go do something
scientists hate this local new yorker @jbarnes
asshole
scientists hate this local new yorker @jbarnes
fine i guess ill just go find percy ;)
You Know Who I Am @TonyStark
stop.
Ferris wheel fighter @ihatecarnivals
WHATS A PERCY
tony stark stan account @ilovehim
I HAVE NO IDEA
Bblimm @blooo
CODE RED PEOPLE CODE RED
iron man <3 @starkswife
the WINKY FACE??
bearbi @bearbi3
@spider-official please mr. man we need answers
spidey @spidey-official
percy is mr. barnes boyfriend!
iron man <3 @starkswife
WHAT
You Know Who I Am @TonyStark
I’m sorry?
spidey @spidey-official
??
You Know Who I Am @TonyStark
They're actually dating?
spidey @spidey-official
yeah??? Theyre like super gross together how did you not know
You Know Who I Am @TonyStark
oh my god
You Know Who I Am @TonyStark
i thought they were just PINING LOSERS
spidey @spidey-official
no they are
spidey @spidey-official
oop
spidey @spidey-official
[Video Attachment: The avengers common room is empty except for Bucky, who’s sitting on the couch reading a book, and Spider-Man, behind the camera.
Then, there’s a loud shriek coming from the distance. A moment later, Tony Stark enters the room, furious.
“You SEDUCED my BODYGUARD?!?!” He yells.
Bucky flips a page, looking incredibly smug.]
james @jimmyjammy
he looks so proud of himself–
spidey @spidey-official
oh he is, he never shuts up about him
bearbi @bearbi3
wait thats kinda cute though
james @jimmyjammy
could this be…couple goals?
james @jimmyjammy
whoever this boyfriend is, he's living his best wattpad life,,,bagged BUCKY MF BARNES, who's apparently whipped for him
bearbi @bearbi3
you're right and you should say it
iron man <3 @starkswife
can we also appreciate TS’s S C R E E C H
tony stark stan account @ilovehim
HE LOOKS PISSED LMAO
Trending
#BarnesBoyfriend????
#YouSEDUCEDMyBODYGUARD
#BuckyBarnes
#IronDad
#SpideyTwitter
#Avengers
Ferris wheel fighter @ihatecarnivals
Its been a couple hours
Ferris wheel fighter @ihatecarnivals
I feel like its safe
Ferris wheel fighter @ihatecarnivals
@JBarnes @TonyStark can we have some answers PLEASE
scientists hate this local new yorker @jbarnes
percy has a twitter but refuses to use it
scientists hate this local new yorker @jbarnes
but has agreed to answer a few questions on my account :)
bearbi @bearbi3
!!!!! HI MISTER MYSTERY MAN !!!! whats is like dating a super soldier??
scientists hate this local new yorker @jbarnes
“terrible, he gets zoomies at two in the morning like my dog” rude as shit and also untrue. slander at its finest.
spidey @spidey-official
so you’re denying the fact that you and lea go on random runs in the middle of the night?
scientists hate this local new yorker @jbarnes
…
spidey @spidey-official
yeah thats what i thought
Bblimm @blooo
SPIDEY TAKING NO PRISONERS
Ferris wheel fighter @ihatecarnivals
how did you guys meet?
scientists hate this local new yorker @jbarnes
“was there when he tried to murder my asshole boss”
Bblimm @blooo
And thats what did it for you?
scientists hate this local new yorker @jbarnes
“yeah”
Bucky looked up from his phone. “Wait, what?”
Percy, curled up in between his legs, head on Bucky’s chest, hummed. “The whole mess on the highway when Hydra attacked Fury? I was standing on the sidewalk when it started, taking my sister out for ice cream. Fury’s SUV came careening down the street, blew up, and I grabbed her and got the hell outta there.”
Slowly, it came to him. Bucky remembered that mission clearly; lining up the shot in time with his breathing, finger squeezing the trigger without hesitation. How he’d stalked to the car, ripped the door right off its hinges, a show of violent strength backed by a symphony of sirens and screaming.
And, now that he’d thought about it, he remembered seeing a man, wide-eyed and face red from the cold. He’d cataloged dark hair, a thick sweater and jeans, and, just for a second, he’d made contact with a pair of unforgettably green eyes. The man had stood there, shocked still for just a second, before grabbing the girl and ushering her to safety. Away from the Soldier.
As if he could hear Bucky’s train of thought, Percy lightly bumped his head against Bucky’s chest. “Not you.” He reminded.
Bucky released a breath, the tension in his shoulders leaking out alongside it. “Not me.” He repeated. The arms around his boyfriend tightened slightly, and he rested his chin atop Percy’s head. “Not me.”
annlis @anli
why do you refuse to use your twitter?
scientists hate this local new yorker @jbarnes
“too many buttons”
annlis @anli
king
piru @pirepiro
other than the zoomies, whats is like having a supersoldier bf?
scientists hate this local new yorker @jbarnes
“pretty neat. its nice dating someone who can just pick me up and take me places when i don't feel like walking.”
piru @pirepiro
🥺
annlis @anli
do you have any wisdom for the masses?
scientists hate this local new yorker @jbarnes
“sure. I'll tell you what my mom told me.”
annlis @anli
marry rich?
scientists hate this local new yorker @jbarnes
”kill people and sell their bodies.”
annlis @anli
well alright then
bingbongbeng @bennnnn23
why is barnes typing for you?
scientists hate this local new yorker @jbarnes
cause his arms are currently occupied with holding me, duh
scientists hate this local new yorker @jbarnes
“illiterate”
scientists hate this local new yorker @jbarnes
that too
spidey @spidey-official
can i get an rip for mr. stark here
annlis @anli
Rip
Avengers!!!! @superherostan
rip
piru @pirepiro
RIP
tony stark stan account @ilovehim
what happened???
spidey @spidey-official
hes still losing his shit over the fact that he didnt know they were dating
You Know Who I Am @TonyStark
You say it like it was obvious!!
spidey @spidey-official
ummm??? because it WAS???? they’re literally always with eachother, cuddle on the couches during movie nights, and bucky is literally always staring at him????
You Know Who I Am @TonyStark
and?
spidey @spidey-official
They were holding hands when they came to dinner yesterday, percy told bucky he’d die for him 100% serious, and bucky shared his drink with him???? Percy called him jamie, bucky called him darling???
You Know Who I Am @TonyStark
THEY DID ALL THIS SHIT BEFOREHAND
spidey @spidey-official
wait really
You Know Who I Am @TonyStark
YES
spidey @spidey-official
oh jesus christ
You Know Who I Am @TonyStark
THEY ARE JUST L I K E T H A T
You Know Who I Am @TonyStark
and i figured since bucky was STILL FLIRTING with percy, they hadn’t gotten together yet!
spidey @spidey-official
HUH???
scientists hate this local new yorker @jbarnes
he needs to know i like him
You Know Who I Am @TonyStark
You’re dating.
scientists hate this local new yorker @jbarnes
so?
james @jimmyjammy
thats actually really cute
You Know Who I Am @TonyStark
yeah, you’d think so until you actually hear them
james @jimmyjammy
oh????
You Know Who I Am @TonyStark
[Video Attachment: It’s security footage of the common room. Percy is cooking, his face turned away from the cameras. Bucky is sitting at one of the barstools, reading. Then, he looks up.
“Hey, do you have any Romanian in you?
Percy pauses for a second. “No.”
Bucky hums and takes a sip of his drink. “Would you like some?”
Percy walks into a counter.]
Bblimm @blooo
I-
Ferris wheel fighter @ihatecarnivals
NO CAUSE TELL ME WHY THAT WAS SMOOTH AS FUCK?????
scientists hate this local new yorker @jbarnes
im 106 not dead
scientists hate this local new yorker @jbarnes
and even hydra couldn't make me forget how to be a whore
annlis @anli
im fucking SOBBING
Notes:
steve running around dc at 6 am is super soldier zoomies and nobody can convince me otherwise. bucky uses 80 years of accumulated stealth skills to get out of bed without waking his boyfriend so he can go RUN AROUND and JUMP and CLIMB STUFF-
remember way back at the end of demigods interlude when i wrote like, two sentences about percy being there when the winter soldier attacked fury? yeah.
percy: omg this guy just tried to kill my boss
percy: the boss who didnt believe me when i said hydra infiltrated and a bunch of people died and my life got a little ruined because of it
percy:
percy: give it, like, three years, and ill kiss himqueen sally jackson's life advice >>>
if you take one thing from this chapter, its that percy and bucky are fucking losers. they're so in love with eachother its gross. people see them and go 'oh my god, these pining dweebs, someone needs to set them up', but they've been dating for months. they're just sappy and gross.
plumbing baby. goodbye.
Chapter 34: local man uses twitter for evil
Notes:
(See the end of the chapter for notes.)
Chapter Text
ethically sourced sluts
vintage bi: barnes why do i hear mitski blasting from your room
antique gay: im SAD
antique gay: percy just said that he likes it when guys roll up their sleeves so he can see their four arms
antique gay: I ONLY HAVE TWO ARMS TONY
vintage bi: uh
antique gay: NOOOO
antique gay: I HAVE O N E ARM TONY
vintage bi: what the actual fuck is wrong with you
antique gay: IM SOBBING STOP BEING MEAN TO ME
vintage bi: forearms, barnes. not four arms.
antique gay:
antique gay:
antique gay: okay that makes a lot more sense but i still feel like you are being a little harsh
vintage bi: he’s blind.
antique gay: fuck.
we had a bonding moment!!! i cradled you in my arms!!
Father of Five: for the love of the gods please go spend some time with barnes
crack dealer: ?
crack dealer: i literally just left to grab a snack
crack dealer: is everything alright?
Father of Five: how long were you gone?
crack dealer: like five minutes im on my way back now why
Father of Five: i dont hate gay people but yall are so annoying god bless
crack dealer: ?????????
percy’s bimbos
president lincoln: does anyone know where peter is?
nedleedle: yeah
nedleedle: hes on the front steps sunning himself like a lizard
mindiana jones: i was thinking cat, really
mindiana jones: but what do you need?
president lincoln: do you know if he wears his webshooters to school
nedleedle: what did you do
president lincoln: remember how cindy and i were climbing that drainage pipe and i scratched my arm and you gave me a paw patrol bandaid and told me not to pick at the scab
mindiana jones: oh my god
president lincoln: i am sitting in a pool of my own blood and the bandaid is no longer sufficient
nedleedle: and so you thought…webs?
president lincoln: yeah
president lincoln: i think i hit an artery please someone get peter
[Video: Tony, Rhodey, Bucky, Natasha, and Spider-Man sit at a long table in a room with a black backdrop. In front of each of them, there’s a container filled with slips of paper.
Spider-Man: Hi! I’m Spider-Man,
Rhodey: I’m James Rhodes, also known as War Machine,
Natasha: Black Widow. Or Natasha,
Tony: Tony Stark, Iron Man…
He trails off, and they turn to look at Bucky, who’s staring at someone behind the camera. He blinks and looks over.
Bucky: What?
Rhodey: You’re supposed to introduce yourself.
Bucky: Oh,
He turns to the camera, deadpanning.
Bucky: Hi, I’m the only surefire way to snap your hyoid bone clean in half, Bucky Barnes.
From behind the camera, someone lets out a loud bark of laughter. Bucky looks very pleased.
Rhodey shakes his head.
Rhodey: No, no, start over—
Bucky: It’s the guy who doesn't miss President Kennedy ‘cause his aim is perfect, Bucky Barnes—
Rhodey: I’m sorry?
More laughter from behind the camera.
Bucky: Hey, it’s the Big Gulp you get behind the 7/11, Bucky Barnes—
Tony: NO
This time, the person audibly chokes and starts wheezing with laughter.
Bucky, staring directly at the camera: You’re going to die in seven days. I’m Bucky.
Natasha: Alright, that one was fine.
Rhodey: No, no it was not–
Whoever is behind the camera, they snort when they laugh, and Bucky’s face takes on an incredibly fond expression.
Bucky: Named after President Buchanan because we’re both gay and unable to stop a Civil War, it’s Bucky Barnes—
Tony, baffled: Civil War?
Spider-Man: It’s what people are calling the parking lot fist fight.
Tony looks slightly constipated.
Bucky, put out: Hi. I’m Bucky.
Tony: Christ, was that so hard?
Bucky: Well, excuse me for wanting some flair.
Natasha, rolling her eyes: Right. Well, we’re the Avengers, and we’re here with Buzzfeed to read thirst tweets.
She reaches forward to her bin and pulls one out.
Natasha, reading aloud: ‘Does the Black Widow need a dog? Because I can bark.’
She looks up at the camera, face blank.
Tony, stifling a laugh: Right. My turn.
He clears his throat.
Tony: ‘I know everyone keeps calling Tony Stark a dad, but what about daddy? Open your eyes, sheeple.’
Tony stares at it for a long moment before silently folding the paper and putting it down. He shakes his head.
Tony, quietly: Why?
Rhodey grabs a paper next.
Rhodey: ‘I would put myself on a spit roast for James Rhodes, I’m tired of hiding my truth.’
Rhodey: …okay, uhm, thanks? I think. Yeah, thanks.
Spider-Man, grabbing a paper of his own: ‘I bet Spider-Man is fucking adorable under that mask. Like, absolutely babey. I’m talking overwhelmingly adorable. I picture him and see an excitable golden retriever with Sticky’
Spider-Man buries his face in his hands while Tony laughs.
Tony: He is!
Rhodey, smiling: He’s got honest to God doe eyes.
Spider-Man, muffled: I hate you people.
Bucky snorts. He unfolds a paper slip and clears his throat.
Bucky: ‘I want to suck the SOUL out of james barnes, send tweet’
Bucky breaks out into laughter.
Natasha: ‘Everyone keeps saying they have a crush on the Black Widow, but I would genuinely let her stab me. If she suffocated me I’d just be like ‘nice’ and tell her to squeeze harder’
Natasha tilts her head to the side.
Natasha: Tempting.
Natasha: ‘I would let natasha romanoff bend me over and snap my spine if it pleased her’
Natasha: I do not think it would, but I’ll keep it in mind, thank you.
Tony: ‘how do people not moan when they fight iron man? genuine question’
Tony looks utterly defeated.
Tony: I–I don't know? I’d really rather they didn’t, and I kind of hate this person for putting that image into my mind.
Tony: ‘Saw a video of Iron Man bodyslam someone. Do—’
Tony takes a moment to collect himself.
Tony: ‘Do me next daddy’
He shakes his head again and hides his face into Rhodey’s shoulder, who is fighting for his life to not laugh.
Rhodey: ‘I want james rhodes to ruin my life, deadass, if you are reading this sir, im available literally any time you want’
He looks distraught, but carries on.
Rhodey: ‘rhodes should snap me in half, light me on fire, and roast marshmallows over my burning body’
At this, he looks up at the camera.
Rhodey: Haunted, you people are haunted.
Spider-Man: ‘Spidey seems like he knows how to properly wash dishes and change a tire, I love him so much’
Though you can’t see his face, it’s clear that he’s beaming.
Spider-Man: I do know how to do both those things!
Spider-Man: ‘Idk, spidey could take me out to dinner and engage me in polite and genuine conversation, generously tip the waiter, then walk me home any day. down horrendously bad for that guy’
Tony: Twenty bucks he's blushing under that mask.
Natasha, shaking her head: No bet. He is.
Bucky reaches in and grabs more papers.
Bucky: ‘James Barnes looks like he could crush a watermelon between his thighs. If he can’t find a watermelon, my head is the same size please and thank you.’
Bucky: ‘Every day I wake up and resist the urge to lick james barnes’s biceps’
Bucky: ‘I’d climb James Barnes like a tree and never let go’
Bucky reaches into the bowl to grab more. Rhodey’s brows shoot up.
Rhodey: You have more?
Natasha looks amused.
Bucky shrugs.
Bucky: ‘James Barnes should—’
Bucky’s eyes widen. He reads the paper again, then once more.
Bucky: I’m not reading that out loud.
Natasha leans over and pulls the paper from his hand. Similarly, her eyes widened. She methodically begins to shred the tiny paper into a thousand pieces, shaking her head.
Bucky: ‘I’d let—’ Nope, no, no.
Bucky: ‘If Bucky Barnes–’ Fucking Christ.
Bucky: ‘Let it be known that—’ Dear lord.
Natasha is still taking all of these and ripping them up, muttering about innocent eyes. Then, one of the producers walks on camera with a pile of papers and hands them to Bucky. Tony leans over the table to look at him, horrified.
Tony: There are more?
Bucky quickly shuffles through them, stifling laughter every now and then, brows raised comically. He finishes and just shakes his head, stunned silent.
Producer, behind camera: Yeah, those just came in. There are dozens of them. All from the same account, too.
Bucky: Wh–
He looks back through the papers and they are, indeed, all from the same person. Then, his narrowed eyes snap to somebody behind the camera.
After a second, the camera is picked up and turned to focus on a man lounging on a chair—the one who was laughing earlier. His face is blurred out, but it’s clear that he’s on his phone. Twitter is open.
The camera turns back to Bucky, who is staring at him, still in shock.
The man laughs, sounding utterly and manically delighted.
Unknown man: Consider this payback for all the pickup lines, Jamie.
Bucky stands abruptly from the table.
Bucky: Those were shit one-liners! This—this is—I didn’t even know some of these sentences could be formed, how—
He waves the papers in frustration. The man cackles.
Unknown man: ‘He needs to know I like him’
It takes a second for Bucky to realize he’s parroting his tweet from the other day. He’s rendered speechless.
Natasha: I read one of them, and it was easily the worst sentence put together by the human mind.
Unknown man: Thank you, it’s a gift.
Bucky: You utter shit . I’m obsessed with you.
Bucky marches off camera. We don’t see what happens, but Tony’s eyes widen and he raises a hand to cover Spider-Man’s eyes.
Rhodey gives a strained smile.
Rhodey: Right. Uh, thanks for watching. We…we should probably leave them to this. Sorry to any production crew we’ve traumatized.
The camera cuts.]
Avengers updates @avengersupdates
What a way to find out Black Widow is back! Jesus Christ. I don’t even know what to say about the rest of that. At least Barnes and his boyfriend are…in love? Stay turned for more news, I guess.
Notes:
this is specifically to edene, who once told me 'idk, could be hornier' after reading one of my chapters. so, heres this, edene.
percy and bucky? so smart. honestly. but put them together and they are the dumbest mfs to ever walk the earth
bucky and/or percy as soon as one of them leaves the others presence for more than five minutes: screaming, crying, throwing up
i just know all the spidey thirst tweets are so incredibly respectful, hes just a little guy, big puppy vibes, and his 'thirst tweets' are literally just 'id buy that man flowers fr'
and yeah nats here now, i genuinely forgot to add that last chapter
poor producers, just trying to do their damn job while percy and bucky are making out on the floor. they're the real victims of this story
plumbing baby. goodbye.
Chapter 35: christmas 2: electric boogaloo - bucky gets into a knife fight with santa
Notes:
happy holidays everyone! this might just be the longest chapter i've ever written, so you better enjoy this
(See the end of the chapter for more notes.)
Chapter Text
It started out as a normal day. But then again, most of them did.
Bucky was up first, an hour and a half before the winter sunrise, carefully detangling himself from the sleeping furnace he shared a bed with. Percy’s face was mashed into a pillow, his hair sticking up every odd way, curled up on his side. Bucky gave his partner a fond look before slipping out from the covers.
The cold air hit him instantly, and he moved to get dressed as quickly as he could without waking Percy. Mrs. O’Leary was watching him from her spot on the bed as he pulled on a pair of running shoes over his thick socks, tying his hair up and grabbing Percy’s old jacket from the top of the dresser.
Soft brown leather, lined with fleece and fantastically warm. It fit Percy perfectly, like it was made for him. The strange part, though, was that even though Percy was a good half foot shorter and far narrower than Bucky, it seemed to be tailored to Bucky’s exact measurements as well. He suspected some sort of magic bullshit, which Percy had all but confirmed with how insistent he was Bucky wear it when he went out.
That, and the fact that Percy had been wearing it for years, and there was not a single imperfection in the leather.
If it was even leather, that was.
Mrs. O’Leary sprang up from bed, stretching once her paws soundlessly hit the floor, and trotted after him into the elevator. Going on morning runs had become a routine for the two—Percy was most definitely not a morning person, and Bucky was all too happy to let his boyfriend sleep in. Gods know he needed it. Besides, Bucky had been waking up at six on the dot for eighty years—it was a habit he wasn’t getting out of anytime soon.
He and Mrs. O’Leary made their way down Fifth Avenue and into Central Park, greeting the occasional other dog on the way. Though Bucky despised the cold, he couldn’t deny its beauty. The entire park was overlaid with a blanket of frost, turning the landscape grayscale, icicles hanging off tree branches glittering under the street lamps. Most of the paths were plowed and salted, but the majority of the grass was coated in a few inches of snow, which the hellhound eagerly dove in and out of, shaking off her fur and creating a tiny blizzard around her each time she returned to the path.
They stayed out for almost an hour, until snowflakes began to spill out of the clouds. They melted on impact with the ground, but Bucky knew they would eventually pile up. When they returned to the tower, Mrs. O’Leary went straight to the kitchen to get some water, while he took a quick shower. Steam fogged up the mirror, and as he wiped it off, he could hear Percy shift under the covers. It was a funny thing that Bucky had discovered—Percy typically stirred whenever there was water moving nearby. He doubted the demigod even knew he did it, but he privately thought it was rather cute.
He stepped out of the bathroom, dressed back in his pajamas and toweling off his hair. Percy was sitting up in bed, his hair even more messed than before, rubbing at his eyes.
“Morning, love.” Bucky greeted as he came to stand by the bed. Percy’s face scrunched in displeasure. “What time is it?”
Bucky glanced at the clock as he sat on the mattress next to Percy, who automatically lifted the covers to accommodate him. “Half past seven.” He reported. Percy hummed and leaned into him, lightly bumping their heads together. As he did so, Bucky felt his hair instantly dry, leaving it fluffy and hanging in his face. In return, he kissed the tip of his boyfriend’s nose.
They’d had a surprising lull in cases lately; no strange murders, no psychos with alien tech or superpowers—not even any Hydra activity, which left something satisfied in Bucky’s chest. By the time he was done with them, the entire organization would be nothing but script in a textbook.
The next hour found the couple sitting at the kitchen island, eating banana and chocolate chip pancakes—bright blue, obviously—and then washing dishes in comfortable silence. Tony, dragging his feet and clutching a coffee mug like a lifeline, emerged as they were putting the final plate back in its cabinet.
Bucky gave the engineer an amused look. “You alright?”
Tony mumbled something in response. Percy rolled his eyes, and an unspoken message passed between him and Bucky. They moved at once; Bucky swooped in and took Tony’s mug from his grasp while Percy wrapped his arms around the man’s torso and began to drag him out of the kitchen. It took a few seconds before Tony even realized what was happening, and he gave Percy a mutinous look as he was deposited on the couch. Bucky dropped a blanket on the man, and Mrs. O’Leary hopped up on the couch to lay next to him.
Even as he glared at the pair, he gave the hellhound scratches behind her ear. He was asleep in minutes.
Vision drifted by to return a book he’d borrowed to Bucky, and the two chatted about it for a few minutes while Percy called his mom like he did most mornings. Pepper and Rhodes dropped in to check on Tony, smiling fondly at his sleeping form. Peter bounded into the tower sometime around ten, shaking snow out of his hair in a way that was reminiscent of Mrs. O’Leary. Natasha came up from the gym and commandeered the television, flipping on the subtitles and muting to let Tony sleep.
All in all, a pretty calm day.
Of course, that’s when FRIDAY spoke up.
Fifteen minutes later, they were suited up and on the streets of New York, braving the torrent of snow building up beneath their feet. Vision, Rhodes, and Tony were hovering a few inches above the ground, and Peter was crouched on Vision’s shoulders to avoid the snow. It left Bucky, Percy, and Natasha on the ground, the two assassins looking far more disgruntled about it than the demigod. Before they’d left, Percy had insisted Bucky wear his jacket, zipping it up to his chin and giving him a smile.
Yep, definitely magic.
Peter, Tony, and Rhodes all had insulated suits, and Vision didn’t really get cold. Natasha had exchanged her usual suit for thermal wear with a jacket overtop, even adding a knitted hat with the red hourglass associated with her on the brim. Somehow, she made it work. Both Bucky and Natasha wore thick snow boots laced up tightly, added on after they glanced at the forecast.
Percy, on the other hand, was wearing his normal suit, everything but the tips of his fingers covered by a material Bucky knew wasn’t insulated for below freezing temperatures. But because it was Percy, he didn’t even seem to notice, and had no issue walking through the snow like the rest of them.
Locating the disturbance FRIDAY had reported was easy enough—not even five minutes later, they spotted him. There was a man standing right by Pulitzer Fountain, in a blood red cloak that seemed to float around him unnaturally. Bucky squinted at the man and the strange golden glow that seemed to be emitting from his hands.
Tony, naturally, was the first to speak up. “Man, what the hell are you doing?” He called out. “It’s freezing out, can you do this later?”
The cloaked man turned towards them at the sound of Tony’s voice. He had a neatly trimmed goatee and was graying at the temples, and appeared to be wearing blue robes. Bucky squinted and began weighing the chances that this man was a cosplayer. Please, just a cosplayer.
“It’s not quite what I’m doing,” The man replied snappishly, “But more what I’m here to stop. And I’ve got it under control. Go back to your tower.”
Tony and Rhodes exchanged looks. “Stop what, exactly?” Rhodes ventured.
The man didn’t respond, his eyes narrowed and gaze sharp. He was staring right at Percy, who was heading up the back of the group. Bucky stiffened slightly and shifted to stand in between the two.
“You,” The man said, low and dangerous, and Bucky’s hand slid to his thigh holster. “What did you do?”
Percy tilted his head to the side, and Bucky could hear the frown in his voice. “You’re gonna have to be a little more specific, man.”
The cloaked man didn’t seem to appreciate that response. He did a strange, choreographed movement with his hands, and a golden rope of light shot out from his palm, wrapping around Percy’s legs and yanking him forward. The effect was instantaneous, the assembled Avengers readying and aiming weapons while shouting warnings.
The demigod hung midair upside down, eye level with the cloaked man, who leaned forward into his face. “Don’t play dumb with me.” He snarled. Another flick of his hands, and a golden halo wrapped around Percy’s shoulders, moving down across his head and taking his helmet along with it, exposing his face to the cloaked man.
In synchronization, Natasha and Bucky flipped off their safeties. “Put him down.” Bucky ordered, voice as cold as the blizzard surrounding them, words accompanied by the whine of charging up repulsors.
Percy’s brow was knit, face scrunched, obviously confused. The cloaked man, face dark and furious, leaned in further to scrutinize Percy. None of them but the apparent wizard were surprised when Percy lunged forward from his hold and sank his teeth into the cloaked man’s nose.
The man howled and jerked back, the glowing cord around Percy’s legs flickering out and dropping him into the snow. Bucky was at his side in an instant, easily hauling him up and yanking him backwards, where Vision touched down and stood in front of the demigod. Bucky tackled the cloaked man into the snow, landing atop him and roughly jamming the barrel of his gun into the man’s temple.
The man’s eyes were calculating, and Bucky bared his teeth like an untrained dog. “You think you can move faster than I can shoot? ‘Cause I don’t.”
Webs shot forward and stuck the man’s hands to the ground, and Natasha crept forward to stand over the two, her own weapon aimed at the cloaked man. Vision still stood ready to grab Percy, just in case, and the two armored men didn’t waver in the aim of their repulsors.
“You have no idea what you’re dealing with.” The man grit out.
Bucky pressed the barrel harder against his skin. “Enlighten me, and maybe I won’t decorate the snow with the insides of your skull.”
Before the man could speak, a deep roar reverberated across the streets, loud and powerful enough to seemingly shake the ground. Peter gave a full body flinch at the loud noise and the jolt of his sixth sense that accompanied it. The cloaked man closed his eyes, letting his head thump back into the snow. “That.” He said.
“Fri—” Tony could be heard saying. The AI responded, though Bucky couldn’t make out the words from the suit’s insulation. Whatever it was, Tony made an aborted choking noise. The engineer turned to the cloaked man. “Alright, who the hell are you and what the hell is that.”
The cloaked man eyed Tony cooly. “Dr. Stephen Strange, Sorcerer Supreme. And that is the temporal anomaly I was trying to prevent.”
“And you tried to wreck my shit because…?” Percy ventured, arms crossed. Dr. Strange gave him a hard look. “Because there’s been a weird magical energy leaking all over the city since this morning, and you have the strangest aura I’ve ever encountered. I don’t know just what you are, but you sure as shit aren’t human.”
Percy made a mutinous noise in the back of his throat. “Rude.”
“I’m sorry,” Rhodes broke in. “Are you trying to tell us you’re a wizard?”
“Sorcerer.” Strange corrected.
“Jesus Christ,” Rhodes muttered. “Whatever. If you promise not to try and kidnap our friend again, we’ll let you up. Clear?”
Strange cast a look at Percy’s unmasked face once more, wary. “Fine.” He agreed tersely. Bucky pinned the man with another glare before getting off of him, flipping the safety back on and reholstering his gun. He was at Percy’s side in a second, checking the demigod over worriedly. Percy submitted to his pokes and prods, exasperated but considerate to his boyfriend’s worry.
Other than the snow in his hair, which Bucky gently brushed off, Percy looked no worse for wear than he did that morning. He still stuck close to the demigod’s side as Strange stood up, brushing himself off. He gingerly touched his nose, where bloody puncture marks had been made in the shape of Percy’s mouth.
“Do I need to get this checked?” He asked warily.
Tony clapped the man on the shoulder. “I’d double check that you're up to date on your shots.” He said cheerfully. “But that seems like a later type thing. What the hell is a temporal anomaly?”
Strange adjusted the collar of his cloak. “It means that somebody was powerful enough to open a rift through layers of reality or time and bring something here. What were you doing this morning?” He said, immediately switching his gaze back towards Percy, who rolled his eyes. “Made pancakes and talked about Dance Moms with Natasha. I didn’t do shit, man.”
Strange still seemed skeptical. “Let’s say I believe you. No missing time? You haven’t come into contact with anything odd?”
“Depends. How odd do you think Spider-Man’s skittle omelets are?”
The sorcerer looked mildly disgusted, but relented. “Even if you didn’t do this, you practically stink of magic in the way no man should. In the meantime,” He looked past the group. “I need to go take care of something.”
“It’s we now, man. You yoinked him, you forfeited your right to be left alone.” Spider-Man informed him from his spot, now on Tony’s shoulders. Strange curled his lip. “I can handle this.”
Another roar sounded, far closer than before. Strange turned his head to the side, eyes scanning the streets. The ground beneath them began to shake, a steady pounding that grew in strength as whatever had been summoned drew closer.
It rounded a corner, and Bucky’s jaw went slack. The shadow alone casted by the creature stretched all the way across the street and onto them, making the environment seem just a little bit colder. Its footsteps were heavy, its cry loud enough to make Bucky cover his ears. Looming above them, an honest-to-God T.Rex threw its head back and roared, showcasing rows of curved teeth the size of Bucky’s arm.
“You are about that?” Tony said weakly. “Because I may have a limited knowledge about dinosaurs, but I don’t think those ones are supposed to be that big.”
As the beast grew closer, it became apparent that the animal was far too large for its size. The head alone was the size of a van, its legs three times the height of the people standing across the street. It looked unbalanced as it walked, lurching to the side as if not used to the new weight.
“That,” Peter said quietly, “Is not what Jurassic Park told me those were supposed to look like.”
“There is definitely something wrong with that.” Strange confirmed, looking a bit pale. “It’s saturated in a magic I’ve never even seen before. Whatever that is, it did not come from here.”
“The dinosaur isn’t from New York?” Rhodes repeated.
Strange broke his concentration on the dinosaur to look at Rhodes. “Not from this plane.” He stressed. “I can’t even begin to imagine how to send it back.”
“Killing it, then.” Natasha affirmed. Strange cast her a look over his shoulder. “You think you can kill that?”
Natasha was one of the most skilled fighters Bucky had ever come across. She spoke countless languages, was a brilliant actor, and was an expert spy and assassin. The Black Widow was a fearsome opponent who should never be underestimated. Despite all that, she was still a human being with a gun.
Another thing that made Natasha the best of the best—she knew her limits. “No. I’m going to start evacuating the block.” She said plainly. Strange raised an eyebrow, and Natasha, along with the remaining Avengers, looked expectantly across the group towards Percy. “You up for it?”
The demigod grinned broadly, showcasing sharp canines that made Strange narrow his eyes. “I’m a little offended you even asked.”
“I can use a ritual to get a better trace on where it came from, but it won’t work once it’s dead. It’ll take five, ten minutes tops.” Strange warned. Bouncing back and forth on the balls of his feet, Percy nodded. “You guys get everyone out of the block, I’ll entertain the dinosaur, Strange can do his magic detective work.” He paused, turning to the man. “Hey, can you turn stuff into pigs?”
“What? No.” Strange replied, baffled.
Percy sighed, seemingly disappointed. “Alright. Let’s get going, then.”
Natasha jogged across the street into the first storefront while Vision flew to the opposite side of the block and began to empty people out from there. Peter, Tony, and Rhodes started somewhere in the middle, clearing out civilians from the top down. It was startlingly efficient and oddly calm despite the very visible dinosaur stomping across West 59th Street right towards them. This wasn’t much in comparison to aliens, Bucky supposed.
The supersoldier hung back for a moment, putting a light hand on Percy’s shoulder. “Are you sure about this?” He murmured to Percy. “I’m not doubting you, I just worry.”
Percy gave him a soft smile. “I know. I’ll be fine, Jamie. Don’t worry your pretty little head.” He teased. “I get to fight a dinosaur, and then you get to go inside out of the snow. Win-win.”
Bucky shook his head, an amused huff of laughter escaping him. “Right. See you in a few.”
“Wish I could see the same. Love you!” Percy chirped back as he turned to meet the dinosaur rampaging across the crosswalk. Bucky stood there a second before smacking his palm into his forehead and jogging off to join the rest of the evacuation effort. He paused as he passed Strange, any trace of the adoration in his face wiped away. The supersoldier leaned into Strange’s space, shoulder to shoulder, not quite facing him as he spoke to his ear. “I have full faith in Percy,” He said, far too calmly. “But I want you to know that I broke out of eighty years of conditioning and torture for that man, and if something happens to him, not even your magic will be able to save you from me.”
He didn’t wait for a response.
Strange shook his head as he made his way to the edge of the sidewalk, staring up at the mutated dinosaur. Now that he could get a better look at it through all the snow, he could tell it was a pale gray color, blending in quite well with the weather. There were spines along its back, short but sharp, and two-foot-long talons tipped its hands.
Their saving grace, so far, seemed to be the dinosaur’s relatively short attention span. It pursued a fleeing civilian for only a moment before getting distracted and switching its attention to another one, snapping its enormous jaws at them as they screamed. Thanks to the quick evacuation efforts, it hadn’t gotten anybody yet. Yet.
He watched as the man—Percy, the others had called him—walked right up to the creature. Strange began the spellwork, eyes flicking up to the action scene whenever he could. Runic work was always one of the hardest parts of sorcery. Everything had to be just right, from the angles of the lines to the size of the runes. He let himself sink into his work, the warm golden glow enveloping him as he constructed the ritual.
Meanwhile, Percy, after a moment of internal debate, left his sword sheathed. It would be like trying to stab this thing with a toothpick, anyways. Instead, he reached his arms out, collecting flurries of snow that melted into long ribbons of water, twisting and slithering around his arms like serpents.
All the buildings near them had been emptied out, and he could feel the mass of heartbeats moving the block over. Satisfied the area was empty, Percy moved his focus back to the dinosaur in front of him. Though the snow was falling heavier by the minute, it noticed him almost immediately. As it got closer, he noted its eyes, which were large and wide-set. Percy felt the moment it zeroed in on him, pointing to excellent depth perception. It sniffed the air, nostrils flaring. A good sense of smell then, as well.
Strange added another layer to his tracing spell, linking runes together and forming an intricate design out of the chains they made. He risked another look up as the ground shook, the dinosaur stomping its foot as it readied to charge. It lowered its head and released a booming roar, strings of spittle flying out of its mouth and hitting the ground.
Percy did not seem cowed in the slightest. Strange watched in a sort of sick fascination as the inhuman tossed his head back and released a guttural roar of his own, utterly animalistic in nature and deafening compared to that of the creature he faced. Instead of waiting for the dinosaur to charge, Percy ran at it in a full sprint. It met him halfway in the middle of the street.
It happened alarmingly fast—the inhuman leapt upwards, far higher than the capabilities of any man, and grabbed a hold of the first curved spike that rested on the crest of the creature’s head. He hauled himself up, swinging his legs over it until he was sitting on the dinosaur’s ginormous head. Strange choked slightly, almost losing focus on his spellwork. The man let out a whooping laugh from atop the beast’s head, holding on by sheer thigh strength and nothing else. The dinosaur let out an enraged cry, furiously shaking its head from side to side to throw the inhuman off.
He added another layer, twisting the golden threads into neat knots as he went. The next time he glanced upwards, there was a thick cable tied around the beast’s snout, holding its mouth shut, keeping it from snapping at evacuating civilians. When Strange squinted, it almost seemed to move, ebbing and flowing like water.
He tied off the last layer, now standing inside a masterpiece of spellwork. It pulsed like a steady heartbeat, almost alive as it began the trace. Strange moved all his focus into keeping everything in place as it worked, holding it all together.
Strange felt it in his core when the spell finished, the runes and cords losing their sheen as they died off. He then looked back up at the spectacle taking place in the street, trying to decide how to get the inhuman’s attention to tell him the spell had finished. Oddly enough, though, the man just seemed to know. With an unearthly grace, he swung off the dinosaur’s head and landed into the snow on his feet, completely unbothered by the significant fall he just took.
The beast’s entire body shook, as if to make sure he was truly off its back before making another charge attempt. Like before, it lowered its head and fixed its eyes on Percy, but this time, the man stayed just where he was.
It barreled down onto him, footsteps like thunder. Strange’s breath caught in his throat as it grew closer and closer, heart leaping. The inhuman’s grin was sharp, something wild contained in it. At the very last moment, he dropped down under the snapping jaw, barely missing the bite that instead turned the concrete of the Pulitzer Fountain to dust.
The inhuman dashed forward under the dazed beast, wrapping his arms around its tree-trunk-thick legs. He pivoted on his heel, and to Strange’s horror, the beast was completely lifted off the ground, spun and then tossed into the air.
It slammed into the snow-covered asphalt with an ear splitting crash, letting out an agonized cry as it lay there. The inhuman stuck out a hand and the snow it was laying on began to pick up, moving and swirling in mesmerizing patterns. It was hard to notice at first, how the individual flakes began to land on the beast’s belly, forming lines upon lines across the scales. The lines turned to thick stripes, coagulated and thickening until the powdery snow turned into shining ice, immobilizing the dinosaur further and anchoring it to the ground.
Curiously, he did not turn completely to face Strange when he spoke, rather a bit to his left. “Do I have to kill it?” He asked hesitantly. “It’s…well, it’s kinda cool.”
Strange floated forward, his cloak billowing around him as he surveyed the damage. “It tried to eat you.” He deadpanned.
“If I held grudges against everyone who tried that, I wouldn’t have many friends.”
Looking at the possibly demented man, Strange shook his head. He wasn’t quite sure what realm this inhuman was from, but Strange most definitely did not want to pay a visit.
“I’m unable to send it back.” Strange said forcefully. “And either way, it’s been tainted by dark magic. That kind of thing takes its toll—it will decay over time, slowly and agonizingly. Putting it down now is for the best.”
Percy looked surprisingly upset by that, but nodded. The inhuman didn’t even have to move to make the snow around them solidify into another shape—a long, inch-thick rectangle of glimmering ice, slanted at the bottom edge and wicked sharp. It was easily fifteen feet wide, made of perfect angles and straight edges. Percy sighed, and the guillotine blade came down and severed the beast’s head from its neck in one clean cut. As soon as it touched the ground, the blade dissolved back into snow.
Blood spilled out in a tidal wave, staining the brilliant snow scarlet. The inhuman tilted his head to the side, crouching down and leaning close to the red slush, a confused-looking frown on his face. Strange edged around the massive corpse, larger than a double-decker bus, to get a look at whatever had caught the inhuman’s attention. But before he could get close, it began to dissolve, turning into a fine, dark powder and lifting up into the wind. The entire body was gone in seconds.
Strange stared after it as it evaporated, a deep crease in his forehead. The inhuman, on the other hand, did not look the least bit concerned, as if massive beasts turning into dust was a normal occurrence for him.
The other Avengers caught up to them in the next few minutes. Stark and Spider-Man touched down together, followed by Colonel Rhodes. Romanoff jogged up the next minute, and the Vision a second later. Barnes came last, going straight to the inhuman, clearly checking him over for any injury.
As the group formed, Strange only got one snippet of the conversation between the two. “—they’ve never bled before, Jamie.” The inhuman was saying in a hushed voice. They were pulled apart by Stark’s metallic voice. “How was it?”
Percy smiled broadly. “Fantastic, thank you for asking.” The engineer nodded before turning to Strange. “So,” Stark said, faceplate retracting. “Any leads on what the fuck that was?”
“I’ve never seen anything like it.” Strange said truthfully. “The fact that the body disappeared is…concerning.”
“Disappeared?” Romanoff echoed skeptically.
Strange gestured to the large depression in the snow where it used to be. “It dissolved into a black powder-like substance. Not a physical trace left of it.”
“Black powder?” The inhuman interrupted, looking slightly troubled.
“Black.” Strange repeated, exasperated. “However, the trace spell did work, and I should be able to track down the origin relatively soon.”
“How, exactly?” Stark asked.
About to give a rundown of basic magical principles, Strange opened his mouth, but was cut off once more. “Nothing that has to be explained out here, I’m sure.” The inhuman said flatly. Oddly enough, all the others seemed to accept it easily, beginning to head towards the tower. Stark send Strange a grin before beckoning him to follow, his faceplate flipping back down as he turned away.
Strange sighed and began to trudge after them.
To the Avengers’ credit, their common room was quite tasteful. The decorating was mild and inoffensive, a pleasant color scheme with a cozy, homey look to it. Most of the personality came from the personal effects strewn about the area, from the jumpers hanging over the backs of chairs to the textbooks scattered across the kitchen island. Christmas decorations were also up—a tree, decorated in an eclectic collection of ornaments, including a cheesy Iron Man one Strange doubted the man himself bought. Lights were strewn up around the room, and stockings hung from the fireplace.
A large black Mastiff—perhaps a St. Bernard—was waiting at the elevator entrance, massive tail wagging as it caught sight of them. As they passed, each of the Avengers leaned down to give the dog a quick pat, and once the procession had all stepped over the threshold, it trotted after them.
Stark’s suit practically melted off of him, folding inwards and curling off of his body like it was a second skin, seamless and fluid. Strange couldn’t help but stare at the marvel of engineering, and Stark caught his eye. The man gave him his signature grin, upturned and challenging. Everyone else went their different ways, Romanoff shaking snow out of her hair and muttering about finding fuzzy socks, Spider-Man off on a quest to grab a snack, Vision phasing straight through a wall, and Rhodes to call a contact to speak of the attack.
The inhuman gently brushed a hand through Barnes’s hair, all of the accumulated snow miraculously falling out with his fingertips. The supersoldier regarded him with such fondness Strange was unaware his cold face was capable of. Before the two turned down the hall to go change, Barnes looked over his shoulder and pinned Strange with a vicious glare.
Witnessing the interaction, Stark snorted. “Good luck with that one.”
“What do you mean?”
The engineer cocked a brow. “Yeah, that’s the ex-Winter Soldier, and you just attacked his boyfriend. Again, I wish you the best with that.” Said Stark. “But, seriously, pull some shit like that again and I’ll melt your skin off your bones.” He added on lightly.
“...Duly noted.”
When they all reconvened, everyone was dressed down. Even Spider-Man had changed into pajamas and had just pulled his mask back on. Romanoff was sporting yoga pants and a sweatshirt, Barnes cargo pants and a sweater, the inhuman in sweats and a faded tee.
They all looked remarkably comfortable, taking seats on the various couches and armchairs. Barnes and the inhuman were curled up together on the loveseat—Strange couldn’t help but notice the discarded wrist braces on the coffee table. Barnes was holding the inhuman’s hands in his own, thumbs rubbing his wrists soothingly. Interesting. So maybe the inhuman wasn’t as invulnerable as Strange had previously assumed.
“The trace spell.” Stark prompted.
“Assuming I’m right, which I typically am, whatever magic that was came from a different realm. Even my spells cannot be exactly precise from this far away. It will give me an approximate location that I can summon a portal to. From there, it will act as a compass to point us in the right direction. We’ll have to go on foot for a bit to get there.” He warned.
He can’t help but glance back to the inhuman. His legs are curled up to his chest, and his head is leaning on Barnes’s shoulder. If Strange hadn’t been so closely attuned to the mystical arts, he would’ve said they looked normal, if not incredibly sappy. Barnes catches his gaze immediately and glowers at him. “Does the name Dormammu mean anything to you?” Strange asks, watching closely for any sign of familiarity.
None come. “No…” The inhuman says slowly. “Why? Who’s that?”
“An interdimensional entity who rules over the Dark Dimension. Known as the Cosmic Conqueror, the Destroyer of Worlds. A few years ago, a sect of sorcerers devoted themselves to him in return for a fraction of his power. Bloodthirsty zealots who didn’t care in the slightest whom they killed.” Power hums beneath Strange’s skin as he scrutinizes the inhuman. “His magical signature is unlike any I’ve ever seen before. Except for yours.”
The inhuman blinks. “I’m…I’m sorry about that. But I have no idea who this Domumu guy is.”
“Dormammu, babe.” Barnes corrects. The inhuman just shrugs.
“All of his disciples had a rune carved into their foreheads. If what you say is true, then you won’t mind if I do a quick spell to burn away any illusions you may carry?” He tests warily.
He receives a shrug. “Go nuts, man.” Barnes elbows his partner. “Percy!”
“What? I don’t have a weird-ass face tattoo. I don’t mind if it makes this dude stop staring at me like he wants me under a microscope.” He defended.
Rather than get within striking range of the inhuman’s untamed street dog of a partner, Strange gestured for the man to stand. “Right here, please.” He requested. To Strange’s slight annoyance, he stopped about a foot to the right of where Strange requested, but it was of no major inconvenience.
The unveiling spell was one of the first ones Strange had learned after driving Dormammu away from Earth. He would never forget the entity’s face, its eyes that seemed to bore straight into his soul. Merely standing in front of Dormammu had made every hair on Strange’s body stand up, had quickened his pulse and made his throat dry. Master of the mystic arts or not, he was still just a man. And he’d known instinctively that this entity in front of him was far, far beyond him. Dormammu’s true power was beyond any human comprehension and imagination—the mere concept of attempting to him was impossible. Using the Eye of Agamotto to trap the entity was the only viable way out.
Their only saving grace were the Sanctums. If Dormammu had no human emissaries to act through, he could not break through Earth’s defenses. And so Strange learned every spell he could to rip away one’s illusions to hide Dormammu’s mark so he could weed them out, had combined and overlapped them in the dangerous experiment of creating his own spell. The end result, through much trial and tribulation, was a revealing rune that would savagely shred any illusions, no matter the caster.
Strange casted it with a smooth motion and a calculative stare as it formed. A simple flick of his wrist and the glowing symbol shot towards the inhuman like a bullet, slamming into his chest and knocking the air out of him. Time around them turned sluggish, thick and heavy.
It began to peel off the man like a second skin, shedding and falling to his feet. Strange did not feel victorious at the thought of being right—the only thing confirmation gave him was ice cold dread. Layers and layers of concealment magic like he’d never before seen were torn up, revealing what lay beneath.
To Strange’s astonishment, it was not Dormammu’s sigil that was hidden. In fact, there was no mark at all carved into the inhuman’s forehead. The rest of his skin, on the other hand, was a completely different story.
Brutal lines carved into his flesh now turned golden, microscopic particles of golden dust swirling beneath his skin. In all shapes and sizes, they stretched across him, peeking out from his sleeves and glowing from underneath his clothes. Scars, Strange realized, his trained eyes picking out each and every one. Not all of them had reacted oddly—some were just plain old scar tissue, like the one clearly from a bullet on his bicep. The illuminated ones, on the other hand, appeared to be from much stranger things. Claws, teeth, and strange, jagged weapons. Shining through the inhuman’s shirt, almost blinding, was a large knot of scar tissue. To be that old and still that size, he must’ve been impaled by something the size of a telephone pole.
The dichotomy between the mundane marks and the golden ones was extraordinarily odd, and Strange’s curiosity only grew. Jagged lines, thin in some places and gaping in others, also wrapped around his skin. Particularly around his ribs, though a few on his left leg and right wrist. Strange had been a world-renowned surgeon—he knew what a compound fracture looked like, and these lines looked exactly like where the skin would be broken. His eyes flicked back to the inhuman’s ribs, and he almost gagged. If his theory was correct, at some point in time, his ribs would have been broken badly enough to have almost each and every one sticking out of his body, like something had picked him up like a ragdoll and squeezed. Strange shivered.
However bad he thought the body was, though, the face was far worse. Black hair had been endlessly deepened, seemingly sucking the light out of the room, inky as the depths of the ocean. A sole gray streak up front, pale and lifeless in comparison. Strands stuck up on end and floated as if he was underwater, unnaturally framing his face. The scars around his eyes that Strange had barely even noticed earlier were bloody and raw, as if someone had taken a blade to the inhuman’s face and carved out the skin, revealing bloody tissues beneath. Slightly sharpened teeth had been replaced with massive fangs, curved and serrated, dozens of them in razor-sharp rows. And his eyes.
His eyes.
Any traces of sclera and pupil were gone. Taken over by swirling blues and greens, thousands of oceans churning in between lash lines. Waves crested with brilliant shocks of white, rain pounded noisily onto the surface, lightning striking against the water. Rivulets of entire seas ran down his face, catching in the seams of his lips and dripping down his chin. It was bright enough to blind a man, dark enough to turn him insane.
This inhuman, this being, was no zealot of Dormammu’s. No, Strange likened him more to the Destroyer of Worlds himself. But unlike the ruler of the Dark Dimension, when Strange looked at him, he did not feel any semblance of the terror Dormammu gave him. No unfamiliarity, nothing unrecognizable. Nothing strange or foreign, nothing unknown.
When Strange looked into this being’s eyes, he instinctively knew that this was familiar—deeply, undeniably so. He stared into his face and the primal sources of the Earth stared back, the very fabric of this dimension reflected in his infinite eyes. Despite never even hearing of a creature such as this, Strange knew that whatever stood in front of him, it belonged here, far more than the rest of them ever would.
The ancient arcane arts were lost to time, nothing but a whisper in the wind, but Strange had no doubt he was staring at them right now. He understood in a way he never had. He heard the arcane in the rolling thunder and snapping lightning, saw it in every tide and quake that shook the ocean floor, smelled it in sea salt.
Time snapped back like an elastic, and all of that was gone. Like it had been wiped away, the layers of illusionary magic crawled back up the inhuman and rested comfortably on his scarred and weathered skin. Strange felt like the breath had been stolen from his lungs as he continued to stare, transfixed at the being in front of him. The inhuman was rubbing his chest where the rune had hit, looking a little confused but no worse for wear.
For the rest of the group, it had barely been a blink of an eye, but it had felt like an eternity of Strange. From the couch, Barnes was glaring at him even as he held an arm out for the inhuman to sit under, pressing back up to his side. “Satisfied?” Barnes snapped.
Strange nodded, still shellshocked. “Yes.” Is all he offered. He turned back to Stark, who was looking at him like he knew something. Far too smart for his own good, that man was.
“When do we leave?” Romanoff asked, leaning forward. “As soon as you get dressed. I can’t get an exact reading, but I’m able to get a vague impression of where the portal will lead us before I open it. And wherever that is, it’s quite cold.” Strange answered easily. He had countless wards at his disposal to keep himself warm, which he could extend to the others in case of emergency, but he’d rather save up his energy for whatever they found and keep that as a last resort.
Barnes groaned aloud and buried his face in his partner’s shoulder. The being, Percy, he called himself, ran a soothing hand through the supersoldier’s hair. “Sorry, Jamie. We can stay home, if you want.” He offered.
From what Strange had heard, the man had been cryogenically frozen on and off for over eighty years—if that didn’t cause an aversion to the cold, he had no idea what would. Perhaps he could cast a warming spell specifically over Barnes. He doubted he’d let him, though.
“It’s fine,” Barnes muttered. “I’m stealing your fuzzy socks, though.” Percy kissed the crown of his head. “Whatever you want.” He sounded like he truly meant it, too.
Sickeningly sweet...and strangely human.
Once more, Strange and Stark were left alone as everyone wandered off to hunt down even heavier winter gear. “Not wearing a coat over the suit?” Strange asked wryly.
Stark’s smile crinkled the corner of his eyes. “Don’t need to.” He said simply. “I’ll be fine in there.”
“With a power source like that, I don’t doubt it.” It was the raw truth—Strange had never been a huge follower of the tech industry, but even he couldn’t continue looking in other directions when Tony Stark returned after three months of abduction, shut down his company’s most profitable venture, and started churning out clean energy sources decades ahead of anybody else.
He’d met Stark once before, many years before the world had even heard of Iron Man. What Stark had been doing at a neurosurgery conference, he’d had no idea, but hadn’t really paid much thought in favor of preparing for his speech. At the very end, Stark had raised his hand and asked a single question. Strange didn’t exactly recall what it was, but he remembered being surprised at how well thought out it had been. After that, the man had nodded and leaned back into his chair, letting the other attendees ask their own questions.
It had been quite different from what was said about Stark—there was no arrogance there, no carelessness nor selfishness. Confidence, sure, but the easy, earned kind. Strange hadn’t thought about it a moment longer, and now he kind of wished he had.
That got him another smile, Stark’s hand unconsciously coming up and rubbing at the blue circle of light shining faintly through his thick sweater. Then, that same hand extended. “Nice to officially meet you, Strange.” He said. “You aren’t bad when you’re not doing a claw machine impression with my friend.”
Strange smiled. “I apologized,” He said, shaking his hand firmly.
“Did you?”
“I’m taking them on a field trip, am I not, Stark?”
Stark laughed. It was a pleasant noise, Strange found. “I suppose so. And it’s Tony.”
“Stephen, then.” He insisted in return.
Percy was a little bit stressed, alright? He knew James didn’t do well in the cold, plus Peter had a few thermoregulation issues, and wherever they were going was apparently cold enough to warrant multiple layers and boots with ice cleats on them. It wasn’t the actual journey he was worried about—Gods know he’s been on far worse quests to mysterious locations. But he could hear Tony about to have a conniption about shoving Peter into a parka, and James, no matter how much he loved him, was a stubborn asshole sometimes.
“You really don’t need to do that.” The man himself commented as he tied his boots. Percy tossed a glare in his vague direction as he shoved another scarf into his bag. “Shut up.”
Bucky sighed dramatically and leaned back on their bed. “You’re doing something nice but you’re so mean about it, it’s honestly astonishing.”
Percy throws a balled up sweater at his head. The supersoldier laughs, and it lightens something in Percy’s chest.
Bucky watches as he packs his backpack, quickly and efficiently. The bottom layer is a spare sweater, hat, gloves, along with a scarf. Then medical supplies, followed by bottles of water, packets of carrot sticks, apple slices, and granola bars on top. The next pocket over has a few emergency supplies; stuff to start a fire, multi-tools, flares, what may or may not be a grenade of some sort, and rope. Percy shoves a few spare blades and extra ammo for Bucky in, then some treats for Mrs. O’Leary. A flashlight, duct tape, and a tupperware filled with smooth white orbs the size of apples.
“What’s that?” He asks, leaning forward to get a better look.
“Pig balls.” Percy says simply. “Lou Ellen made me some.”
“Pig balls?” Bucky repeats incredulously, grinning.
“Explodes and turns people to pigs.”
“...Is that why you asked Strange if he could do that?”
A smile creeps up on his face. “Maybe. I mean, he calls himself the Sorcerer Supreme, but he can’t turn people into pigs? My cousin can do that, and she doesn’t even have a fancy cloak.”
“Gods, I adore you.” Bucky blurts out. Percy perks up and leans over to peck him on the lips. “The feeling is mutual. Pass me the pack of tissues over there?”
He does as requested, and Percy shoves them into his bag. “You must do this a lot, huh?” Bucky notes. “Packing for a quest, or whatever.”
Percy nods as he zips it up. “I guess. You just get into the habit of making sure you have everything, cause if something can go wrong, it probably will.”
“That’s a terrible motto.”
“It’s true,” Percy corrects. Bucky shakes his head and pushes off the bed to stand. Percy slings his backpack over his shoulder and stops in front of Bucky. Like he had earlier, he catches the bottom of his jacket and zips it right up to Bucky’s chin, fingers spaying across his collar. Bucky can’t help but smile and leans forward to press his forehead against Percy’s. “Are you ever going to tell me what it is about this jacket?”
Percy hums. “How nicely are you gonna ask?”
Bucky leans forward and kisses him soundly, free hand coming up to thread through his hair. “Really nicely.” He can feel the curve of Percy’s smile against his lips, the mock exasperated sigh he exhales. “Well, as long as it’s really nicely,” He drawls out. “Nemean Lion skin.”
Then, he steps back, adjusts his backpack straps, and walks out of the room to go grab his boots, leaving Bucky rooted to the spot. “Nemean Lion?” He echoes, dumbfounded. “Like the one Hercules wore? Percy? Am I wearing what fucking Hercules wore? Percy!”
Bucky kept shooting Percy skeptical looks out of the corner of his eye, Peter couldn’t help but notice. The demigod looked slightly smug, the corner of his mouth twitching upwards every time Bucky squinted down at the jacket he was wearing. It was Percy’s, the one he’d lent Peter a couple times. Underneath, Bucky wore a long sleeved shirt and lined gloves, along with a pair of thick pants and snow pants overtop those. Percy had even forced the man into a scarf and hat, and there were goggles around his neck.
Peter, on the other hand, was dressed rather oddly. He was in his suit, sans mask, which did have a heater on its own, but Mr. Stark had harassed him into wearing snow pants, a parka, and boots overtop. “I made that suit for cold New York nights, not subzero bullshit.” The man had muttered, which was followed by, “I have a heart condition, Pete, put the damn boots on.” When he’d first emerged, Strange had done a double take at seeing his face. Peter knew Mr. Stark had thoroughly threatened the man to not tell anyone, so Peter wasn’t really concerned.
The Iron Man suit was much thicker, and especially with the nanotech Mr. Stark had been working on, Peter knew the man would be fine. He was wearing clothes suited for the weather underneath, anyways. A sweater in his signature red, thick pants, and boots.
Natasha had done her hair in a long braid, pulled a hat on, and had a parka with a red hourglass embroidered on the bicep, which was very cool. Her gloves were nicely made, and her boots perfectly tied. She, like Bucky, had a pair of goggles hanging around her neck.
Percy stuck out like a sore thumb. He was in cargo pants which tucked into his boots, a sweater and unzipped jacket, his wrist braces, and a hat Peter knew his mom had made him. No gloves, no scarf, no coat. The only thing appropriate for the weather he had on was the ice cleats on his boots, but Peter genuinely believed that was just because he wanted to kick someone while wearing them. Even Mrs. O’Leary, standing next to him, was wearing a XXL Christmas sweater and boots.
Strange gave the man a considerate look, but ultimately shrugged it off. Peter wasn’t quite sure what had passed between the two when Strange cast his revealing-thingy, but there was no doubt in Peter’s mind something had.
The wizard dude had, apparently, opened a portal back to his own home to change, and had abandoned his wizard outfit for cold weather gear of his own. The brilliant red cloak, though, still sat on his shoulders, now just overtop his jacket. He looked strangely normal like that, and Peter couldn’t help but stare.
Ultimately, Vision and Rhodes had decided to stay home—Vision to fight another dinosaur if one showed up, just in case, and Rhodes to deal with the mountain load of paperwork that was apparently generated by the appearance and subsequent takedown of a dinosaur.
Mr. Stark looked everyone over, a slightly pained look on his face when he saw Percy’s lack of heavy duty clothes. “Everyone ready?” He checked, looking at Bucky the longest. “You better have a lotta layers, Barnes, because if you even shiver, I’m pretty sure that one is setting the nearest thing on fire.” He said, jabbing a thumb in Percy’s direction.
Natasha snorted. “You got gasoline in that bag of yours, Jackson?”
The demigod snorted derisively. “Only amateurs need accelerant.”
Everyone looked a little wary at that, and everyone but Bucky inched away from the man. Peter really needed to get Ned on trying to unearth Percy’s criminal record.
Strange eventually cleared his throat, and Peter watched, mesmerized, as the man moved his wrist in a circular motion. Orange-gold sparks appeared in the air, swirling and spitting, widening up with each rotation. The cold air blasted them the second the portal was wide enough for it to slip through, icy and stinging. It lowered the temperature of the entire common room in just a few seconds, and Peter huddled closer to Mr. Stark.
With a dramatic swish of his cloak, Strange stepped aside and gestured to the portal. “After you,”
Mr. Stark gave a mock bow. “Why thank you.” He stepped through it, immediately beginning to look around the area. One by one, they all filed after him, carefully stepping in and making the transition from hardwood to snow-covered ground.
As soon as he touched the snow, Peter shivered. It wasn’t the cold—everything just felt…off. And not in a bad way, per se, but somehow, he just knew that wherever they were, it was different. Mr. Stark gave him a concerned look, but Peter flashed him a thumbs up and continued looking around.
They were surrounded by sky-stretching evergreens, trunks wider than an SUV, tall enough to brush the clouds. The scent wasn’t overwhelming like he expected; it was actually rather pleasant. For one of the first times in his life, when Peter inhaled deeply, the stink of city smog didn’t coat his nostrils.
Snow fell undisturbed around them for as far as the eye could see, a white blanket over the forest. Most of the animals were taking shelter in their dens, hiding away from the weather. Everyone, even Nat, was craning their necks up at the massive trees, lips parted in awe and visible breaths puffing out of their lips. Percy’s eyes were closed, snow landing on his lashes. Peter wondered what this was like for him—if water was a large part of how he saw the world, was the snow making everything better? Peter hoped so.
Strange broke the reverie they’d fallen into. He waved his hand, and the portal behind them collapsed in on itself, solidifying into a sole line of light with an arrow at one end. It spun in place as it oriented itself, before snapping to attention and pointing to their left.
“It might be best if you all grab a partner, just in case. Visibility may get worse.” Strange warned them as he looked around. From the back of the group, Percy grumbled. “Oh no, my visibility.” Bucky smacked him on the arm, but then grabbed his hand. He figured Mr. Stark would want to be partners with Strange—they seemed to get along fairly well, so Peter turned his head to look for Mrs. O’Leary, but instead found Natasha. She was grinning at him, her brilliantly red hair a pop of color on the white and green landscape. “Team arachnid?” She offered, holding out a fist. Peter beamed and knocked their knuckles together. “Team arachnid!” He agreed enthusiastically.
Mrs. O’Leary was an independent woman and he would only slow her down, anyways, Peter thought as he watched the hellhound begin to scale one of the massive trees.
Strange and Mr. Stark headed up the front of the group, Peter and Natasha in the middle, and Bucky and Percy in the back. He could catch Mr. Stark and Strange talking as they went through the snow, though he couldn’t catch exactly what about without purposefully eavesdropping. Natasha asked him about his patrols after a few minutes of silence, and he ended up recounting all the nice people and cute animals he’d met over the years. Percy and Bucky seemed content to walk in relative silence, but they never let go of each other's hands. It was so cute it was kinda gross.
They followed Strange’s spell for almost half an hour before Percy spoke up. “There’s stuff up here.” He announced, head tilted. “Like…a town, maybe? Buildings. People, definitely.”
Strange gave him an interested look. “How did you do that?” Any hostility between the two seemed to have vanished, leaving only Strange’s curiosity.
Percy just shrugged. “I just can.” Strange, to his credit, left it alone after that. And, sure enough, about ten minutes later, Peter was able to smell the smoke of wood fire and hear the distant chattering of voices.
The village itself was nestled in a large clearing, mostly hidden by a thick curtain of pine needles and thick trunks. Peter counted about two dozen buildings at first glance, arranged in a two-layered circle. At the center, a massive hearth sat, stocked with logs thicker than Peter, crackling and spreading warmth throughout the entire clearing.
As they got closer, his breath caught in his throat. Each house was built out of expertly cut logs, icicles hanging off the roof. Designs on the roofs and outer walls were done in white, giving each building the appearance of a gingerbread house. People milled about, dressed in shades of red and green, cable-knit sweaters and thick, bundled up scarves. A reindeer was hooked up to a wagon full of firewood, and a group of small children huddled around it, feeding it carrots.
“Hello!” A jovial voice called out. The source, a tall, older woman in a cherry-colored sweater waved at them. As she approached, Peter couldn’t help but notice her hair, from the twin plaits tied off with bows to her eyelashes and brows, were the same color as the snow. It was striking, and strangely beautiful. “What brings you to this neck of the woods?” She asked as she got within normal hearing range.
Bucky, ever polite, smiled back at her from the back of the group. “We were looking around, ma’am, and stumbled across this place. Awfully pretty.” He complimented. The woman cooed at him. “Aren’t you nice? Well, you’re all welcome here. Truth be told, it’s been a while since we’ve had any visitors in our neck of the woods.”
Peter grinned. “Thank you, miss.” She waved him off. “It’s no problem, sweetie. Here, I’ll show you around.” She offered.
“We don’t want to be any imposition.” Bucky protested. Once again, the woman dismissed it. “No such thing. Come, come, my wife just made an excellent batch of hot cocoa, and we’d be delighted to share.”
After a shared glace, they followed her into the village. It was even more picturesque up close—twinkling fairy lights lined windows and doorways, ornaments hung from the smaller trees dotting the pathways, and every single mailbox was painted with candy cane stripes. The group got led to the village center, to the bonfire, where a woman was stirring a large pot with a ladle.
Around them, the other townspeople stood in small groups, all sipping from steamy cups. Noses and ears were red, but their smiles were blinding. Kids ran around, seemingly playing tag, weaving in and out of the adults’ legs. All of them had snow-white hair, lashes and brows too, blending into the landscape.
“Cynthia, dear! We have visitors!” The woman who greeted them called as they approached. Cynthia looked up, her face brightening at the sight of her wife. “Wonderful! Grab them some cups, would you, Ella?”
The woman who greeted them—Ella, apparently—stopped by a table set up in the frozen grass and grabbed six cups from the stack. Her wife filled each one and handed them back, looking up at the group.
His spidey-sense was extraordinarily quiet, so Peter took a sip. It was, like Ella had said, fantastic. Cinnamon-y and rich, but not too sweet. “Thank you,” He chirped. The two women smiled at him. “Glad you like it.” Cynthia said. “Now, I believe introductions are in order. You already met Ella, and I’m Cynthia. It’s a pleasure to have you.”
Peter grinned back. “Thanks for having us. I’m Peter! This is Percy, Bucky, Natasha, Mr. Stark, and Dr. Strange.”
Mr. Stark rolled his eyes fondly. “You can call me Tony, please.”
“And Stephen is fine.” Strange input.
It was then that one of the kids, engrossed in an intense game of tag, tripped and barreled right into Percy. He must not have been expecting it, because he lurched to the side, the steaming hot cocoa in his cup spilling over the side, threatening to upturn all over the kid’s head. It happened so fast that even Peter barely caught it—both Percy and Bucky’s hands shot out. Bucky’s caught hold of Percy’s jacket, keeping him from stumbling, and with Percy’s outstretched fingertips, the cocoa stayed suspended in the air, like it had been flash frozen.
In the blink of an eye, the cocoa returned to Percy’s cup, and he bent down to check on the kid. Not fast enough to escape Ella and Cynthia’s notice, who were now staring at him with wide eyes.
“You alright?” Percy asked gently.
The girl who’d bumped into him sniffed. “‘M okay. I didn’t mean to make you fall. I’m sorry,” Her voice was wobbly, like she was going to cry.
Percy’s face softened further. “Hey, hey, it’s okay. Don’t worry about it. No harm done, see?” He said, gesturing to himself. The girl sniffed louder, looking unconvinced. Percy leaned in, dropping his voice to a whisper. “In fact...you wanna know a secret?”
She looked up at him and nodded, eyes wide. Percy smiled. “I fight monsters for a living. And while you’re pretty strong, you’re no monster. I like to think I’m quite tough, so, really, don’t worry about it, alright?”
This time, the girl smiled. “Really? Monsters?” She asked excitedly, all traces of tears vanished. Percy nodded solemnly. “Monsters.” He agreed. “But that’s our secret, right?”
“Right.” She said instantly. Then, she squinted at him, standing on her tiptoes to get a better look at his face. “You have hair like me!” She chirped excitedly, turning to face Cynthia and Ella. “Look! Look, he has hair like us!”
Ella crouched down to get on the girl’s level, looking at Percy, the pale streak in his hair being ruffled by the wind. “Indeed he does!” Ella overdramatized. “And it looks quite fetching, does it not?”
“Very pretty!” The girl agreed. Percy turned scarlet, and Bucky snickered. “Sorry again, mister.” She said before running off. Bucky hauled his stunned boyfriend to his feet before lightly tugging on the pale streak in his hair. “Very pretty.” He echoed. Peter didn’t think it was possible, but Percy flushed further.
Cynthia snorted, covering her mouth with her hand. “You all are an interesting bunch, aren’t you?”
Bucky shrugged. “We try.”
“So, what really brings you here? You…obviously aren’t from around.” Ella asked, no doubt having seen Bucky’s metal hand when he helped Percy up, plus the whole hot cocoa incident. There was no malice nor skepticism in her voice, just curiosity.
“Well,” Nat said, digging for her phone. “We’re looking for something. Have you seen any creatures like this around?” She held it up, a photo of the T. Rex that had attacked New York displayed on the screen. Ella took a moment to look at it before nodding. “Oh, those? They live out in the woods. Bit cold for them to be out—they retreated to their dens months ago.” She squinted at the screen. “And that one looks awful big. Sick, too.”
“Sick?” Strange repeated.
“Yeah, I’ve only seen ones that color when they were dying. Nasty stuff, poor thing.” Commented Cynthia.
“Are they…aggressive?” Mr. Stark ventured.
“Oh, heavens no. Friendliest things—we take the kids to ride their backs during the summer.”
Percy looked distinctly excited by that. Before he could speak, Nat continued. “That’s really helpful, thank you. One more question, if you don’t mind—do you know of any magic users around here?”
“Magic?” Ella repeated. “Oh, nobody here has a talent for that sort of thing, I’m afraid. Why, the only magic we’ve seen in decades was what your friend just did. Very nice, by the way.” She complimented.
Percy ducked his head. “Thanks.”
Cynthia snapped her fingers. “Oh! Well, there was this one fellow…I’m not sure if he lives in the area anymore, though. We’re the only settlement for miles, so his people used to swing by to run a couple errands. I heard from one of them that their boss was quite adept at magic.”
Natasha nodded slowly. “But nobody has come in a while?”
“Almost a year, I’d say. He lives a bit north of here, but we’ve been quite busy preparing for the cold season, so we haven’t gone up to check on him, unfortunately.”
“And what do you mean by ‘his people’?”
“Oh, they all worked for him. Nice people, really. Seemed to like him, too. Oh, I forgot his name…” She trailed off with a frown. “It started with a N, I believe.”
Bucky, adjusting his scarf, tilted his head to the side. “What sort of errands did they run?”
“Supplies, mostly. Bought a lot of the produce we grow here. Ah, they stopped by the tailors one time. I ended up almost taking the coat they'd brought in home by accident, it was the exact color of the sweater I’d dropped off!” Ella said with a laugh, Cynthia looking at her fondly.
“Red?” Peter asked after a second.
“Quite a lovely red, too.” Ella confirmed. Mr. Stark gave Peter a questioning look, but the vigilante kept going, bouncing on the balls of his feet. “You said his name started with a N. Did it happen to be Nick?”
Cynthia pointed at him. “Nick!” She exclaimed. “Of course! Yes, that’s it! How did you know?”
“Just a hunch,” Peter said, practically vibrating out of his skin. “Thank you so much for your help. And the cocoa. It was really nice meeting you two.”
“You too, Peter.” Ella said warmly. “If any of you find yourselves in the area again, feel free to stop by.”
“Sure thing.” Peter promised.
As they walked away, Mr. Stark turned to Peter. “...Nick?”
“We’re in a literal winter wonderland, there's a magic man who wears red, and has a bunch of people working for him. Why wasn’t Nick your first guess?” Peter huffed.
It took a second, but Mr. Stark got it. “As in…Saint Nick?”
“Well, I was right, wasn’t I?”
“I’m sorry, you think Santa sent a dinosaur to New York?” Strange checked.
Peter crossed his arms. “I’m saying there’s a Nick who wears a lot of red and knows magic. And he might know about the dinosaur.”
Strange stared at him for a long moment before shrugging. “You know what? That’s not completely out of the realm of possibilities. They said he lives up north, and, wouldn’t you know,” Strange flicked his hand, and the glowing compass materialized once more. “Pointing north.”
“Alright,” Natasha said. “Let’s go do a welfare check on Santa.”
Percy was actually having a pretty fun time. The village was nice, the hot cocoa good. He was enjoying the snow, too. It made everything a lot clearer for him to map out, almost as good as being underwater. He linked his hand with James’s as they began to trek north, following Strange’s lead. James had informed him that a glowing arrow was leading them, but Percy, unfortunately, couldn’t make heads or tails of it. Apparently, magic didn’t have a high water count, oddly enough.
James was guiding him along as they walked, occasionally tugging his hand lightly when they adjusted directions. It was effortless and absentminded on his part, but it made Percy smile. As they walked, he couldn’t help but wonder about the dinosaur. If what Ella and Cynthia said was true, which, according to their heart rates, it was, the one he’d killed was acting extraordinary odd. Not only was it way bigger than it should have been, it was uncharacteristically aggressive. Not to mention the dark magic coating it like a second skin.
The whole thing was weird. But then again, they were currently on a quest to find Santa. So, whatever.
As it happened often, Percy felt it before any of them saw it. A massive structure, not of wood or brick but stone. It sat at the foot of a great mountain, carved into the cliff face, wrapping around the base of the mountain and stretching upwards. There were towers, multiple levels, and what even felt like a basement level.
The moment all the others saw it, Percy felt their breaths catch in their throats. James’s hand tightened slightly on his, and Percy squeezed back. “Pretty?”
“Very.” James breathed out. “It’s covered in snow, and the icicles are catching the light just right, it practically glows. It’s amazing.”
They wander right up to the front doors, which stretch dozens of meters high above their heads. Natasha presses her palm against the thick stone consideringly. “Are we sure we should just waltz in here?”
“Knock?” Peter offers.
She gives him a dry look, and he grins at her. Strange looks at his arrow, which is stubbornly pointing inside. “We could always try another entrance, just in case.” He suggests.
“Are there any others?” Tony asks with a frown.
Peter shrugged. “I mean, we can at least look—”
“Hey, guys?” Percy says suddenly. Everyone looks over at him. “There’s blood in the snow over there.” He flicks his pointer finger and, about a dozen feet away, a large chunk of scarlet snow lifts up for them to see.
“Shit,” Tony says. “Is it human?”
“Definitely.”
James’s face tightens. “Looking around, it is.” He says resolutely. “Can you find any other entrances?”
Percy tilts his head to the side, searching for gaps where the snow has flitted in. “Window, low enough for us to climb into.” He reports. Strange nods. “Lead the way.”
They circle around the stone behemoth, keeping a careful distance away from the building proper, just in case. It’s so large that it takes almost five minutes for them to reach the gap Percy had found. None of them hear anybody nearby, so, one by one, they swing a leg over the sill and climb inside. Despite the uncovered window, it’s perfectly warm inside, and Percy gets the familiar feeling of magic creeping down his spine. The others must feel it too, because they, sans Strange, all tense up at the new sensation. The carpet underneath their feet is plush, and a fire crackles in a hearth a few meters to their right. The hallway is long, deserted, and carries echoes with relish.
“Left or right?” Percy whispers.
Strange looks both directions. “Arrow says left.” Is all he offers.
“But we have no idea what we’re dealing with. I say we poke around a little more. Right.” Natasha proposes. When nobody objects, she turns in that direction and soundlessly pads across the carpet.
Every hallway they pass through is entirely deserted. By the ten minute mark, it begins to put everyone on edge. They still check every corner, move as silent as possible, but encounter not a single living soul.
Eventually, they locate a staircase and descend into the basement level Percy had felt earlier. A wave of heat hits them as they go down, the air turning from relatively warm to comfortably toasty. Both James and Peter let out soft, content sighs as they drew nearer.
Almost at the same time, Strange and Percy stopped. “There’s something here.” The sorcerer says. “Heartbeats.” Percy finishes. “Dozens.”
Natasha draws a blade, and James’s hand rests on his holster. Percy inches closer to the landing, straining his ears. The heartbeats sound…small, almost like those of children. Something was wrong here. Very, very wrong.
He opens his mouth to speak, but before he can, Natasha shoves her shoulder into the door and it bursts open.
It’s a kitchen, with low ceilings and wall-to-wall shelving. A crackling fireplace is laid with messy brick, a group of people are huddled around it, shoulder-to-shoulder and curled in on themselves. They were dead silent beforehand, but as soon as they catch sight of Bucky and the people around him, they shriek and flinch back, frantically scrambling back against the far wall.
Their screams are high-pitched and squeaky, and very, very small.
All of them are tiny. Round, soot-smudged faces stare back at him, eyes wide and shining. Immediately, Bucky drops to his knees. “Hey, hey,” He says softly. “It’s alright. We’re not here to hurt you.” He reassures them.
Tony’s helmet retracts, revealing his face, and Strange’s glowing shields dissolve. Percy, hand on Bucky’s shoulder, crouches down next to him. The kids look at the two of them, hearts quick and fluttery.
“We…we’re working, we swear.” One girl blurts out. “Please don’t tell Mister. Klaus we’re all down here.” She begs.
Bucky blinks. “Klaus?”
“...Our boss?” A boy says.
“Okay, wait, why are you all down here?” Natasha interjects.
That gets her a round of guilty shuffles. “Mister Klaus is…strict.” Someone says. “Usually our parents are around to make sure he doesn’t see us, but they’ve been working a lot recently.”
“Strict?” Percy asks, forcing lightness into his tone. “Does he yell a lot?”
The children nod. “He…he hit Nellie yesterday.” Another girl says quietly, as if she’s afraid to speak aloud. “We’ve been hiding down here ever since.” Percy’s fists tighten, and Bucky bites down on the inside of his cheek.
“Who are your parents?” Strange leans in.
“They make stuff for him,” The first boy explained. “They’re always busier around the year end, but never like this. They’ve been stuck in the factory all week.”
“They haven’t come home? Not even late at night?”
“No,” He says pitifully.
Bucky, recalling the conversation they had with Ella and Cynthia, speaks up. “Do you know anybody named Nick?”
At that, they all perk up. “Mister Nick was super nice.” A girl informs them. “He always gave us candy and let us play with the reindeer.”
“Where is he now?” Bucky inquires carefully.
“We…don’t know. Mister Klaus wouldn’t tell us. He just said that he was our new boss. We work down in the kitchens until we’re old enough to move to the factory.” She says.
“And the reindeer?” Peter inputs.
“They’re stuck in the stables. Mister Klaus doesn’t let them out to play like Mister Nick did.”
The assembled heroes begin to exchange looks, uneasy. “Do you guys have any idea where Nick could be?”
At that, silence reigns. Then, from the back, one boy stands. He’s clearly much older than the others, on the cusp of adulthood. “The west tower.” He says. “I…I’d snuck out of our rooms last week to get an extra blanket. I heard him talking to one of the older elves, one of the ones who runs the factory now. He’s up there, but I have no idea how to get in.”
Bucky works his jaw. “If we wanted to bring Nick back,” He says suddenly, “What would he have to do?”
The older boy blinks in surprise. “You’d do that?”
He shrugs. “This Klaus guy sounds like a real piece of work.” Is all he offers.
The boy looks wary, but eventually replies. “I don’t know. Besides freeing Mister Nick…” He shrugs helplessly.
Sharing another look with the rest of the group, Bucky stands. “We'll figure something out.” He promises.
“About Mister Nick?” The girl in the front whispers.
Tony gives her a comforting smile. “We’ll do our best.” He promises.
They file back out of the kitchen, dead silent until the kitchen door is firmly shut. “This is fucked up.” Natasha says firmly.
“Oh, for sure. But, if I’m getting this right…a rival, evil Santa, usurped jolly-good Santa?” Tony says slowly.
“And evil Santa is mean to animals and children.” Percy says, eyes dark.
“Capitalist scum working his elves to the bone.” Bucky adds.
Then, in unison, “Let’s kill him.”
Strange choked. “What?”
Bucky crosses his arms. “We’re deposing him to bring Nick back. I’ve deposed a lot of world leaders in my time, Strange, and the only way to really get them out of the way is to kill them. If we don’t, he’ll probably just come back.”
“Klaus made a mistake when he didn’t kill Nick. We don’t make the same one.” Percy concluded.
Strange looked slightly unnerved, but Tony and Natasha were nodding along. “Kill evil Santa.” They agreed.
“We also need to free the reindeer and check out the factory.” Strange reminded them. “And I still think we should stay in pairs, just in case.”
“But if we do, and Klaus gets word of what’s happening, he might escape before we can get to him.” Peter commented.
Percy tapped his chin. “Two to Nick, two to the reindeer, two to Klaus. We need extra manpower.” Then, a slow, slow smile came across his face. “I have an idea.”
The portal opens up to what looks like a relatively normal living room. A gray couch with a crocheted afghan tossed over the arm, a mug sitting on a coaster on the coffee table next to a book with a pen acting as a bookmark in it.
Distant rustling, a soft clang, and then footsteps. Cautiously, someone walks into the living room, then approaches the portal to see Percy.
Bridgette Lehey looks at him, then turns her head to the side. “Lee!”
A moment later, Lee Van Keppel’s face appears, inquisitively looking between Bridgette and the portal. The two of them are wearing matching plaid pajama pants, but white Bridgette is in a tank top and cardigan, Lee is wearing a thick sweatshirt with a cactus on it.
“Sorry to bother,” Percy says. “But can you call the others? It’s a bit important.”
Bridgette groans, dropping her face in her hands. Lee, on the other hand, looks fascinated with the portal and doesn’t stop poking the sparking edges of it, and though they can’t see it, Strange’s eye twitches with every prod.
Fifteen minutes later, a sleepy-eyed Ross, Mal, and Dan fill the apartment, all in their pajamas. Percy doesn’t beat around the bush. “How do you feel about revolutions?”
They perk up in unison.
It’s a tangle of zipping up coats and lacing boots, pairing gloves and tying scarves, but eventually they get all of the members through the portal. First Mal, then Ross and Dan, and lastly Lee and Bridgette. Strange closes the portal behind them, and the SWORD members take a good minute to look around, eyes wide as they take it all in. Strange clears his throat, pulling their attention away from the snow-coated landscape. As soon as they turn, Lee and Bridgette make noises in the backs of their throats.
“Stephen?” The two exclaim loudly.
Strange’s eyes widen. “You two!”
Bucky frowns. “You guys know each other?”
“He’s our neighbor!” Bridgette yelps. “What—how did—”
Lee looks Strange over, the flowing cloak and glowing symbols around his wrists. He turns to Bridgette. “I told you he was a wizard!” Lee says triumphantly. Bridgette sputters, and Strange goes white as a sheet. “You knew?”
“Of course I did! Wong got drunk and turned one of my spiders blue!”
“You know Wong?” Strange says shrilly.
“And when was this? You told me Nellie’s species just does that sometimes!” Bridgette crossed her arms.
“Wong comes over every time you go to your book club! We watch Riverdale, and why the fuck would a spider randomly turn baby blue?”
“I don’t know, do I look like someone who knows stuff about spiders?”
“You certainly look like someone who can Google stuff!” Lee refutes.
Tony cautiously steps forward and puts a hand on Strange’s shoulder. “Let’s…all calm down.”
“We’re all very calm!” Bridgette snaps. Tony puts his free hand up placatingly.
In the back, Ross raises a hand. “Uh, I was told there would be a revolution?”
Strange buries his face in his hands and screams.
They divided up their missions into teams.
The SWORD members, eyes shining, demand to go to the factory and instigate. They decide to sneak across the sublevel to the other side of the fortress, to the workshop. Tony and Strange volunteer to go outside to the stables and free the reindeer, and Natasha and Peter decide they’re in the mood for a jailbreak, so the newly dubbed ‘spider squad’ elect to find the prison Nick is being kept in.
“You guys good with Klaus?” Tony checks.
Percy, eyes gleaming, nods. “I want his hat.” He whispers. Stephen shivers. Bucky, on the other hand, pulls the demigod close and pressed a kiss to his temple. “I’ll get you his hat, baby.” He promises.
The SWORD members head off first, one of the elves showing them a hidden passageway they can use to get all the way to the main hall. From there, they elect to take a roundabout route, and head outside to skirt around the elves’s dorm wing. They circle around the factory, eying the tall smokestacks sticking out. They find a few doors from the outside, but all of them don’t budge, locked with no apparent lock.
They end up locating a large snowbank, and Lee, as the tallest of them, climbs atop it and presses his face to the glass, breath fogging against it. He watches for a moment, then appears to shrug and slams his elbow through the windowpane, shattering it. Lee gives Mal and boost and she hauls herself through it, landing quietly on the concrete floor on the other side.
The team waits a long few minutes before they hear the soft creaking of door hinges. Mal's head sticks out from a side door, grinning. “Come on,” She whispers.
Inside, it’s…well, it’s rather dreary. They’re off in a corner, hidden behind a large stack of crates the size of small cars. Bridgette gets a glance at an open one and sees it filled to the brim with brightly wrapped presents, and covers her mouth to suppress a gasp. She peeks out from behind one of the crates, is met with the sight of rows upon rows of worktables, hundreds of elves hunched over them as they work. The clang of hammers and the buzz of electric saws is constant and overwhelming, but it had covered their rather messy entrance, so she couldn’t complain too much.
Nobody is speaking, oppressive silence reigning over the cavernous factory. Bridgette’s first thought after hearing ‘elves’ was tiny people with big eyes, pointed ears and striped socks. Instead, all the elves look rather…normal. Their ears are pointed, sure, and they look a little short from where she’s sitting, but other than that, nothing about them makes her look twice. They’re all wearing gloves, hair tied back under hair nets as they work. She looks around, and the only thing that meets her eyes is droopy shoulders and lowered heads. At the end of every couple rows, a tall, cushy chair is set up, an elf in each one. Some are watching the workers with craned necks and curled lips, and others are slumped backwards, snoring. How they can sleep through the constant noise, Bridgette has no idea.
The entire place is freezing, as well. The SWORD members are all in coats and boots, but the working elves certainly aren’t—they’re in plain gray coveralls. The ones up in the chairs seem to be quite comfortable, she notes with disdain. All the ones she can see are drinking hot cocoa and have blankets over their laps.
It's incredibly bleak and honestly quite depressing. Ross’s voice is quiet. “Is anyone getting sweatshop vibes from this, or is it just me?”
Dan is frowning deeply. “No, no, not just you. This is…” He trails off, shaking his head.
“Wrong.” Mal finishes softly.
Bridgette’s lips are pursed. “Alright, so what are we gonna do about it?”
Lee and Dan share a conspirative look. “I…think I have an idea.” Dan says. “We’re going to need some duct tape, though.”
Ross immediately holds out a roll. When Mal raises an eyebrow at him, he just shrugs. “Jackson had some in his bag. He also had snacks.” He informs them through a mouthful of granola. Mal sighs.
Out on the factory floor, an angry yell echoes back to them. “You already used up all your breaks!” One of the elves in the elevated chairs thunders. “Please, sir,” The worker elf says quietly. “I-I’ll be quick.”
“You better. Sneak off, and I’ll have your head. In fact,” He snaps, “You, with the bow, go with him. Any funny business, and you’re both going to get it.”
The elf, tying a neat bow around a wrapped box, nods fearfully and stands, scampering after the first elf. Mal and Dan exchange looks, then soundlessly peel off from the group to go after them. Less than five minutes later, two coverall-wearing elves come back and quietly take their place, heads down.
Far away, by the stables, Tony frowned. “I don’t think melting it is the way to go.” He finally said. Stephen frowned at the charred, but undamaged, walls. “Maybe.”
Slowly, Stephen lifted his hands. “Magic fire?”
Tony looked at him, eyes wide and nodding. “Magic fire.”
Lee, Ross, and Bridgette wait a couple minutes before moving. Bridgette sneaks around to the main door that connects to the rest of the fortress. It’s a bit smaller than the average door on Earth, and after checking the floor for scuff marks, she determines that it opens inwards. Protected by the barrier of white noise, she carefully begins to move the boxes scattered around to barricade it. As soon as she’s finished, the crouches down behind one, hidden.
Lee and Ross, still behind the massive stack of crates, exchange looks. “I’ll stay and watch this one. All the others are still locked?” Ross checks, looking back at the door they came through. Lee nods in affirmative, and takes a deep breath before stepping out from his hiding place. His stride is long and his chin held high as he walks right up to one of the overseeing elves, namely the one who had yelled at the two workers earlier. Lee climbs up on the raised platform the chair is on before roughly grabbing the elf by the collar and tossing him onto the floor like a sack of potatoes. Lee kicks over the chair, and the clatter it makes as it falls seems deafening.
Everyone stops. Power tools turn off, hammers are lowered, and wrapping paper cuts are paused. Lee clears his throat. “This is bullshit!” He screams out to start. From all the way across the factory, Ross and Bridgette make eye contact and immediately look away to keep their laughter at bay.
“I mean, look at this place! Hundreds of you, hunched over at your tables, day in and day out! You sit here, and you freeze, and you starve! And what do they do? They watch!” Lee roared. “Look at this, look at this man!” He pointed to the elf he’d thrown to the floor. “While you toil, waste away in your labor, this man sits and watches, under his warm blanket and coat. No more! I implore you, my fellow laborers, throw your tools aside! Reject the box this man is so desperately trying to put you in!”
One of the other overseeing elves stands up from his seat. “Sit down!” The man orders angrily. Lee casts him a hateful look and continues. “Aren’t you tired of it? They own your tools and your uniforms and so they own your jobs, and with that power they own you! Will you let these men be the masters of your fate, or will you consciously cast them aside! Freedom will not be handed out with your visors and your bootlaces—it is up to you, the individual, to stand up and seize it for yourself! They will own you until you have the courage and the mind to decide otherwise!”
The elves below are murmuring to one another, casting looks at the other overseeing elves in their chairs. Then, Dan, wearing stolen gray coveralls, screams out, “Why do they get to sit up there and not us? What makes them more worthy?”
Coming from their own ranks, the working elves began to speak amongst themselves louder. The nearest overseeing elf trips in his haste to get out of his chair and make his way to Lee, who’s still going. “The oppressor cannot be put in such a position without your consent. Every day you come to work, you put on your uniform to become one with the masses, you sit and you say nothing, you are tending not to yourself, but to him!”
“Get down from there!” The overseeing one yells, marching up to Lee’s platform. The pathologist doesn’t stop speaking, even as he climbs the back of the chair to put distance between him and the elf. “They are nothing without us! They can own the building, the tools, the uniforms and the very tables you sit at, but not the people!”
“You know what, I’m done with this bullshit!” Mal, also wearing a stolen uniform, screams in frustration. Then, to everyone’s astonishment, she picks up the nearest item, a long, thin screwdriver, and smashes it against the corner of the table until it bends.
“But, our jobs—” One working elf nervously starts.
“What are you so scared of? They cannot fire every single one of us, my friend! Then who would do the work? Certainly not them!” He proclaimed as the overseer elf began to attempt to drag him off the platform. “Our strength lies in our numbers, in our resolve! Rise up, grow a backbone! Do not lay at the feet of the ruling class, polishing their boots in hopes that it will get you somewhere in the world! Fight back! Change comes with you! A new tomorrow that starts today!” Lee screams as another overseeing elf joined the first to drag him away.
Dan looked around at the stunned silent factory workers. Then, he took a readying breath, and flipped the table in front of him. “We have nothing to lose but our chains!” Dan roared, and chaos ensued.
Ross tossed Mal the duct tape, and she ran at the nearest overseeing elf she found and, with the quickly forming mob, duct taped him to his elevated seat. “Your throne will become your prison!” One elf screamed.
At one point, Lee broke free from the elves holding him down, and climbed atop one of the few unflipped tables, cackling as he watched the elves revolt. Bridgette soon appeared by his side, and he smiled at her.
She got on her tiptoes to press a kiss to his jaw. “You needed that, didn’t you?”
He sighed contentedly as he watched a group of elves burn the cushy chairs. “I did.”
Outside, halfway across the grounds, Stephen and Tony eyed the stables. It was a relatively small building, low ceilings and no windows. There was a single door, but when either of them tried to push it open, it didn’t even budge.
“I don’t even think there’s a lock to cut through,” Tony said, inspecting the doorframe.
“There’s a magical signature coming from the entire place. I thought it might be the reindeer themselves, but I think the building itself might have some spellwork imbued into it as well.” Stephen observed.
“Can you try your portal thing?” Tony asked, glancing back at the sorcerer.
Stephen raised his hand, going through the familiar circular motions. Golden light sparked midair, and his face screwed up in concentration. The circle sluggishly began to expand, awkward and forced in comparison to the gracefulness Tony had seen earlier. Then, Stephen gasped raggedly and the portal collapsed. The sorcerer bent over, drawing in rushed lungfuls of air. Tony darted over to him, putting a hand on his shoulder. “Are you alright? What the hell just happened?”
The sorcerer’s breaths were heavy. “I—I don’t know. I could only hold it for a second, it was like it was draining my energy. Nothing like that’s ever happened before.”
Tony’s eyes were wide in his worry, his grip on Stephen’s shoulder tightening slightly. “Are you going to be alright?”
Stephen nodded, the color already returning to his face. “Yeah, just…give me a second. Whatever wards they have up, they're insane. I don’t think magic is going to be our way in."
Eyes sharp, Tony looked back to the stables. At the moment, he couldn’t help but wish Percy was here. He doubted Percy’s abilities really counted as magic, so the dude could probably just level the building if it came to that. Or, hell, maybe reindeer were close enough to horses that he could just convince them to come out on their own.
Just like that, inspiration struck.
“Or…maybe it is.” He suddenly said. “Now, I don’t know shit about magic, so correct me if I’m wrong, but spells are usually made for one specific thing, right?”
“There’s not a lot of multipurpose spells, yes. The stronger the magic, the more specific it must be.” Stephen confirmed.
Around him, the suit began to disassemble, folding and condensing down until it was the size of a small briefcase, which Tony deposited in the snow. Stephen was watching, fascinated, and warm pride burst in his chest. It was always nice to have his genius appreciated, after all.
Then, he frowned. “Aren’t you freezing?”
Tony shrugged it off. “It’ll only be for a moment.” He dismissed.
Stephen, instead of nodding and moving on, drew another one of his fancy symbols in the air. It floated over to Tony, landing on his sternum, right over the arc reactor. It sank into his skin, and immediately, warmth spread outwards from the impact site, down to the tips of his fingers and toes. It was surprisingly pleasant, chasing away any whisper of chill. “Warming rune,”
Tony blinked, then smiled back. “Thanks.”
“Don’t mention it,” Stephen muttered.
Tony rubbed the palms of his newly warmed hands together, a wicked grin creeping up on his face. “Alright, I originally grabbed these for Spidey, but,” Tony reached in his coat pocket, and pulled out a small bag of carrot sticks and apple slices. “I doubt Klaus gives these guys a lot of treats.”
Strange was looking at him curiously. “Probably not.” He agreed.
Then, Tony reached down and tapped the side of his briefcase. One of the corners unfolded, forming into a red and gold gauntlet. Tony held it up, messing with something on the back of the hand. “And if this magic is as strong as I’m assuming, it’s gotta be pretty damn specific. Based on stopping people from getting in, not breaking out.”
It took a second, but realization dawned. “You want to lure them out.”
“Give the man a prize!” Tony exclaims. “I’m thinking you shove another portal open, and I can send the gauntlet through with the bag, and it’ll lead them out.”
“I’m not sure I can hold it that long,” Stephen said with a slight frown. Tony clapped him on the shoulder. “Have some faith in yourself, Stephen. You got this.”
The sorcerer looked a little doubtful, but nodded and lifted his hands. Once more, golden sparks lit up the white landscape, slowly beginning to swirl. The strain on Stephen’s face was visible as he widened it, and the gauntlet lifted itself into the air, clutching the bag of snacks between two fingers.
“That’s a little creepy,” Stephen gasped out as he continued to force it open.
As soon as it was wide enough, the gauntlet darted forward. “Yes!” Tony cheered. But then, a loud scream sounded from across the grounds, a hundred tiny voices forming into one. “Union!”
The unexpected cry startled both men, and Strange flinched, losing concentration just as the gauntlet moved to enter. It collapsed in on itself, leaving a gauntlet clutching a severed bag of snacks in the snow. “What the hell was that?” Stephen exclaimed, looking around for the source of the noise.
“I have no idea,” Tony whispered. Cautiously, he stepped forward to pick up his fallen gauntlet. He inspected the bag, and sighed. “It cut some of it off.” He said, holding up the bag, neatly cut down the middle.
Then, a loud thud.
Another.
Then another.
The two shared wide-eyed looks. The force shook the side of the stables, getting louder and louder each time. It was nearly deafening as it picked up in speed and aggression. Tony reached for his briefcase, and the suit began to reform around him, the gauntlet in his hand seamlessly reconnecting to the rest of the suit.
In front of them, the wall caves in with a mighty bang, sending up flurries of snow and dust. A single hoof sticks out, pawing at the snow. It retreats back inside, and is replaced by a massive head, with a glowing, red nose.
Meanwhile, across the grounds, Natasha and Peter stood at the foot of a turret, staring upwards. “This is…pretty tall.” Peter finally said. They’d wandered around inside, trying in vain to find a door that wasn’t magically sealed, and had ended up outside. Peter squinted upwards. “There’s a window with bars on it near the top.”
Natasha looked over at him, calculative. “Hey, how strong would you say you are?”
“Last I checked I can lift about…200 tons, I think?”
A smile slowly crept over Natasha’s face. “I have a fantastic idea.” From her jacket, she took out a long coil of rope, and started making knots. “Come here.”
Peter shrugged and moved to stand in front of her.
Tony grabs onto Stephen’s arm. “Oh, my Gods.” He whispers.
Stephen can’t even bring himself to be curious at the use of the plural, too transfixed on the sight in front of them. A pair of antlers knock loose pieces of wall out of the way, widening the hole for the reindeer to step through.
Rudolph, his nose truly as bright as described, leads the escape. The reindeer are enormous, antlers the size of tree branches jutting out of their heads. Each one is covered in a thick layer of gray-brown fur, and a single name tag hangs from each neck.
A single apple slice sits between Rudolph’s lips, and Tony pales.
Dasher, Dancer, Prancer, Vixen, Comet, Cupid, Donner and Blitzen. One by one, they fan out to stare at Stephen and Tony, jingle bells sounding from their harnesses. The two are rooted to the spot, eyes wide.
Then, slowly, Tony reaches for the bag and pulls out a single carrot stick, shakily offering it to Dasher. The reindeer leans in, narrowly missing Tony with his antlers, and exhales a warm gust onto his palm. He takes the carrot surprisingly gently, and Tony relaxes.
“They’re…actually kinda cute,” He comments, cautiously resting his hand on the crest of Dasher’s head. The reindeer seems to enjoy the attention, leaning into the touch. “I doubt Klaus plays with them much.”
Stephen, eying Vixen, makes a motion for the bag. Tony hands it over, and the sorcerer takes out an apple slice and offers it. Vixen accepts it happily. “This isn’t really how I expected this to go.” He admits, glancing at the busted in wall. “They must’ve really wanted some treats,”
“Guess so.” Tony mutters, scratching Comet behind the ears.
“You’re awfully calm about this.” Stephen notes.
Tony shrugs. “They kinda remind of Percy’s horse, actually. Bit nicer, if I’m being honest.”
“He has a horse?” Stephen asked, surprised.
“Giant black pegasus.” Tony confirms. “The thing just shows up, Percy feeds him a couple donuts, they chat for a bit, and it leaves.”
“Pegasus,” Stephen repeats faintly. “Alright.”
Tony looks at the man over his shoulder. “You get used to it.”
“Are you sure this is alright?” Peter checked.
Natasha, firmly harnessed to Peter’s back, nodded. “Yeah, I think it’ll be fine.”
Peter shrugged against her, and tugged his mittens off with his teeth. He was fairly sure he would be able to stick through them, but he didn’t plan on taking any chances, especially with a passenger. He was still wearing the gloves to his suit underneath anyways, so it wasn’t like he was going to get too cold.
“Ready?” He asked, placing a hand against the stone.
“Ready.” Natasha confirmed, her legs wrapped firmly around his waist, arms around his front. He’d toed off his snow boots earlier, leaving them hidden behind a snow bank, just in case. Free to climb, he began to haul the two of them up with a surprising amount of grace. Like it was natural to him, Natasha noted, a second nature.
It was a pretty smooth journey, all things considered. Her little spider was extraordinarily strong, unflinchingly latching onto the smooth stone face. The wind whipped at them, snow piling up on their heads and shoulders. Every now and then, Natasha leaned forward and wiped the excess off the top of his head. About halfway up, she turned her neck to look down below.
Everything looked so much smaller from this height. The trees, which had seemed infinitely tall from the ground, looked more like weeds shooting up from the snow. She could almost see the whole fortress, from the factory to the stables to the main hall. A bright, colorful blast smacked against the sides of the stables, and she raised an eyebrow. Strange and Tony were an odd duo, but they suited each other. And they probably wouldn’t bring the whole place down.
No, it was Bucky and Percy she was worried about in that regard.
“So,” Natasha said, turning back to him. “Tell me about this MJ.”
“Nat,” Peter whined as he pulled them up another couple feet. Then, he paused. “Hey, do you hear that?”
Natasha listened, but heard nothing. “Not everyone has super senses like you, little spider.” She reminded him.
Peter hesitantly began to climb once more. “It…it almost sounds like people are chanting the word union?”
“...Odd.” Natasha replied after a second. “But, ultimately, not our problem.”
“Fair enough.” Peter said. “I can see the window.” Sure enough, when she looked up, the indentation where the bars sat was visible. Peter climbed until they were level with it, a few feet to the left and out of view of whoever was inside.
“Is it Nick?” Peter whispered. Natasha precariously leaned to the side, grabbing ahold of the ledge and peering inside. She kept her glance quick to lessen the chance he would see her, just in case.
The room inside was rather drab. A single cot, a toilet in the corner, and an imposing wooden door with a slot the size of the empty food tray on the floor next to it. On the cot, facing away from them, was a man. His hair and beard were scraggly and dirty, but clearly white. “Sure looks like it.” She reported.
Peter hummed, but the quiet noise was mostly lost to the wind. “Maybe try calling him?”
Natasha leaned back to the window, grabbing ahold of one of the iron bars covering it. “Yo, Nick!”
The man jolted up and whipped around to look at her head, peeking through the bars. His face held a pleasant flush to it, cheeks round and rosy, eyes kind and twinkling. He certainly didn't look like someone who belonged in a jail cell. “Hello?” He called.
“Back up a little, would you?” Natasha asked, trying her best to be polite to the man. He stood from his cot and did as she asked, backing up the far wall of his call.
Peter, after making sure the rope securing Nat to his back was tight, moved closer to the window. He wrapped a hand around the nearest bar, giving it an experimental tug. He then turned his head back towards his passenger the best he could. “Hold on tight.” He warned.
Then, Peter yanked the bar backwards, ripping it clear out of the stone it was embedded into. He let the broken piece of metal fall and hit the snow, hundreds of feet below. Nick looked absolutely stunned as the young man repeated the process with the rest of them, effortlessly tearing through steel and stone.
Once there was nothing but a gaping hole in the wall, Peter turned to the side so Natasha could get a leg over the ledge. Sitting half in and half out, precariously keeping her balance, Natasha’s deft fingers began to untie the knots connecting the two of them. She slipped out of the rope harness and hauled herself through the window, landing in a crouch on the stone floor. Peter followed easily, sliding in and dropping onto his feet.
“Hi!” He chirped. “I’m Peter, this is Nat, and we’re here to bust you out!”
Nick’s bushy white brows met his hairline. “That’s…awfully kind of you.” His voice was deep and smooth, full of warmth. “I take it you’ve heard of my situation?”
Peter nodded solemnly. “The usurper.”
“So, then you understand that freeing me won’t do much, I’m afraid.” Nick said morosely. “It will take quite some time for me to gain my strength back and clear Klaus out.”
Nat gave him a devilish grin. “Oh, I wouldn’t worry about that. We brought friends.”
Bucky and Percy, fingers intertwined, wander down the hallways. They took the stairs up from the kitchen and backtracked to the window they’d first come into. From there, remembering Strange’s arrow, they head left.
“Heartbeat coming up,” Percy comments as they round a corner. “In the big room up there.”
Neither of them so much as pause as they reach another set of great stone doors, each going to a side and shoving them open with their shoulders in tandem. They make a tremendous clanging noise as they burst open, slamming against the walls.
Inside is what looks like a study—floor to ceiling bookshelves, maps pinned up on any available wallspace, marked up with red push pins. The far wall is made entirely of large windows, displaying the forest outside. The fireplace is crackling, and carpet is soft and a rich scarlet, and, most importantly, a grand mahogany desk sits right in the center. And, there, in a plush armchair, is a man.
He’s tall and broad, with a neatly trimmed white beard. When they enter, his gaze snaps to them. His eyes are dark and narrow, mouth set in a perpetual sneer. “Who the hell are you?” He roars, shooting to his feet.
“Klaus, I presume?” Bucky checks.
“What’s it to you?”
“Is that a yes or a no, old man.” Percy demands.
“Yeah, I’m Klaus.” He spits. “Now get the fuck out of my office.”
The demigod tuts, unsheathing his sword and dropping his backpack by the door. “That’s not very Christmas spirit of you.”
Bucky puts a hand over Percy’s, stopping him from raising his sword. The demigod tilts his head, and Bucky raises a brow. “You got to fight the dinosaur.” He reminds.
Percy huffs, but sheaths his sword. “Fine,” He grumbles. Bucky pecks him on the cheek as he takes off his coat, and then opens the demigod's discarded bag, pulling out the extra twin blades Percy had packed. “Love you.”
Just like that, any semblance of a pout leaves Percy’s face. “Love you too.”
Bucky twirls one of the blades in his hands, turning to Klaus. “Post up, bitch.”
As his boyfriend charges the man, Percy lightly toes his bag. It was a lot lighter than it was when he’d stepped through the portal. He knew Nat had taken his rope and Tony his carrot sticks and apple slices. He was pretty sure it was Ross who’d grabbed his granola bars and duct tape. For what, he wasn’t sure he wanted to know. The spare sweater, scarf, and hat he’d packed were also gone—Dan and Mal, he was pretty sure. And now that Bucky had taken the spare knives, it was practically empty.
On the other side of the room, Bucky broke the acting Santa’s nose.
The med kit and treats for Mrs. O’Leary was still there, along with the firestarters and multitools. Percy frowned, feeling like he was forgetting something. He began to run through the list of what he’d packed that morning, thumbing his bottom lip.
Clothes, snacks, first aid supplies…
Klaus roared in pain as Bucky kicked him in his gut, forcing him back. Then, while the man was still winded, he jumped and pulled a textbook perfect 360 kick, his boot connecting with the man’s face hard enough to send him sprawling. Percy clapped politely, then returned his focus to his bag.
Flares, ammo, hellhound treats…
What was he missing?
Bucky, now pinning Santa to the floor, drew his knife. Percy cupped his hands to his mouth and called across the room, “Ask him about the dinosaur!”
The supersoldier looked scornfully down at the man. He didn’t speak, he just raised a sole eyebrow. Very visually intimidating, Percy was sure of it. Klaus inhaled raggedly. “I sent it to grab people, nothing more. Wasn’t there to hurt anybody.”
“The magic you used was going to kill it.” Percy pointed out angrily. Not only did the man apparently take a creature, considered widely peaceful in this realm, and send it to terrorize New York, he did it at the poor things expense.
Klaus remained silent, and Bucky brought the tip of his blade to the man’s jugular. “What do you mean, grab people?”
“Just needed a few new workers, that’s all.” Klaus wheezed out.
“What happened to the old ones?” Bucky snarled, leaning in closer to the man.
He received no response, which was answer enough. Bucky bared his teeth. “You disgust me. Stand up.” The supersoldier hauled himself off of the man, dusting off his clothes. Klaus stumped to his feet.
“Say something cool,” Percy urged from the sidelines, head tilted to the side as the situation unfolded, Bucky advancing on the man. His boyfriend was clearly deliberating something as he backed Klaus against the wall of his study.
Once he’d apparently decided, he regarded the man for a moment. Then, with a wide, unhinged grin, he spoke. “See you in jingle hell,” Before driving his blade into Klaus’s gut. He ripped it out, and Spartan kicked the man straight through the window, shattering it. Right before he fell over the edge, Bucky plucked the hat right off his head, then let his body plummet to the ground, two hundred feet below.
Bucky wiped off his blade, then turned and walked towards Percy. His boyfriend was breaming at him, all dimples. Bucky, the taller of the two, had no problem fitting the stolen hat right atop his head, pulling it down over his ears. Percy’s hands came up to cup his face, and he tipped their foreheads together. “I have literally never been more in love with you.” He breathes.
Smiling, Bucky slides a hand around his waist. “That was cool?”
Percy laughs, a soft thing that Bucky wishes he could hear forever. “Very, very cool.”
Bucky’s hand rests on the nape of Percy’s neck, and he can’t help but stare at him. Percy’s skin is flushed, snow from the broken window blowing inside and resting on the inky locks peeking out of the hat Bucky had put on him. His lips are chapped from the cold, and Bucky’s eyes linger.
He hears Tony’s surprised voice, way down below. Clearly, someone had found Klaus. Whatever, he could be gay later.
They all meet back up outside, standing in a circle around Klaus’s body. The SWORD members were red-cheeked and grinning. Bridgette is tucked up under Lee’s arm, and Ross has linked arms with both Dan and Mal, who are, oddly enough, both wearing gray coveralls. Stephen and Tony are standing side by side, and there’s a flock of giant reindeer behind them, though neither of them look willing to address it. Peter and Natasha stand on either side of a man in red—he looks much more like Santa should, unlike beady-eyed Klaus.
Nick is eying the scarlet pool of snow with a wrinkled nose. When Bucky and Percy wander out of the fortress into the courtyard, the man looks at them consideringly. When he catches sight of the hat on Percy’s head, he sighs.
“You stabbed him?”
Bucky shrugs. “The revolution slows for nobody.”
Nick doesn’t seem to know what to do with that, so he turns back to everyone else. “You…freed the reindeer?” Tony runs a hand down Donner’s side. “Yes. They deserve lots of apples.” He says forcefully.
Donner chuffs, and Percy nods. “The green ones.”
“The green ones.” Tony agrees.
Nick rubs a hand over his face. Mal, watching the whole thing with a crooked grin, pipes up. “We also started a socialist revolution amongst your elves. Better hope you pay them a fair wage, ‘cause they just formed a union and are duct taping their former corporate overlords to the ceiling.”
“...You radicalized the elves?”
“I’m a passionate speaker.” Lee deadpanned.
Nick, after a second, shrugged. “Good for them. I imagine Klaus made a lot of changes for the worse, around here. I’m glad they’ve learned to stand up for themselves.”
Dan flashes the man a thumbs up. “Oh, by the way, Jackson, we traded the extra hats and stuff you brought for two of their uniforms to infiltrate the workforce.” Percy just nods.
“Your temporary replacement forced dark magic on one of the dinosaurs from the forest and sent it to our realm to kidnap people.” Percy tells the man after it's silent for a second. “He needed to replace workers, apparently.”
Nick pales. “Did he say what happened?”
Bucky shakes his head regretfully. Then, “If you try to take Percy’s hat, you’ll end up like the other guy.”
“Barnes!” Tony hisses. “You can’t threaten Santa!”
Bucky doesn’t even twitch. Nick sighs again. “He can keep that hat. While you lot may have an…unconventional way of it, you really helped me out a lot. I cannot thank you enough for what you did for the elves and my reindeer.” He says sincerely. “Really, thank you. I might even be able to get everything back on track for Christmas…” He trails off. “What’s today?”
Natasha checks her watch screen. “The 24th.” She reports. Nick relaxes. “Oh, that’ll definitely be enough time. You all have my eternal gratitude. The least I can do is send you back home.” Then, he pauses. “I can use a portal, or…” He trails off with a smile.
“This is amazing!” Peter whoops, leaning over the side. Tony is keeping a grip on the teenager’s sleeve, just in case, as he laughs.
From the front, Nick flicks the reigns of the sleigh. “Nothing quite like it, you’ll find.” He comments.
They’re far up in the evening sky, riding above the clouds. Despite the altitude, they all breathe easy as the reindeer team pulls them along. Rudolph’s nose shines brightly, illuminating the way. The sun is beginning to dip in the horizon, turning the sky a rich, vibrant orange. Peter laughs again, a carefree, joyous sound. Natasha smiles fondly at him as they soar through the clouds, wind whipping at the strands that had escaped her braid. Even Stephen has abandoned his usual demeanor, grinning wide and unashamed. He and Tony make eye contact for just a second, eyes crinkled and the tips of their ears red.
Ultimately, the SWORD members had decided to take the portal option home. Lee, the only one who'd given an opinion about it, had simply said, "If I wanted a reindeer as a method of transportation, I'd just go back home."
In the back row, Bucky has unzipped his jacket and wrapped one side around Percy, who’s leaning into his side and holding onto the supersoldier for dear life. He knew Percy wasn’t much of a fan of flying, but he didn’t say anything when he heard how excited everyone else was at the idea.
“You’re way too selfless sometimes,” Bucky murmurs directly into his ear over the wind. Percy just grumbles something against his side. Bucky sighs and presses a kiss to his forehead. “Love you.”
This time, he can make out the returning, “Love you too.”
By the time they get back to the tower, it’s late. Nick bids them goodnight before rushing off back home to prepare for upcoming his worldwide journey. Tony ushers Peter straight off to bed as soon as they get inside with a stern, “You can tell your weirdo little friends about it tomorrow.”
Peter, who’d been beginning to type out a very long text message, made a face at Tony, but trudged off to his room. Natasha, undoing her braid and raking her nails through her hair to get the snow out, laughed a little. “I think I’ll be following the little spider’s example.”
“Night, Nat.” Percy and Bucky call.
“See you tomorrow,” She calls as she steps into the elevator.
Eventually, Tony convinces Strange that, yes, it’s fine if he stays the night, it’s getting late and they’re all tired, there's no need to back to the sanctum. FRIDAY directs the sorcerer to a spare room, and the man gives them a grateful smile before departing.
Tony, Percy, and Bucky sit heavily on the couches for a long period of blissful silence. Eventually, Tony looks over at Percy. “Nice hat.”
Percy’s smile is sleepy but radiant. “James got it for me.”
Bucky and Tony exchange amused looks. “That’s nice of him.” Tony says. Percy nods along, already curled into the supersoldier's chest. “Strange is nice.” Percy says suddenly.
Tony pauses. “What?”
“Strange. He’s nice too.” Percy repeats.
“What does Stephen have to do with this?”
Bucky’s grin is wolfish. “Stephen?”
Tony’s ears turn pink.
Percy hums. “Your pupils dilate when you look at him.” He drops. Bucky laughs, mindful of the volume as he slides an arm under Percy’s knees. He picks up his boyfriend with ease, standing smoothly. He carries him into the elevator, leaving Tony spluttering on the couch.
Five minutes later, the two are in pajamas, their gear strewn across the desk and chair in the corner. Mrs. O’Leary is sitting on the bed, wagging her tail, and Percy scratches behind her ear. “Hey, didn’t she come through the portal with us?” Bucky asks.
Percy hums. “Probably. She comes and goes.”
Bucky kisses the hellhound on the snout. “A strong independent woman. Wonder what she did all day.”
They peel back the covers and curl under them. Percy’s nose pressed into Bucky’s collar, one arm wrapped around him and resting across his back. Bucky holds him close, his chin atop the demigod’s head. They’re comfortable in their silence, breathing patterns falling into sync.
They both have full days tomorrow—visiting Percy’s mother in the morning, then a get-together at the tower. After that, Percy’s going to bring him along to his Camp holiday party, so he can finally meet the few remaining cousins that haven’t dropped in on them so far.
But, until tomorrow, they can relax in each other's company, content to just lay there.
Then, Percy gasps. “The pig balls.”
“What?”
“I knew there was something missing from my bag! It’s the pig balls!”
Slowly, Bucky turns his head to look at the end of the bed. Mrs. O’Leary wags her tail, and Bucky swears she’s grinning at them.
At the same time, he and Percy burst out into laughter, the round, deep kind that comes from the belly, hard enough to bring tears to their eyes. When they can finally catch a breath, Bucky leans down and catches Percy’s chin. His eyes flit to the clock on their nightstand. Its exactly midnight.
He tips Percy’s chin up and kisses him soundly. “Merry Christmas, love.”
The smile he gets is one that plays again and again behind his eyelids. “Merry Christmas, Jamie.”
Notes:
its got it all! wintersea fluff, the spider duo, ironstrange, socialist revolutions, violence against santa, and reindeers! what more could you ask for :)
also shout out to my friend M, who specifically requested the line 'see you in jingle hell'. you are iconic and i love you.
me last year: some fluff, they all celebrate the holidays together :)
me this year:
me this year: percy fights a t.rex. tony is a reindeer whisperer. nat dreams of jailbreaks. SWORD yearns for revolution. bucky kills santa. peter takes to the skies.bucky about nat: i just think shes neat :)
strange is lowkey a dumb bitch. like “He wasn’t quite sure what realm this inhuman was from, but Strange most definitely did not want to pay a visit.” bitch you mean manhattan
me: he's fighting a t.rex, strange got bit by a feral demigod,
me: percy is an eldritch being, connected to the primal sources of the earth, unknowable to mankind-
me: the dog has a little sweater lmaoi just thought it'd be a little bit of a neat idea if the scars monsters gave demigods glowed a little with the golden dust they turned into. like the more violence you commit, the more tiny pieces of monsters become part of you
anyways stan cynthia and ella <3
lee and wong >>>>>>>>
if anyone caught that one chapter of the sword babes at the end of TLS, they're at bridgette and lee's house, which is right next to the sanctumlee, eyes narrowed: what do you want you wizard bitch
stephen, who just needed an egg:me: christmas story :)
me but in a evil little cloak: c a p i t a l i s m
me: ....okay-percy: i w a n t s a n t a s h a t
bucky, preparing to commit a murder: dw babygirl i got youbucky: see you in jingle h e l l
percy, weeping, already down on one knee:strange and percy at the beginning of the chapter: >:(
strange and percy at the end of the chapter: 🤝 caring about tonyi had to deliberate between ironstrange and pepper/rhodey/tony, but ultimately, i decided that the dynamic of two very well put together sophisticated people cheering on their dumbass friend to seduce a wizard was too good to pass up
happy holidays, everyone!
beans out B)plumbing baby, goodbye
Chapter 36: fistfulls of shredded carrots and cabbage before the sunrise
Notes:
(See the end of the chapter for notes.)
Chapter Text
*kills you in russian*
natatouille: so…
natatouille: you and jackson?
bucky bear: huh
natatouille: you’re together, are you not?
natatouille: because if you aren’t, i swear to god i WILL be fixing that
bucky bear: please no
bucky bear: ive heard horror stories of your matchmaking efforts
natatouille: :)
bucky bear: yeah we’re together
bucky bear: have been for a while
natatouille: im happy for you
bucky bear: thanks
natatouille: but i gotta ask
natatouille: how?
bucky bear: i captivated him with my encyclopedic knowledge of tolkien and also my mental illnesses
natatouille: 👍
natatouille: providing hope to ex-assassins all around
natatouille: but he is good to you about that kind of stuff, right?
natatouille: obviously, it wasn’t your choice to do all that, but i know some people have issues with pasts like that regardless.
natatouille: everythings okay on that front?
natatouille: i can lace his jello with cyanide if not
bucky bear: uh
bucky bear: first, please dont. the man is absurdly protective of his jello
bucky bear: second, yes, he’s amazing. honestly, nat, i dont know what i did to deserve him. he’s such a genuinely good person it surprises me every day. i dont know where i’d be without him
natatouille: gross
bucky bear: :/
bucky bear: and nat?
bucky bear: he’s not going to judge you. you dont need to worry about it. talk to him. it'll go better than you think.
natatouille:
natatouille: alright. I will
Natasha Romanoff and Perseus Jackson
NR: hey, can we talk?
PJ: im ironing my socks right now
PJ: we could get lunch later?
NR: sounds good
*kills you in russian*
natatouille:
PJ: im ironing my socks right now
natatouille: ?????????
bucky bear: god he’s so weird
bucky bear: i desire him carnally
natatouille: you two most definitely deserve each other actually
robert <3
egg: its a genuine fear, dan
class traitor: no?? I dont think it is????
certified monster fucker: is it someone sticking you with heroin while you walk past them on the sidewalk, pulling you into addiction and ruining your life?
certified monster fucker: cause i get that
egg: no what
egg: ross what is wrong with you
Local milf: me living in constant fear that my gardening will get me taken down by the fbi
class traitor: girl huh
Local milf: i like the way poppies look!! but what if im making drugs :(
class traitor:
class traitor: well ARE YOU???
Local milf: no!
Local milf: but what if i do it on accident
class traitor: you're. insane, actually
egg: hey the focus shifted away from me and i don't like that
certified monster fucker: right sorry
certified monster fucker: mal, what fear were you talking about?
egg: im deeply untrusting of tall people
egg: what if they lick my head
Local milf:
Local milf: are you serious
egg: yes!!! literally what is stopping them
Local milf: a BRAIN
egg: i live in constant fear of like half of you
egg: and you belittle me????
Local milf: lee is telling me to tell you that he never thought of doing that to you until you brought up the idea
egg: SHIT
certified monster fucker: speaking of, where is my dearest discount thor??
Local milf: he’s sitting in the kitchen chewing on the contents of a tea bag
Local milf: he says it “appeals to his autistic sensibilities”
class traitor: so real for that one
Local milf: since we’re all sharing
Local milf: dan whats a weird fear you have
class traitor: the next time aliens come to earth what if a piece of their ship falls off and impales me through the foot, immobilizing me, and they laugh at me from above and call me names. i wouldn't be able to understand what they’re saying, but i would hear them jeering and yelling, and so i know it would be mean but i wouldn't know exactly what they're making fun of me for. and since i wouldn't be able to move because of the metal spike through my foot, id just have to stand there and take it, wondering about every little thing they could possibly be making fun of me for. every insecurity i've ever had would come to surface. It'd be terrible
thor understudy: and the food processor
class traitor: and also the food processor
class traitor: but i feel like thats your fault
thor understudy: get over it
thor understudy: if you cant handle midnight vegetable shredding, then you have no right to be here
class traitor: every. goddamn. night.
class traitor: THREE YEARS
thor understudy: youve never experienced joy until you know fistfulls of shredded carrots and cabbage before the sunrise
class traitor: ill literally never forgive you
class traitor: to this day i hear the shredder in my sleep
thor understudy: and it continuously improves you as a person
class traitor: :/
coolest intern @peterparkour
come with me to see if any of the avengers will finish the heart <3
coolest intern @peterparkour
[Video Attachment: Peter walks up to Tony and holds out a hand, first finger extended and middle finger bent to make half a heart. Tony looks up from the papers he’s reading, and, after a second, puts his coffee cup down.
Tony: What are you doing?
Peter: It’s a heart, Mr. Stark!
Peter: Well, half of one.
Tony nods, squinting. He holds up a hand to mimic Peter’s, taking a second to get it right. He holds it up to Peter’s, completing that heart.
Tony: Like that, kid?
Peter: Yep!
Then, he’s standing across from Rhodey. Once more, he holds out his hand, fingers in the shape of a half-heart. The Colonel regards him curiously. Then, he looks down at his own hand, hesitantly raising it and completing the heart.
Rhodes: Did I do it right?
Peter nods, giving a thumbs up.
Peter: Fantastic job.
Next, he approaches Natasha, who is crocheting on the couch, a large black mastiff next to her. As soon as she catches a glimpse of Peter, she holds up a half-heart before he can even say anything. Peter is the one to finish it this time.
Peter: How did you know I was going to do that?
Natasha, somehow crocheting with one hand: I know everything, kid.
Peter: You’re so cool.
Natasha looks up at that and smiles at him.
Lastly, he approaches Bucky. The supersoldier is sitting on the couch, sharing a throw blanket with another man, who's cuddled up against him. Though he stops when Peter draws near, it appears he was reading aloud. Peter holds out his half-heart, and Bucky tilts his head to the side.
Bucky: Is that a threat?
Peter: What? No!
Bucky, squinting: Oh! It’s a heart?
Peter: Yeah!
Bucky finishes the heart. The man next to him, his face mostly hidden, turned into Bucky’s side, makes a confused noise. Bucky, lovingly gentle, takes the man’s hand and moves his fingers into the right position. Then, smiling, he connects their two hands to make another heart.
(Though you can’t see it, the other man beams.)
Peter, choked up: You guys are disgusting.
End of video.]
piru @pirepiro
why am i fucking sobbing
annlis @anli
WHEN WILL IT BE MY TURN TO BE HAPPY
Avengers!!!! @superherostan
oh my god i love tony stark so much,.,.,,..,,,,,rjghregvrequghGRJHDSJTK
Bblimm @blooo
natasha im SCREAMING <3 <3 <3 <3
bearbi @bearbi3
I will be a colonel rhodes stan until the day i DIE
mimi @wheresmybeans
barnes helping his bf make the little hand thing 🥺
Ferris wheel fighter @ihatecarnivals
tbh thats so valid of him, it took me like fifteen minutes to figure out
scientists hate this local new yorker @jbarnes
“couldn't see it :(“ –my boyfriend
Ferris wheel fighter @ihatecarnivals
omg that was my issue too!! My friend was trying to show me when I’d lost my glasses lmao
scientists hate this local new yorker @jbarnes
“blind”
Ferris wheel fighter @ihatecarnivals
me fr 😭 my prescription is BAD
scientists hate this local new yorker @jbarnes
“I actually cant see”
mimi @wheresmybeans
omg dude help your boyfriend find his glasses????
Bblimm @blooo
bro help him
piru @pirepiro
find his glasses for him!!
YES we have very strong opinions about colors and NO we dont all know each other
“blue”: i swear to god
“red”: What’s wrong?
“blue”: ask someone to pull up james’s twitter for you
“red”: Okay.
“red”: Oh my God.
“blue”: i dont know whether to laugh or cry
“red”: People are fantastic at ignoring what’s right in front of them.
“red”: It works in our favor, though.
“blue”: indeed it does
Notes:
I HAVENT UPDATED THIS SINCE CHRISTMAS LMAO
natasha and percy went to dennys btw
for those wondering, dan's fear is a genuine fear a friend of mine has
guess who "red" is :)
plumbing baby. goodbye.
Chapter 37: TONY STARK SEDUCED OUR PARENTS???? (NOT CLICKBAIT) (REAL)
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
Tony Stank: commencing the public shaming of one Peter B. Parker
skrunkly raccoon: :o
percenary: ooooh someones in troubbblleeee
skrunkly raccoon: what did he do???
Tony Stank: i got a call from the school to pick him up
Tony Stank: for his SUSPENSION
percenary:
percenary: @babyavenger tell me it was worth it
baby avenger: >:(
baby avenger: i will not be shamed for defending my territory
Tony Stank: …kid
Tony Stank: you know what
Tony Stank: barnes, add me to to the chat with all of peter’s rat bastard comrades
skrunkly raccoon: aight
baby avenger: WAIT DONT
percy’s bimbos
[terminator has added TS to the group]
TS: …
TS: admittedly, the pure shock coursing through my body has tempered my rage.
TS: who named this?
TS:
TS: @TheNews(™) what???
TheNews(™): freedom of speech, bitch
terminator: this is my friend tony, everyone
TheNews(™):
TheNews(™): stark?
TheNews(™):
TheNews(™): freedom of speech, sir*
TS: uh huh
TS: now, would any of you like to explain why i was called away from work to come collect peter?
TS: furthermore, why every single one of your guardians was standing outside the principal's office with me?
moonmoon:
moonmoon: well, i’d like to start by saying that it was an honest mistake
moonmoon: and that, if any blame is cast, it should be upon Mr. Dell
TS: are you seriously trying to tell me that your history teacher is at fault?
moonmoon: yes sir i am
murphy’s law: he made the medieval age unit very intense, sir
murphy’s law: his descriptions of dark age warfare were very elaborate and descriptive
president lincoln: we’d just gotten out of his class
president lincoln: and we were sitting in the AcDec room
president lincoln: and the door was locked
president lincoln: and flash shoulder checked it really hard instead of knocking (cause he sucks)
president lincoln: and
TS:
TS: and all eight of you immediately took on the mindset of medieval peasants under siege?
The News(™): i believe so, sir
The News(™): the loud noise awoke something in all of us
Murphy’s law: i panicked and started moving the desks to barricade the door
moonmoon: and when charles panics, i panic, so i started helping him stack chairs on top of the desks
Avril lavigne: it was contagious, sir. i was reinforcing the windows with textbooks and scotch tape before i even knew what was happening
nedleedle: and when i saw all of that, i knew we were going to be preparing for the long haul, so i started rationing food for the winter
TS: well that explains the lunchable stack in the corner
The News(™): we were preparing a last stand. the pressure started getting to us. abe and i began our offensive maneuvers.
TS: you made flashbangs and exploding acid packets.
president lincoln: we thought poisonous gas would be too hard to control
TS: and i thank the gods for that modicum of common sense in the midst of your madness
TS: but acid? really?
moonmoon: we were worried about the trebuchets, sir
Scary Captain: i realized fifteen minutes in that we might not last, so i boosted peter up into the vents to start the escape tunnel
TS: and thats why peter had that shovel?
tungsten dioxide whats this: and thats why i had that shovel.
TS: i don't even know what to say about this
moonmoon: neither do our parents. my mom is on the phone with ned’s to get us drug tested
The News(™): mine are calling my psychiatrist
Murphy’s law: mine haven't been able to look me in the eyes. I think they’re calling a priest
President lincoln: oh, you’re catholic?
Murphy’s law: nope
Murphy’s law: they're just that desperate
Avril lavigne: last i checked, mine were looking into reincarnation and past lives
Avril lavigne: my dad was on the phone with a lady who claimed to be a serf in a past life
TS:
TS: barnes, take me out.
[terminator has removed TS from the group]
ethically sourced sluts
vintage bi: i meant with a gun, but that works too.
vintage bi: grab percy and bring him to my office? I have an idea.
antique gay: 🫡 you got it boss
[TS has created a new group]
TS: Hello, everyone. It’s recently come to my attention that many of us are at a loss of what to do with our respective children after today’s events. After speaking with my colleague, I believe I have found a solution that would benefit all parties.
Emma Moon: You’re Peter’s other guardian, correct? May has mentioned you, but we haven’t gotten a chance to formally meet. Other than the brief chat we had outside Morita’s office.
TS: That would be me. If all of you are available, I’d like to invite you to dinner for us to speak about today. My treat.
Evan Murphy: That’s awfully generous of you, but not necessary. What time are you proposing?
TS: Please, I insist. I have a strong feeling this may be more my fault than any of yours. Does 7:00 work?
Susan Avril: 7:00 works for me. And how could this possibly be your fault?
TS: Good to hear. And as for the second part, I feel as though I’ve let Peter have too many unsupervised conversations with an…ancient warfare enthusiast I know.
Isa Leeds: Ancient warfare enthusiast? How fascinating! If that’s the case, then I’m sure it can’t have been that much of an issue. People with obscure hobbies are delightful to be around! A while back, I had a lovely conversation with a young man about seagulls.
Isa Leeds: Peter’s older brother, I believe. He was a very nice young man.
TS: Ah.
[TS has created a new group]
[TS has added Peter Parker, James Barnes, and PJ to the group]
[Peter Parker has added Ned Leeds, Michelle Jones, Sally Avril, Cindy Moon, Betty Brant, Abe Brown, and Charles Murphy to the group]
TS: Before any of you ask, this is for my own benefit. I don’t want to be haunted by the history of that other chat.
Charles Murphy: …that’s fair.
TS: Anyways, the reason I brought you all here. You see, I had the most delightful dinner with all of your parents.
Abe Brown: is that where my dad was?????
Charles Murphy: wait.
Charles Murphy: are you the reason my parents came home wine drunk
percys bimbos
moonmoon:
PETER
moonmoon:
MISTER BARNES SIR
tungsten dioxide whats this: what?
terminator: yes?
moonmoon: IS TONY STARK ABOUT TO TELL US THAT HE SEDUCED OUR PARENTS
tungsten dioxide whats this: im sorry???
Unnamed Group
TS: Yes, I suppose so. We were discussing how to proceed with all of you at Le Bernardin last night.
percys bimbos
avril lavigne: I JUST GOOGLED THE RESTAURANT
avril lavigne: IT HAS THREE MICHELIN STARS AND I CAN'T PRONOUNCE HALF THE MENU
terminator: i'm going to be fully honest with you guys,
terminator: tony stark may or may not have had sex with some or all of your guys parents.
president lincoln: WHAT KIND OF SICK FUCKING POWER PLAY IS THIS
Unnamed Group
The News(™): you?? fed?? my??? mother??? scallop caviar??????
TS: Along with mesclun salad with truffle vinaigrette, some lovely halibut, and caramelized rice pudding with white peach sorbet. It’s amusing that you think I didn’t treat Amelia with multiple courses and dessert.
The News(™): AMELIA?????
TS: You heard me. Are we done here?
The News(™):
The News(™): ʸᵉᵃʰ
TS: Good. We came to the decision that, if you all have so much energy and a strange proclivity for violence, you’ll be learning to direct it in a healthy and heavily supervised environment.
[James Barnes has changed the group name to ‘bootcamp’]
James Barnes: welcome to hell, kids :)
Notes:
*dissapears for two months*
*gently nudges TONY STARK SEDUCED OUR PARENTS???? (NOT CLICKBAIT) (REAL) towards you* hi
a very sincere thank you to everyone who reached out! i am fine and alive, i was just super busy for a bit, and then had some major computer troubles. everything is resolved now!
also, a VERY late happy pride month to everyone! enjoy tony stark, our slutty bisexual king :)
love you all!
plumbing baby. goodbye.
Chapter 38: mmmmmmmmmmmmm widely available explosives
Notes:
(See the end of the chapter for notes.)
Chapter Text
Bucky would almost be tempted to blame May Parker if she wasn’t the fantastic woman she was. It had started off fairly innocuous, the woman leaning on the counter and chatting with Tony while she waited for Peter to pack up the last of his things.
“Yeah, the whole building used to get together on the rooftop and have a cookout, but the landlord put an end to it after last year,” May said with a roll of her eyes. “Bastard.”
Tony made a face. For a man who had to be completely unfamiliar with landlords, he sure managed to hold a burning passion for them. The cogs in his brain were almost visible as they worked. He took a sip of his smoothie, then shrugged. “If it’s important to you, my rooftop is available.”
“Really?” May asked, taken aback. “Oh, I can’t ask you to do that. Besides, I’m pretty sure most—if not all—of our neighbors made plans already.”
A dismissive gesture. “Probably for the best, FRIDAY has been spending a frightening amount of time with Peter’s friends, and I’m worried she might try and use her newfound evil on the next unsuspecting stranger. Besides,” He said, “I’m sure the view of the fireworks will be much better from here.”
May chewed on her lower lip for a moment, then broke out into a smile. “I’ll talk to Peter,” She said. Then, before exiting the kitchen, she put a hand on Tony’s arm. Voice warm, she said, “You’re a good friend, Tony. Really.”
His face turned an alarming shade of scarlet, and, from his spot on the couch, Bucky laughed.
From there, it was a flurry of preparation. The entire SWORD team, all of Peter’s horrible little gremlin comrades, the Parkers, and all of the tower’s occupants were invited with varying levels of respect.
Pepper and Rhodey both received gilded and embossed envelopes with hefty cardstock invitations. Percy and Bucky, at least, received the courtesy of a polite knock and a verbal invite (Though, that may have been more out of fear than courtesy. Tony would never forget the last time he hadn’t knocked. Scarred. For. Life.) At the bottom of the chain, Peter’s friends received a text that said ‘ hey shitheads 🤪 come to the tower or i’ll zip your assholes shut’.
Surprisingly, that was the more orderly part of the preparation. Divvying up food responsibilities afterwards was much, much worse.
“Alright, BBQ! Ribs, hot dogs, burgers, do I have an offer!” Pepper called, standing on the coffee table with a clipboard. “Grill’s already on the roof, we just need someone to man it!”
Rhodey raised his hand. “I can do that and baked beans!” Pepper nodded approvingly, not trusting the majority of the others with flames in any form, ticking it off her papers. “I can help,” Natasha offered. Rhodey scrutinized her for a moment, then nodded, deeming her sensible.
“Side dishes!” Pepper announced next. “May’s already bringing corn on the cob.” Mal slapped a hand on the counter. “My dips could convince someone to kill their grandmother.” She said, intense. Pepper accepted that with a nod and the scratch of a pen. “Potato salad and some fruit would be nice.”
Tony shrugged. “I can handle the potato salad.” This, for some reason, got him some serious stink-eye from Bridgette. From behind them, Percy offered. “I can find the best watermelons in a seven mile radius.”
“Aw, man.” Ross muttered. “I wanted to bring the watermelons.”
Percy slowly turned towards him. “I’ll fucking kill you.”
Ross clammed up and nodded. Bridgette was still staring at Tony, and now muttering under her breath.
Another nod, two marks on the paper. “Drinks?” Bucky silently raised his hand.
“Desserts?” Bridgette and Lee exchanged looks, then Bridgette broke her spell-casting(?) and spoke up. “We can do that.”
“I’ll handle decorations. Can we get someone on silverware and plates?” Dan, who just learned how to boil water last week, turned to Ross, who was inching away from Percy’s menacing expression. “I guess that’s us.” Dan sighed.
Pepper nodded. “Alright. You all have your missions.” She looked up from her clipboard for the first time. “Do not disappoint me.”
It was a simple statement, but somehow so, so threatening.
They met on the roof a few hours before sunset. The tables were adorned with season-appropriate tablecloths, and chairs had been set up around the space. Ross and Dan’s plates and cutlery were stacked at the far end of a long, rectangular table, and the space from there to the grill Natasha was watching over slowly began to fill up; Bucky’s contributions of sweet tea and lemonade, large bowls of baked beans and potato salad, and Mal’s dips laid out in a surprisingly artful spread. Right next to the grill, stacks of corn sat, and large platters were slowly being filled with hot dog and hamburger buns, a couple neatly latticed apple pies behind them.
Music was playing from a speaker by the roof access door, and a few blankets were set up near the ledge for later in the night. Peter was bouncing up and down, a motion that only increased as more as his friends showed up. Thanking the Gods that Percy was still inside, Tony watched them stare at Natasha with wide, starry eyes. The assassin seemed reluctant, but still greeted them. Cindy looked like she was going to pass out.
They were just about to start dishing up when Percy arrived, a large platter balanced easily on one hand. He set it down on the only free space on the table, and everyone went silent. “Hey, Percy?”
“Hm?”
“Have you ever done anything fucking normal? At any point in your life.”
Percy’s deadpan was impressive. “I have no idea what you’re referring to.”
The platter had multiple fair sized watermelons on it, each elaborately carved. From where Tony saw, he could see multiple watermelon sharks circling around an absolutely breathtaking rendition of an eighteenth century ship. Other fruits made up small details, forming waves and a distant, rocky shoreline—-he could pick out pineapple, grapes, and strawberries, at the very least.
To the left of him, Percy hummed. “It’s the HMS Victory.” He informed Tony blithely. “Served 245 years.”
Tony just stared at him. “Why do you do these things?” He whispered.
Rhodey and Nat had grilled everything to perfection, his experience combined with her lethal focus. Mal’s description of her dips was apt, and the lemonade was the perfect mix of sour and sweet. It had taken Peter’s friends a couple minutes to stop staring, open-mouthed, at Percy, and a few more for them to clean up the drool, but after that, the party began.
(Rhodey took pity on Natasha, who was watching the teenagers follow Percy with their eyes borderline obsessively. “They’re infatuated. We can’t do anything about it. We’ve tried. Barnes thinks it’s funny.” He supplied.)
Tony, Pepper, and May all relaxed back in lawn chairs as they ate, soaking in the last of the sun’s rays as it began to inch towards the horizon. Natasha was, once more, monitoring the grill with a burning intensity as Rhodey filled up plates for the both of them. Bridgette was leaning back in her chair, using one of Lee’s broad shoulders as a footrest. He was seated on the ground in front of her, seemingly not minding, talking quietly with Mal. All three of them were keeping an eye on Ross and Dan, Bridgette’s eye developing a twitch whenever one of them got vaguely near the grill.
Thank the Gods for Natasha’s vigilance.
Peter’s knees were curled up to his chest, clutching nothing but the serving bowl of baked beans and a large spoon. The other kids sat in a loose circle with him, and Tony was honestly too tired to even try and listen to whatever they were talking about. All he knew was that Abe was on his sixth hot dog, Cindy was gnawing on an entire watermelon shark, and Betty was online shopping for fireworks. All of them were fixated on Percy and Bucky, the only ones seated at a table. With a sick sort of fascination, they, including Bucky, watched as Percy steadily destroyed an entire rack of ribs.
Charles leaned forward, half-heartedly chewing as Percy stuck an entire rib in his mouth, only to spit out a gleaming bone a second later. Bucky looked, quite frankly, delighted.
Tony looked away and resumed his conversation with May and Pepper. Those two were each other's problem tonight.
As the evening dipped into night, everyone started crowding closer to the ledge, settling on the blankets spread out. It was warm enough to not have to worry about the night’s chill, the breeze only lightly ruffling clothes and hair. Peter had a pair of headphones sitting in his lap in preparation for when the fireworks began, eagerly focusing on the East River in the distance.
“Are you sure we’ll be able to see them?” Sally asked. “It’s a bit far.”
Tony sighed dramatically. “No faith, child. None.”
Sally blinked, and slowly turned back to the cityscape, now equal parts nervous and excited. Anticipation was curled in their guts as the sky further darkened, checking watches and phone’s every couple minutes. The rooftop had settled into silence, the grill turned off and conversations flowing to an end.
The first firework shot upwards into the sky, a spark with a plume of smoke trailing after, exploding in a massive shower of blue and red sparks. The accompanying sound would be better attributed to a bomb than a firework, deafening and unmistakable. For just one second, the entire sky seemed to light up.
Slowly, Sally turned back to Tony. “That can’t be legal,” She breathed.
The man just grinned and raised his Solo cup of lemonade. “You’d be surprised what people are willing to do when you supply the explosives.” Was all he said.
The barges floating down the river started shooting more, some making high-pitched whistles and exploding into clouds of shimmers, others booming like a mortar and expanding across the sky. It was blinding and deafening and absolutely breathtaking. Even Peter, with the padded headphones fixed over his ears, was transfixed, the explosions of light reflecting off his eyes.
Lee, too, had brought ear protection, leaning forward and resting his chin on Bridgette’s head, who’s migrated from her chair into her partner’s grasp, settled between his legs. Mal, Ross, and Dan were all individually plotting to try and get Tony to supply them with whatever he had given the barges to shoot into the sky. May’s gaze went back and forth from the fireworks to Peter’s awed expression, her eyes soft and adoring. Even Natasha, a hip leaning on the table, was watching in silent appreciation.
Percy and Bucky sat in the back, both supplied with earplugs. Bucky rested against the wall by the roof access door, Percy propped up against his chest. The supersoldier’s arms circled around his boyfriend, hands resting on his stomach. The first half hour of the show was completely lost on him, instead staring at the starburst reflecting on Percy’s eyes. The demigod, though unable to see the fireworks, assured Tony with a shrug that feeling the explosions in the sky was entertaining enough. “Feels fuzzy,” He’d said as they began planning earlier.
Percy was engrossed with the strange sensation in the sky accompanied by his boyfriend’s heartbeat. He’d been a bit worried about how his James would react to the fireworks—though they were both veterans in some form, Percy’s experiences involved a lot less loud bangs and more children hacking eachother apart with blades. Bucky, though, seemed content with the earplugs and Percy in his arms.
He was glad. Bucky, of all people, really deserved to have some fun.
A particularly flashy one went off, arcing across the sky in a brilliant shower of gold and green, and a soft round of exclamations went off from the teens sitting by the ledge. Peter, at some point during the night, had ended up sitting next to MJ, and, at another point, had began to lean against her. Though she hid it fantastically, her heart jumped up into her throat. MJ turned her head to look behind her, careful not to jostle Peter, and made eye contact with Bucky, who had practically enveloped his boyfriend with his arms. The supersoldier raised a sole eyebrow, lips twitching upwards, and MJ, heart thumping in her ears, settled an arm over Peter’s shoulders.
He squished further into her side at that, and MJ’s mouth suddenly felt very, very dry. (...He was still holding the fucking bean bowl. It was a terrible thing that she found that endearing.)
Charles was on his stomach, chin propped up in his hands, and Cindy was using his back as a pillow, staring directly upwards into the sky. These fireworks, whatever the hell they were made of, shot high enough for her to not even need to turn her head to see them. Sally and Ned were awfully close and Abe and Betty were fighting over a hamburger bun, eyes glued on the show.
None of them spoke for what felt like hours, a captive audience. Each firework seemed more impressive than the last, brighter and more colorful. They seemed to rip the sky open like it was made of fabric, tearing open the night and letting flashes of the day come through.
Percy tipped his head up, lips barely an inch away from Bucky’s ear. “It’s going to end soon,” He said softly, the proximity allowing him to be heard despite the earplugs. “Rain’s coming.”
Sure thing, the show seemed to be building up to a finale. There was a short pause, like bated breath, before a barrage began. All at once, the barges on the river let off a whistling arc of fireworks, setting the world ablaze in scarlet and gold, a bombardment in signature colors. For just a moment, the night turned to day.
Then, silence.
Peter was the first to break it, slipping his headphones off and turning to stare at Tony, who was still lounging in his chair. The boy scrambled up and launched himself at his mentor, wrapping him in a hug. Tony wheezed but laughed all the same, returning the embrace. As Peter pulled away, he was already firing questions at the man. “How did you do that? When did you do that? How many laws did you break? Do we need to be worried? Should we—”
Tony pat Peter on the back. “I have my ways.”
Surprisingly, that seemed sufficient to Peter, who beamed at him and hugged him once more. “Thank you,” He murmured against Tony’s collar. The man just smiled and tucked his face into Peter’s curls.
May was the second to get up, watching the two with a smile, and beginning to cover dishes and stack them to be moved inside. Percy wiggled free of Bucky’s grasp, and, after hauling his boyfriend to his feet in a show of strength that had the AcDec team wheezing, the two began collecting trash. Natasha and Rhodey took care of the grill while Tony, who still had Peter clinging to him, started folding up the tablecloths. Pepper and the SWORD team collapsed the tables while the AcDec team folded chairs and blankets.
“That,” Abe finally said after a long moment of reflection, “Was badass. I didn’t even know fireworks could get that big.”
“Yeah,” Cindy breathed. “Forever ruined for other fireworks.” Charles and Betty nodded solemnly.
Tony, plus his parasite, helped collect the last of the trash. “So,” The man asked over the quiet chatter than had picked up as everyone milled about. “How was it?”
Percy, who’d taken out his earplugs, beamed at him. “Very cool.” Tony nodded. “I’m glad. The people on the barges were all too happy to accept my donations. Maybe…too happy. I might need to—” He was cut off by a loud boom as one last firework went off. At the sound, Percy squeaked, and, across the roof on the only remaining table, a watermelon exploded.
Luckily, nobody had been directly in the blast zone, but a large area of the roof was now covered in chunks of fruit.
“I think they forgot one.” Lee finally observed, shattering the stunned silence. Percy’s face, though it was near impossible to tell in the low lighting, was bright red. “I’ll clean that up.” He promised. Bucky, who looked to be fighting an agonizing battle to not burst out laughing, offered to help through his wheezes.
Everyone slowly migrated inside, most of them hiding smiles. The AcDec kids ran for their overnight bags, eager to set up the promised blanket fort in the common rooms as Rhodey, Pepper, Natasha, May, and Tony retired to their usual rooms, leaving Percy, Bucky, and an exploded watermelon on the rooftop.
The second the door had shut behind the last person, Bucky burst out into peals of laughter, doubling over.
Percy’s cheeks burned. “Shut up, oh my Gods. I hate you so much.”
Bucky wheezed. “You…you blew up a watermelon.”
“I am aware,” Percy mumbled, bending down to begin collecting chunks of rind. “I got startled.”
His boyfriend, still grinning, began to help, scooping the massacred fruit into a garbage bag. Above them, the sky gave a warning rumble. Moments later, rain began to fall from above, as if the fireworks had torn holes into the clouds themselves.
As he flicked a puddle of watermelon juice into the trash, Percy sniffed. “People who laugh at my watermelon-related accidents don’t get the benefit of me keeping them dry.” Bucky’s smile was unrepentant, even as the the droplets began to drop down on his shoulders and head.
The last of the massacred fruit taken care of, Percy tied off the bag and turned to bring it inside with the others, only to find Bucky standing in his way. His boyfriend pressed up against him, hands settling on his waist and pulling him even closer. Percy didn’t resist, letting the bag gently hit the ground.
The rain began to pour harder, flattening clothes and hair. Neither minded, staying exposed to it in each other's embrace. Percy’s soft curls stuck to his forehead, and Bucky ran his fingers through them, pulling them back to expose his face. “I love you,” Bucky reminded with a smile. “Watermelon murders and all.”
Percy’s flush returned, a rosy shade that Bucky adored. One hand slipped away from Percy’s waist, tilted his chin up for Bucky to kiss him. Percy melted into the embrace, settling fully into Bucky’s arms as he kissed him. “Love you too, jackass,” He breathed as they separated. Bucky hummed, pressed another quick kiss to his lips before reluctantly stepping back, picking up the trash bag Percy had dropped. “C’mon. It’s late.” He beckoned.
They ran into Tony in the kitchen, who had changed into his pajamas and was speaking quietly to FRIDAY before he went to bed. He looked them over—soaking wet, fingers laced together and smiling.
“You’re dripping on my floors.” He said flatly.
“Better water than watermelon, though, yeah?” Bucky asked with a shit-eating grin. Percy smacked him on the chest and dragged him into the elevator. “Goodnight, Tony!” The demigod called as the doors slid shut.
The engineer rolled his eyes. “Night.”
Once in their room, Percy and Bucky shed their soaked clothes, leaving them in a heap on the bathroom floor with a nonverbal agreement to deal with them tomorrow. Bucky tossed a change of clothes towards Percy, who had been shaking his hair dry like a dog.
As Bucky dressed himself, he watched Percy’s unamused expression as he pulled on the sweats, having to roll them a few times at the ankles. “You think you’re so funny,” The demigod grumbled, pulling on the sweatshirt he’d been provided.
Bucky shrugged, unashamed. “You look nice in my stuff,”
“Be shorter,” Percy advised as he walked back into the bathroom to brush his teeth. Bucky didn’t have to see him to know his cheeks were tinged red. Bucky rolled his eyes and followed him.
They brushed their teeth in pleasant silence, only disturbed once they’d finished and Bucky caught Percy by the hip as he walked past him, scooping him up into his arms. Like he did every time, Percy made a high pitched squeak of surprise. Bucky shook his head as he walked towards the bedroom. “I really don’t understand how you still don’t see this coming.”
“I don’t see anything coming. Fuck you.”
Bucky deposited his boyfriend gently on the mattress and immediately climbed atop of him, pinning him with his bodyweight and pressing merciless kisses to his exposed neck and jaw. “You love me so much it’s stupid,” He said against Percy’s pulse point, then making his way down the column of his boyfriend’s throat.
Percy made an indignant noise, cut off by a whine as Bucky took the soft skin in between his teeth. “James,” He got out. Bucky hummed against him, continuing to darken the his throat with his lips and teeth. One hand, skin warm and rough, slid up to thread through Percy's hair, the other curling around his shoulder. Percy, despite his whining, was soft and limp beneath him, completely relaxed between Bucky and the mattress.
“It’s like one in the morning,” Percy’s breath hitched as Bucky moved down to his collarbones. The supersoldier made an acknowledging noise, leaving one last mark that Percy knew would be all sorts of colors in the morning before climbing off of him. “None of those were very nice responses to declarations of love.”
Percy made a face, climbing under the covers. “Yeah, and this was?”
“A more permanent reminder,” Was the unashamed answer. “You wear high-collared shirts to work anyways.”
A pause. “Yeah, I definitely hate you.” The demigod said as he pulled the comforter up over both of them, leaning his back against Bucky’s chest, who slung an arm over his waist and pressed his open palm to Percy’s heart. “Mhmm,” Was the only response he got.
Percy, shrouded in the darkness of their room and pulled snug against his partner, huffed, a smile making its way onto his face. “Dick.”
“Asshole.” Was the reply.
Percy tilted his head back to kiss him one last time before going to sleep.
Notes:
a??? fourth of july??? chapter????
got some irondad, wintersea, mj and peter, and general shenanagins and tomfoolery for you all
fun fact: early on, before the lost soldiers was even written, i had drafted percy and bucky's first kiss being in the rain after watching fireworks together :)
funner fact: where was mrs. o'leary during this, you ask? driving the barges. all of them at once. she's the demolitions expert.
percy weaponizing watermelons was something that needed to be explored okay
that and him just. fucking demolishing a rack of ribs. covered in sauce gnawing on bones fully regressed into some sort of fucking animal and bucky just dreamily staring like 'what a man'(somehow the fireworks tony provided had no negative environmental impact. dont ask me how. its for my peace of mind)
plumbing baby. goodbye.
Chapter 39: bucky twitterdumping era
Notes:
usernames list:
we had a bonding moment! i cradled you in my arms!
-Father of 5: tony
-crack dealer: percypercy's bimbos/bucky's victims
-moonmoon: cindy moon
-President Lincoln: abe brown
-murphy's law: charles murphy
-avril lavigne: sally avril
-The News(TM): betty brant
-Scary Captain: mj
-nedleedle: ned
-tungsten dioxide whats this: peter
-terminator: bucky
(See the end of the chapter for more notes.)
Chapter Text
[James Barnes has changed the group name to ‘bootcamp’]
James Barnes: welcome to hell, kids :)
we had a bonding moment! i cradled you in my arms!
Father of 5: how is it going
crack dealer: james is making them do push ups
crack dealer: i think charles passed out
Father of 5: have they begun to regret their life choices?
crack dealer: oh most definitely
Father of 5: excellent
percy’s bimbos
[nedleedle has removed terminator from the group.]
[nedleedle has changed the group name to ‘bucky’s victims’.]
moonmoon: jesus fucking christ
moonmoon: i cant feel my arms
murphy’s laws: can confirm, she’s typing with her nose
president lincoln: i hate it here. i hate it here. i hate it here.
avril lavigne: i think im going to vomit up my lungs
Scary Captain: im going to be fully honest; i didnt even know i could sweat from some of these places
The News(™): agreed
tungsten dioxide whats this: losers.
murphy’s law: PETER D:
moonmoon: don’t act like this isn’t killing you too
murphy’s law: cindy
murphy’s law: look up
moonmoon: what
moonmoon:
moonmoon: oh ok what the fuck
avril lavigne: peter can you please stop doing laps and taunting us with your superior athleticism
The News(™): why are you going so fast
Scary Captain: i feel like you guys have forgotten that being spider-man requires him to actually train
tungsten dioxide whats this: yeah, im sorry guys but this is kind of normal for me
President Lincoln: how dare you.
President Lincoln: YOU ARE SUPPOSED TO HAVE ASTHMA
tungsten dioxide whats this: i got over it
moonmoon: peter…traitor to our people
avril lavigne: god its like you dont even have a peanut allergy anymore
tungsten dioxide whats this: …
avril lavigne: NO
tungsten dioxide whats this: i eat shit ton of peanut butter for p̵̺͎̹͝r̸̛̰̩̲̊̈́o̶̞͎̥̓ṯ̷̑e̸̪͂̉̀i̶͚͂̚̕ǹ̵̨͇͍͂͊ now
The News(™): WHY ARE YOU TALKING LIKE A GYM BRO
tungsten dioxide whats this: sally…
tungsten dioxide whats this: i am a gym bro.
The News(™): IM SOBBING
murphy’s law: why would you do this to us peter
tungsten dioxide whats this: the society that separates its scholars from its warriors will have its thinking done by cowards and its fighting by fools, bitches
Scary Captain: hngg
tungsten dioxide whats this: mj?
Scary Captain: arm cramp.
tungsten dioxide: oh
Michelle Jones and James Barnes
Michelle Jones: HE JUST QUOTED THUCYDIDES
Michelle Jones: HE BENCH PRESSED A COUPLE HUNDRED POUNDS, RAN FIVE MILES, QUOTED THUCYDIDES, AND INSULTED ALL OF OUR FRIENDS
Michelle Jones: i am feeling so many emotions right now i think. perhaps all of them.
James Barnes: oh boy
bucky’s victims
moonmoon: WHY ARE YOU EVEN HERE
tungsten dioxide whats this: warming up
tungsten dioxide whats this: gonna get my ass kicked soon
moonmoon: h u h
tungsten dioxide whats this: since i already have a singular muscle in my body
murphy’s law: rude and unnecessary
tungsten dioxide whats this: im continuing getting my ass kicked by mr stark’s pet psychopath
The News(™): im sorry??????
tungsten dioxide whats this: p e r c y
President Lincoln: rude???
tungsten dioxide whats this: no you dont understand
tungsten dioxide whats this: if you guys think barnes is bad….
tungsten dioxide whats this: theres a reason percy’s not teaching you guys
tungsten dioxide whats this: he would break you.
nedleedle: gonna need some more info there bud
tungsten dioxide whats this: apparently percy’s idea of training children involved actual weapons, something about lava and climbing walls, and also releasing various Beasts into an arena with us
avril lavigne:
avril lavigne: are you serious
tungsten dioxide whats this: unfortunately
tungsten dioxide whats this: it was all very specific, so im pretty sure that’s how he was taught
Scary Captain: is…is that why he is the way that he is
tungsten dioxide whats this: i believe so yes
moonmoon: so why is he teaching YOU??
tungsten dioxide whats this: honestly?
tungsten dioxide whats this: im pretty sure it’s because, of the two people available to me that can know how to fight with super strength, percy just happened to show up at the tower first
tungsten dioxide whats this: every day i thank god my enhancements make me Sturdy and my bones don’t shatter when he hits me
nedleedle: that sounds fucking terrifying what the fuck
tungsten dioxide whats this: yep.
“Break time is over!” Bucky announced. The AcDec team, sans Peter, who were sprawled on the gym floor, groaned. Peter, over on the track, bounced over to the pile of his broken friends to put his phone with his gym bag.
“Were you texting while running?” Bucky asks, unimpressed. Peter nods. “I was telling them how insane your boyfriend is,” He says conversationally. “And that they lucked out with you.”
Cindy, sweaty and bright red, looks up at Bucky. “Is he really that…extreme?”
“Once, he was held captive on an undercover mission, and he got hung up from the rafters with chains. When the guy guarding him got distracted, Percy grabbed him around the neck with his thighs, lifted him up, and snapped his neck mid-air.” To their collective horror, Bucky says this dreamily, a besotted look in his eyes.
A beat passed, the AcDec kids' eyes going distant. “You think that’s hot, don’t you.” Peter said, disappointed. Guiltily, they all nodded.
Slowly, Peter turned to Bucky. “Do you think you can convince Percy to snap my neck, too?”
You Know Who I Am @TonyStark
@NatashaR, welcome.
You Know Who I Am @TonyStark
Everyone else, please be normal about this.
BLACK WIDOW MY MOMMY @blackwidowsimp
OHHOHOHOOHOHEHEHEHEHE
You Know Who I Am @TonyStark
Dear Lord.
Black Widow, Baby @NatashaR
142K Followers | 15 Following
Following:
spidey @spidey-official
scientists hate this local new yorker @jbarnes
You Know Who I Am @TonyStark
Coolest intern @peterparkour
WSC @WorldSecurityCouncilPOfficial
Save the Children International @save_children
Operation Underground Railroad @OURrescue
Stark Industries @StarkIndustriesOfficial
See more…
Black Widow, Baby @NatashaR
To be truthful, I’m not exactly sure what I expected when I was told some of my colleagues had gotten a twitter account.
Black Widow, Baby @NatashaR
The thirst tweets and marriage proposals are seen and appreciated. Some of you really have a talent for words.
Black Widow, Baby @NatashaR
Yes, to everyone asking, I have seen the Nick Fury account. No, I have no idea what’s going on there, and I will not touch that situation with a ten-foot pole.
Black Widow, Baby @NatashaR
And thank you to @peterparkour, Tony’s best quality, for helping me find everyone I wanted to follow.
Black Widow, Baby @NatashaR
Lastly, @jbarnes, would you like to explain yourself? At all?
scientists hate this local new yorker @jbarnes
i have no idea what you’re talking about.
Black Widow, Baby @NatashaR
…
Black Widow, Baby @NatashaR
scientists hate this local new yorker @jbarnes
for some reason, a lot of you keep asking me for relationship advice, so ill share this. an important part of any healthy relationship is trusting your partner and keeping your emotions in check. a good example of this is today, when i was out with my boyfriend shopping. this one guy kept making passes at him, even though he was told to back off. here's a thread on how i handled the situation.
scientists hate this local new yorker @jbarnes
i shot him.
Black Widow, Baby @NatashaR
scientists hate this local new yorker @jbarnes
im really into this skincare shit you guys have come up with. we just kind of used to rub bars of soap on our faces if we felt like it. love this modern shit. kidnappers stand no chance against my fucking skincare routine. grab me by the neck i will just slither out like a wet hotdog
Black Widow, Baby @NatashaR
scientists hate this local new yorker @jbarnes
you guys are all so lucky that my weighted blanket (my boyfriend) is holding me back
Black Widow, Baby @NatashaR
scientists hate this local new yorker @jbarnes
im being judged for buying twenty boxes of girl scout cookies. as if thats my fault.
scientists hate this local new yorker @jbarnes
there were four of them and only one of me!!
scientists hate this local new yorker @jbarnes
‘you are literally an assassin’ ‘didn’t you fight in a war’ ‘dude they’re like 10’ have any of you ever MET a girl scout???? they are RUTHLESS
scientists hate this local new yorker @jbarnes
and they have DIFFERENT FLAVORS??? they used to have only shortbread!!! i was weak and distracted
scientists hate this local new yorker @jbarnes
just ate a box of each flavor and threw up.
scientists hate this local new yorker @jbarnes
I HAVE BEEN BANNED FROM BUYING GIRL SCOUT COOKIES
Black Widow, Baby @NatashaR
scientists hate this local new yorker @jbarnes
I WANT TO GET UP AND RUN AROUND AND JUMP AND CLIMB AND MAKE NOISE BUT MY BOYFRIEND IS ASLEEP ON THE COUCH!! HE IS MY WORLD!!!!
Black Widow, Baby @NatashaR
scientists hate this local new yorker @jbarnes
friendly reminder that life is a tornado and im just a cow being spun around for cinematic value
Black Widow, Baby @NatashaR
ethan jones @ethanjones342
Is it just me or is the ex-Winter Soldier guy never shutting up about his boyfriend really annoying? Like, we get it. Jesus. Stop shoving shit down our throat.
scientists hate this local new yorker @jbarnes
ATGCTCTTAGGTCTAGATCTATGGAACTCAGACTG
piru @pirepiro
Did…did you just dox his genetic sequence?
Black Widow, Baby @NatashaR
scientists hate this local new yorker @jbarnes
“you threatened to stab me in a fit of rage” and??? im literally vaccinated the cdc says im safe to be around
scientists hate this local new yorker @jbarnes
i think that’s all perfectly self-explanatory, natasha.
Notes:
the acdec kids: we're all loser nerds here
peter, nodding: yeah. we're all in advanced classes, read textbooks for fun, deadlift a couple tons, and love doing extra credit
the acdec kids:
the acdec kids: hey what was that one in the middle-mj is learning about feelings. pray for her.
percy is tony's feral dog. i do not take criticism. see Rumlow Incident for proof.
also, save the children and operation underground railroad are real organizations, and those are their real twitter accounts! you guys should check out their work
bucky: so trust your partner-
somebody: literally how does that connect to you shooting that man??
bucky:
bucky: i trusted my partner wanted his ass dead.plumbing baby. goodbye.
Chapter 40: Halloweenie 2: pumpkin
Notes:
(See the end of the chapter for notes.)
Chapter Text
Peter blamed Flash.
They all blamed Flash.
Third period had been going fine—Ned and Peter had been happily ignoring their teacher go on about Andrew Jackson’s love affair with the Presidential veto power, drawing little stick figure sketches of their halloween costumes, when Flash scoffed low in his throat. The two of them had ignored him, as per usual, but he’d drawn the attention of Cindy and Charles, sitting on either side of him.
“That’s the stupidest fucking thing I’ve ever seen,” Flash said under his breath, casting another look at the paper between Ned and Peter.
“Don’t be a dick.” Cindy snapped quietly. “What’s your problem, dude?” Charles asked defensively.
“What are you two gonna do, trick-or-treat and go to bed at eight?” Flash asked mockingly, ignoring Cindy and Charles.
Ned, after a moment, looked up at Flash. “Why, you angling for an invite?” He asked boredly.
“Fuck, no.” Flash said with a sneer. “Just wondering when you’re gonna act your age. I mean, Jesus, I get you two aren’t invited to anything, but damn.” He leaned back in his chair.
Peter frowned. “There’s nothing wrong with having a Halloween party with just your friends, Flash. Piss off.”
“Oh, it’s a party, is it?” He mocked. “Christ, Parker, you and your two friends plus your Aunt isn’t a party.” Flash spoke slowly, condescendingly. Then, “This is the reason nobody would fucking miss you.”
Silence.
Peter didn’t reply, his frown just getting deeper. After a second, he just looked down, not bothering to respond to Flash. Under the table, Ned gave his arm a quick squeeze in solidarity.
AcDec practice isn’t any better. Despite their best attempts, they can’t get Flash off the team. The majority of the things he’s done are brushed off as accidents, or it's a typical case of their word versus his. Mr. Harrington can only do so much.
“Eugene. Pay attention.” MJ snaps after her third ignored prompt.
He looks up at her from his phone. “Jesus, calm the hell down. Just responding to an invite.”
“I don’t care.”
Flash rolls his eyes at her. “Don’t be a bitch just because you didn’t get invited to anything.”
Under the desk, Peter’s fist clenches so tightly his knuckles pop. Ned stands up, slamming his hands on the table. “Don’t call her that.”
“Fucked up, man.” Abe agrees.
He remains unbothered. “God, please. I get it, none of you got invited anywhere, you’re all pathetic and nobody wants you around. No need to take it out on me.”
“Get out.” MJ’s voice is hard.
Flash goes easily, slinging his bag over his shoulder. “My driver’s here for me anyways. I have a party to prep for.” With a mocking grin, he’s gone.
“I hate him.” Sally says under her breath. A wave of quiet agreement follows from everyone but Peter, who’s staring down at the ground. MJ looks over at him. “Flash is full of shit, Peter. You know that.” Her voice was, even by her standards, gentle.
Peter, where he was hunched into his sweater, nodded. “I know.” He said easily. He looked up at her, and there was something uncharacteristic in his eyes. “But sometimes…I really feel like making him regret being such an ass.”
MJ stared at him for a long moment, something nonverbal passing between them, and, slowly, a smile crept over her face.
Abe, from his spot across the empty classroom, shuddered.
“Peter,” She breathed. “You certainly have your moments.”
For the first time that day, he broke out into a small smile.
They had dragged the entire group along, abandoning the rest of practice in favor of walking to the nearest subway station and taking it a few blocks north, then walking in almost silence into the Stark Tower lobby. Peter waved to the receptionist, who gave him a smile as he took them all into the elevator.
“Where is everyone?” Peter asked the ceiling.
“Boss is working the 92nd floor, Ms. Romanoff is in the 91st common room with Sergeant Barnes, and Vision is in his apartment on the 93rd trying out a new recipe.” A pause. “He invites you to come taste test once he is finished. Colonel Rhodes, Ms. Potts, and Commander Jackson are all out at the moment.”
Somebody makes a disappointed noise, and Peter blindly elbows them. “Thanks, Fri. Can you take us to Mr. Stark?” He blinked. “Actually, wait, no—to the 91st, please.”
“Of course.” The elevator begins to move upwards, and MJ nods at Peter. “Get Barnes onboard. Smart.”
He sends her another blinding smile. Ned is pretty sure he’s the only one who notices the faint red that appears on her face.
The doors open to reveal Bucky and Natasha sitting on the couch, looking displeased at the television. On it, somebody lets out a guttural scream, and there is a sickening snap sound. Bucky, who’s laying upside down with his knees over the back of the couch, scoffs. “Please. The blood would not have gotten that far.”
Natasha takes a bite of a piece of licorice and hums. “The first part wasn’t too bad, though. Creative.” Bucky shrugs. “Sure, but not original. Did that back in ‘75.” She makes a vaguely interested noise before turning to the group, still standing in the elevator.
“Hi.” Peter says. “We need your help.”
“With what?” Bucky asks.
MJ and Peter exchange looks before replying. “We want to make one of our classmates shit himself.” They say in unison.
Natasha pauses the movie. Bucky sits upright. “Say more.”
Peter drops down to sit on the carpet, the rest of the AcDec team following. “So, basically, Flash is being a dick again—”
Bucky leans over and whispers into Natasha’s ear. “Little transphobic bastard, Peter’s classmate.” She nods solemnly.
“—and he was making fun of me and Ned for not getting invited to any Halloween parties, I guess? Not really sure. As if he’d know, anyway. But we’re getting really tired of his shit.” Peter continued.
“He laughed at my school paper segment,” Betty added quietly. Abe put a hand on her shoulder and nodded. “She worked really hard on it. He also broke my nitrogen cycle model.”
“I was working on an art project during study hall, and we got in an argument so he dumped water all over it.” Cindy said with a frown. “He keeps saying really nasty stuff about how I dress.” Sally recounted next, a little furrow in her brow. Charles crossed his arms. “He mocks my speech impediment. All the time. He tried to get me kicked off the team because I ‘couldn’t properly answer questions’.”
“It stopped once I got the administration involved, but he used to grab me all the time. Like, my waist and my hips, and he’d make all these jokes about how he’d do anything to get with me.” Cindy said after a minute.
“He knocks over my lunch tray all the time. Says ‘I don’t need anymore food’.” Sally gritted out.
“The less said about the race jokes he makes about me and Michelle, the better.” Abe said flatly.
“He finally stopped deadnaming me, and telling everyone my ‘real name’ because he got suspended. After that, he switched to calling me Penis Parker.” Peter added. “I don’t even want to get into what he says about my parents. Today, he told me nobody would miss me.”
“He bothered me and my homecoming date for weeks about going out with him. When she told him she was a lesbian, he said he’d still fuck a lesbian.” Betty said softly.
“And today, he told all of us that we’re pathetic and nobody wants us around.”
Bucky and Natasha, who’s eyes had narrowed more with each statement, stood up, something burning in their gazes. “Alright, then.” Natasha replied evenly. “Let’s do something about it.” She looked at Peter. “He was talking about Halloween parties, you said?”
–
They went on a recruitment tour.
First thing, up a floor to the labs, where Tony appeared before them covered in grease and holding a blowtorch. He looked at them, lined up outside his door, two Russian ex-assassins and eight teenagers with a grudge, and flipped up his welding mask.
“What are we doing?”
After Peter told him more about Flash, Natasha had to restrain him from sending out the Iron Legion. Eventually, though, he heard them out and gleefully set to work on their plan. “The company can wait. Pepper will support me.” Was all he’d said, stripping off his protective gear.
Next, Bucky, in a definitely illegal move, took them all to a building that Cindy didn’t even know existed. There was no signage outside, not even a building number by the door or on the curb. He led them through all seven insane steps of security before barging into the bullpen.
The first person Cindy recognized was Mal, who she’d gone monster hunting with almost exactly a year ago. She wasn’t dressed like a Furby this time, though, instead in a nice pair of pants and a blouse. Next to her was the woman Cindy vaguely remembered to have gone off with Sally—the two occasionally sent each other Pinterest hairstyles—in a pencil skirt and flats. They both looked up from the computer in front of them. “Hello,” The woman said, surprised.
“Hi, Ms. Bridgette!” Peter chirped. She smiled warmly at him and stood from her desk. “How can I help you?”
“Revenge plot.” Natasha said.
Bridgette’s lips parted and her brows raised. Then, she leaned over and pressed a button on the underside of her desk. A door on the far side of the wall swung open. “Lee and Spencer are in the biolab. If you’ll go fetch them, Sergeant Barnes, I’ll get Ross and Dan.”
Bucky nodded and walked down the hall. Bridgette went the opposite direction, disappearing up a set of stairs, leaving the rest of them in the middle of the bullpen with Mal, who gave Cindy a little wave.
An elevator opened to their left, and Bridgette walked out, accompanied by one man in a wheelchair and another holding a giant stack of papers. “Hi, Dan.” Charles said from next to Cindy. Abe, on the other hand, looked at Ross for a long moment. “You finally got the blue dye out.” He noted. Ross gave him a thumbs up, and Dan waved.
Bucky returned to the bullpen a minute later, two people in lab coats with respirators around their necks following him. The first—who Cindy only recognized out of costume due to their sheer height—was pulling off a pair of elbow-length rubber gloves. Next to them, though, was somebody new.
He was wearing a simple tee and brown pants under his coat, and his hair was a striking, deep red. “Uhm,” He said, looking at the assembled group.
“Hi, I’m Peter. These are my friends, Cindy, Abe, Sally, Betty, Charles, Ned, and MJ. We need some help.” The last part was said to the group as a whole.
Mal leaned back precariously in her chair. “How long will it take?”
MJ shrugged. “An hour. A couple days. Depends on your commitment to the bit.”
“It’ll help me avoid work?”
“Yes.”
“I’m in.”
Ross and Dan were immediately on board upon hearing they could put off work, and Bridgette was agreeing upon hearing the reasons they needed help. Lee and the second man—who introduced himself as Spencer—only agreed once they found out the specifics.
“I’ve been waiting to do something like this.” Was all Lee had said.
The last place they found themselves was a Target in Hell’s Kitchen. By this point, it was getting late in the evening, the sun dipping low on the horizon. The store was nearing closing hours, patrons slowly emptying out, except for the few camped out in the Starbucks waiting for their seasonal drink. Cindy, Abe, Charles, Cally, and Betty had all immediately drifted off to get in line.
“Guys. The plan.” Ned reminded.
Sally pointed at the blackboard menu. “Pumpkin spice.”
“It’s five-thirty.”
She pointed again. “...Drink.”
Ned sighed and let himself be dragged away by MJ and Peter. The three of them followed Bucky (Natahsa was lost to the allure of the pumpkin spice) down the aisles to the near back of the store, where two men were standing in the middle of the candle aisle. The first was dressed in a button up and slacks, a tie loose around his neck and his sleeves rolled up to his elbows. He held a cane in his left hand, and a candle with his right. He was gesturing with both to the other man, who was wearing a too-large jacket over a sweater.
“—April Showers is more Spring, though.” The man with the cane said. “And Pineapple Cilantro should burn.” He held up the candle for emphasis.
“Oh, for sure.” He held up two candles for consideration. “Summer Storm and Evergreen Mist.”
He received a squint behind red-tinted glasses. “Yeah, you’d like those two.”
“What’s that supposed to mean?”
“Nothing. Hello.” The man with the cane turned to the group. Bucky had already abandoned the three of them to make his way to Percy, stopping in front of him and adjusting the collar of his jacket. “Thief.” He said under his breath. Percy just smiled at him.
“...What are you guys doing?” Ned finally asked.
Percy held up the two candles he was holding. “Candles.” The man next to him nodded. “Candles.” He repeated.
Bucky looked over at him. “Matt, I’m guessing?”
He received a nod. Then, “Hey, smell these candles.” He thrust out two directly into Bucky’s face. With the hand not resting on Percy’s waist, Bucky took one and smelled it, then handed it back to Matt and repeated with the other. “They’re nice.”
Matt hummed. “Yes. That’s what I thought.”
Bucky gave him a strange look, but seemed more occupied with holding Percy, tucked up to his side, than anything.
“Right. So, we need help.” Peter said. “We’ve already got everyone else on board.”
“You convinced my employees to skive off work, didn’t you.” Percy deadpanned.
“It was really easy?” Peter said weakly.
Percy sighed, and thunked his forehead into his boyfriend’s chest.
They all meet back up at the Tower—including Matt, who, quite honestly, Peter knows nothing about. He just put his candles (Dried Lavender Oak and Ocean Air) back on the shelf and came with them when Percy invited him. “It’s either this or back to the office.” Was all Percy’d said.
Matt was convinced.
There was a small incident where they’d almost forgotten everyone in the Starbucks. Luckily, as they were leaving, Percy had asked why all of Peter’s friends were with Natasha drinking seasonal fall drinks, and they’d quickly doubled back and collected them.
Now, they all sat in a loose circle in the living room. Percy and Bucky were intertwined on an armchair sharing a Pumpkin Spice Latte—well, Percy had no interest in caffeine, and simply ate the whipped cream on top, because Bucky apparently hates whipped cream. Tony, Pepper, and Rhodey were shoulder to shoulder on the loveseat, Peter on the floor leaning against Tony’s legs. MJ and Ned were next to him, and the rest of the AcDec team was scattered around them. Mrs. O’Leary had made an appearance, claiming the couch with Natasha and Matt.
At one point, Rhodey, taking a sip of his frappuccino, wondered aloud, “Do you think we’re going too far?”
Peter’s face was shadowed. “I want to see him regret.”
Pepper leaned over Tony to whisper, “Flash called MJ a bitch today.” Rhodey just nodded. “Rescinded.”
The success in planning was…varied.
“Wait, why do you even own that building?”
“I saw it and decided ‘oh, that’s creepy as hell’, and pushed buy.”
“...Tony, you are the most dramatic person I’ve ever met.”
“Thank you.”
“Okay, does anybody have any horrific and traumatic injuries we can use for this part?”
Five hands went up.
“Fantastic. Thank you.”
“Wait, wait, why do you have a fake blood recipe memorized?”
“Ugh, God forbid women have hobbies, Abe.”
“Sorry, Sally. I’ll take the sexist points on that.”
“Hmmph.”
“Are we concerned about him having a heart attack?”
“No.”
“Nope.”
“Not really.”
“That’s the ideal outcome.”
“Cool.”
“I can get the actual Reaper here. Scythe and all.”
“I’ll keep that in mind.”
“Okay, I checked his Live. He’s going to Ella Mackebon’s party—he thinks showing up on time is for dweebs, so he’ll get there at about 6:30.”
“Based on his home address and the average walking time…plus traffic…he’ll leave his house about 6:15. He won’t drive, the streets will be too busy.” A few clicks. “There are three possible routes he’ll take. We can block off this intersection here, and there’ll be a Youth Group activity scheduled in this park.” Another few clicks. “He’ll walk past this point at exactly 6:23.”
“...We should hang out more often, Dan.”
“Thanks, Abe.”
It all went down on Halloween night. It was dark out, a new moon, and the streets were alight with young voices and quick feet. Flash Thompson, dressed and ready in a crisp suit, the exact color match to the one Elon Musk wore at his recent conference, walked down the sidewalk, scrolling past the first couple of stories from Ella’s party. There was a decent amount of people there, so he figured it was time for him to show up.
As he counted the people visible in one of the photos, he glanced upwards at the sidewalk to make sure he didn’t miss the street. There were less and less trick-or-treaters out the further he got, until eventually, he was practically alone.
There was somebody standing on the fire escape of the building next to him. Flash jolted, taking an unsure step back as the Devil of Hell’s Kitchen emerged from the shadows. “You shouldn’t be here.”
Flash opened his mouth, then shut it. “I—what?”
“It’s dangerous here. Turn back.”
“What? It’s—I’m—” Flash turned to the street sign, ready to point out he wasn’t even in Hell’s Kitchen, but when he looked at the sign, it was blank. He stared, then swiveled back.
“Turn around.” The Man Without Fear intoned. Then, he was gone.
Flash stared at the empty fire escape, then shook his head. It was fine—it was Halloween, people were everywhere. He’d lived in this city his whole life, he knew what places to avoid. This wasn’t even Daredevil’s territory, anyways. He didn’t know what he was talking about.
(“...Is it wrong to use revolutionary illusionary technology to fuck with a teenager?”
“Absolutely not, my company, my rules. Outta my way.”)
(“Holy shit, Mr. Murdock, how did you get Daredevil to do this?”
“...”
“Oh my God.”
“...”
“You’re having sex with Daredevil!”
“What?”
“Don’t worry, Mr. Murdock. They thought I was dating Spider-Man for months.”
“How is that the same?”
“...”
“...”
“Holy shit—”
“Wait—”
“You’re, like, twelve!”
“You’re blind!”
“...Peter.”
“What, Percy?”
“...”
“Oh.”)
Flash spun on his heel, knuckles white on his phone, only to slam directly into somebody else. He staggered back, looking upwards at the looming figure. They stared directly forward, over his head, pale-clear eyes hollow, ringed with bruise-like shadows. They looked like all the color had been drained from their face, from the nigh translucent skin to the ash-blonde hair. The cold October wind snapped at bare arms and through a thin, ragged tee. It was freezing out, but they didn’t seem to notice.
Slowly, they looked down at him. “You shouldn’t be out here alone.” They said with a frown.
“I’m—I’m just on my way to a party.” Flash got out.
They regarded him a moment more before looking upwards at the moonless sky. The movement bared their throat, displaying a wide, deep scar across the base of their neck. “Run, then.” They didn't take their eyes off the sky. “Don’t stay out here.”
Flash scrambled backwards.
(“Wow, that makeup look is good. You look like a corpse.”
“I am not wearing makeup.”
“...Jesus.”)
(“Aren’t you cold?”
“I grew up in a place so far north that, as a child, we were legally required to carry a rifle to fend off polar bears. No, I am not cold.”
“...Hm.”)
Flash rushed to cross the street, his hands trembling as he reached the park. He turned a corner, ears and nose growing numb from the cold, mind racing, unable to get the Devil’s words out of his mind.
Turn back.
He glanced around, looking at street signs. None of them made sense. Some were empty, some had directions for streets he’d never even heard of, some of them didn’t even seem to be in English. A dog barked in the distance.
Why didn’t he recognize any of the buildings?
“You look lost.”
Flash shrieked.
The man who’d spoken, sitting on a bench by the park entrance, was looking up at him. “First time here?”
No, Flash wanted to say. But, for some reason, he couldn’t. It didn’t feel right. More barking, from somewhere in the park behind them.
The man just blinked. “Unfortunate.” Was all he said. The streetlamp above him fizzled on, then out, then on again, illuminating his face. His hair was pulled back, exposing the starburst of scars that resided on his temple and cheek, trailing down his neck. Flash tried not to stare.
He failed.
The man seemed to follow his gaze, his fingers—dark, the tips looked blackened, blue with cold and dark with rot— coming up to touch the side of his face. “Dangerous world out there.” Was all he said.
Turn back, turn back, turn back.
How could he turn back if he had no idea which direction he came from?
Flash stared down the street, face tight. He went for his phone to try and pull up a map—Jesus, he’d lived in this city his entire life, how did he get so lost— but was faced with nothing but a black screen, no matter how many times he tried to wake it up. “Do you—”
The man was gone.
(“Jesus, Peter, did you have to yank Dan up into a tree?”
“Nah, it was cool. Don’t worry about it.”)
Another bark, this time close. A huge mastiff came tearing out of the bushes down the block, fur dark as the night and eyes red. Something dark and sticky coated its maw. It turned to stare at Flash, lips pulling back to reveal long, curved teeth.
A low growl reverberated down the street, hair-raising and unnatural. It dropped low, eyes never leaving Flash.
He ran.
Flash abandoned all sense of calm, turned on his heel, and ran.
It chased him down the street, tearing after him, massive paws thudding on the sidewalk loud enough to hurt his ears. His breaths came out in sharp pants, lungs burning. Why was there nobody here? It wasn’t that late—there should still be people out. Why wasn’t there? Where had they all gone?
It was gaining on him.
All the buildings were locked up. Every single one he ran past was closed, the lights off and curtains down. His chest started to ache, lungs burning.
(“Yes. Run. Let’s see how well that varsity basketball training you love to talk about helps you now.”
“Run faster. Go on.”
“Yes. Yes.”)
The very first one he saw with the door cracked he lunged for, slamming the door shut behind him and leaning up against it. On the other side, heavy, fetid breath sounded, four paws and claws scraping across the concrete outside. Flash wasn’t sure how long he stayed there, pressed up against the door and trying to catch his breath. He could still hear it, the occasional snuffle and low growl when he moved. The dog stayed on the other side of the door, waiting.
(“I’m buying your dog a pizza.”
“Go for it.”)
There had to be another exit, right?
Turn back, run, then, dangerous world out there—
As quietly as he could, Flash stepped away from the door and ventured further into the building. It looked to be some sort of office, or, had been—the furniture was covered in sheets and a thick layer of dust. The windows were dirty and some were shattered, jagged glass edges reflecting the flickering street lamps outside.
“Hey?” Flash called out. There was a chance there was some kind of contractor or cleaner in here—someone he could talk to to find the fire escape or back entrance. The wood groaned under his feet as he walked further into the building, echoing throughout the building.
He slipped, barely catching himself on a door frame, hitting his shoulder on the wall. “Shit,” He muttered, looking down. “Who the fuck spilled—” He cut off as one of the streetlights flickered on, illuminating the puddle under his feet.
Crimson. Half dried and coagulated in places, seeped into the floorboards.
Fuck.
He was frozen, his own heartbeat like a drum in his ears. Then, he heard the footsteps.
Heavy, loud, accompanied by a rasping, dragging noise and the creak of a door, coming from the other side of the building. Flash staggered back against the wall, pressing himself into a corner, then dropping down behind a piece of furniture. It got louder, each step in tune with his racing heart. Flash dove under a sheet-covered table, his cheek pressed to the old floorboards. He caught sight of a heavy pair of boots, heart leaping up into his throat. Another pair of shoes followed—limp, dragging. The first person was pulling the second—unconscious? Dead?— along, to Flash’s horror.
They passed the doorway, disappearing down the hall, and Flash squeezed his eyes shut.
Everything halted, silent.
“What’s this?” The voice was low, raspy. Then, a breathy laugh. “Oh.”
He felt like throwing up.
The yell was sudden. “Who’s here?” A beat. “I can see your footprints! Come out!”
Flash stayed, immobile.
A soft thud, something heavy being dropped. “Oh, don’t be like that.” That same voice cooed. “Come on out.” They started moving again, in the opposite direction— thank God—- up the stairs. Searching.
After a minute, he crawled out from under the table, and peered around the corner.
There was a body slumped against the wall.
Flash stared, horror pumping through his veins. Black hair, loose and matted, and an outstretched hand. A pool of blood around the head, and a large, open wound on the side of the face.
The wound pattern looked familiar.
Dangerous world out there.
No— no. That was stupid. Just a coincidence. There was no way this was the same person. Impossible. Christ, he needed to get out of this fucking building. Flash crept along the wall, ears straining for any sort of footsteps, when he heard the creaking above his head. Slowly, he looked up.
Somebody was standing on the floor right above him. And moving, towards the stairwell. There was nowhere for him to hide—Flash looked around, then made a break for the staircase, going down the stairs as quickly as he could without being heard. As he went down, the flight of stairs directly above him groaned and creaked, and he barely avoided being seen. He couldn’t even think straight, his blood roaring in his ears. The basement floor was concrete, quieter than the old floorboards on the ground and second level. Flash went down the empty, unpainted hall, checking over his shoulder every few steps.
That’s when he heard the groaning.
There were cages. Metal bars ran from floor to ceiling, sectioning off the far wall. Somebody was curled up on the floor against the bars. A flash of pale hair and skin caught his eye, and he inched forwards.
They were drawn in on themself, as if trying to conserve warmth, but it did little to hide how their neck was split open, ear to ear, blood staining ash-blonde hair and a thin shirt with bare arms. Empty, frozen eyes stared up at the tiny crack in the corner of the ceiling, where a sliver of the moonless sky could be seen.
You shouldn’t be out here alone. Don’t stay out here.
Staring up at the empty sky.
Flash clapped his hands over his mouth to keep him from screaming. Daredevil was right, he should have turned around, he should have gone home.
Like a nightmare, following him, the floor began to creak again. The hooded man, heavy boots, dragging. Flash scrambled under the stairs, the only place that could cover him. He crouched low to the concrete, wedging himself as far in as he could.
The limp body of the man from the park was tossed into one of the cells, next to the blonde. Then, the man walked further down the hallway and flipped a switch, lights flickering to life and illuminating the hallway, revealing rows and rows of cells. He stopped at the nearest one to Flash, right in front of him. There were two people in it, Flash could now see. Slumped on opposite sides of the wall, curled up defensively against the cold, one with black hair and the other with brown. The hooded man slammed something sharp against the metal bars, the loud, jarring noise stirring the two. Then, he tossed something in the middle of the floor. It clattered against the concrete.
A pair of bleary eyes looked up at him.
“How much do you want to live?”
“What?” The more coherent of the two in the cell croaked.
“You’re hungry, aren’t you?”
The silence was oppressive, a horrified look shining through the copious amounts of grime and blood on the person’s face. “You— no.” But there was something desperate in their eyes.
The man just shrugged and turned away, walking back up the stairs.
Flash watched the two men in the cell stare at whatever had been dropped into the cell. Then, at the same time, they both lunged. The one with brown hair was clearly injured, a hand pressed to his side, movements sluggish and weighted and easily beat. The other man snatched the knife— it was a knife, long and serrated—from the floor.
The brown haired one scrambled back on the floor as the other stood, swaying, fluorescent lighting catching on the blade. “Please—I—-”
The other lunged, falling upon the other man and slamming his head into the concrete with a brutal thud. He raised the knife high and brought it down, again and again, through the screams and weak attempts to push him off.
Four things would forever be ingrained into Flash’s mind.
One—the sound of sawing, overlapped by agonized sobs and pleads.
Two—copious amounts of blood flowing freely towards a drain in the corner of the cell from a stump.
Three—ripping, tearing, and chewing.
Four—the man, crouched over the body, holding a sawed off arm and blood running down his lips, dripping off his jaw.
Everything was overtaken by a grating static, narrowed down to a pinprick. Flash staggered upwards, out from his hiding spot, overcome by the urge to get away. He couldn’t even think as he ran for the stairs, hearing those screams, again and again and again.
A hand wrapped itself around the back of his neck.
Flash screamed.
“Hiya, Eugene.” Was breathed directly into his ear. “Thought you had a party to go to.”
“Cindy?” He got out. “Jesus, get the fuck off me, you weirdo—” Her hand tightened, and he cut off.
“You really need to learn your manners, Flash.” She tutted.
“Cindy, let go—I—-I need to—”
“No, I don’t think so.” She said quietly. “Honestly, I’m a little surprised. Would’ve thought you’d enjoy some alone time. You’d do anything to get with me, after all.”
“We’re alone because there’s a couple fucking corpses here, Cindy.”
She hums. “Oh, that one’s still alive, actually.” She says, pointing at the man in the cell with the blade. He seems barely coherent, chest heaving, adrenaline fading. “He’s done well so far.”
“He–you—” Flash can’t even speak.
“He’s one of the fun ones.” She continued, hand sliding off his neck as she drifted towards the cell. “Violent.”
Flash tries not to look. The scent of blood is overwhelming, on the floor, the knife, the man’s face, the cooling corpse next to him.
“You did this.” He finally whispers.
She winks at him over her shoulder. “A girl’s gotta have hobbies, you know.”
He takes a step back. “You’re insane.”
“Sanity is fickle.” She dismisses. “You know what isn’t?” Something gleams in her eyes. “Friends.”
Flash whips around, where two people stand right behind him. The first—the hooded man from before— Abe, with Betty next to him. “Let’s go on a trip, Flash.” They each seize one of his arms and begin to drag him down the hall, concrete floors, walls, ceiling, no windows, Cindy trailing behind him. So he can’t run, he realizes.
They take a turn and stop in front of another cell, this one wedged into a corner.
(Back in the first cell, one man covered in fake blood, clutching a prop knife, is hunched over another with a prosthetic arm ripped off.
As soon as they're out of earshot, Percy muffles a laugh into his shoulder. Bucky grins up at him. “I love how good you are at pretending to be insane.”
Percy, one knee on either side of his hips, leans down and kisses him. “I love how good you are at pretending to be in complete agony.” He returns. Bucky’s hand comes up to tangle in his hair, pulling him back down when he breaks the kiss. “You taste like corn syrup.” He murmurs against his lips. Percy laughs again.)
There’s a man in this one, one wrist cuffed to the metal bars. Flash can’t help but stare—he’s covered in scars, his skin burned and lumpy, pulling tight in some places and disgustingly loose in others. “Acid.” It’s Parker, crouched against the other side of the bars, poking at the half-conscious man. “He’s not much fun these days, though.”
“There are plenty of people for you to test your stuff on, Peter.” Michelle says, leaning against the wall near him. “Yeah, I guess.” He sighs, stands. “Hi, Flash.”
“What the fuck is wrong with you people?” Flash screams.
Betty makes a little noise from his left. “Well, you got me thinking. You’re right—my piece for the paper really was—how did you say it?” She snaps. “Right. It really was God-awful boring shit that I couldn’t pay people to read. I decided I needed something…better, to write about.” There’s something shining in her eyes. “Everyone knows that people love tragedies.”
It takes a second for the implication to sink in. “You’re fucking crazy.” He snaps. “All of you.”
He’s shaking. A sudden chill sweeps through the basement, slicing through his clothes like needles, straight into his flesh.
Parker looks at him. “Well, I just figured, since I’m such a useless nobody whose life really isn’t going anywhere, I should at least try and contribute to the chemistry field and test out a few of my ideas before I kick it.”
Sally is giving him an off-kilter smile. “You really got me thinking when you informed me that wearing leather suits me—cowskin, and all. I really do like the look of leather, though, but then I realized that the same result can be achieved from…other materials.” She’s staring down at the man in the cell. She’s holding a scalpel. “Curing and tanning it isn’t that different, really.”
Something in his stomach rolls, crawling up his throat.
“And you were right about the fact that my speech impediment is so embarrassing that I shouldn’t subject people to my talking.” Charles says from the stairs. “I get a live audience to practice my speech therapy exercises, and, afterwards, well…they’re not really around to have to go through it more than once.”
Abe is mindlessly playing with the strings of his hoodie. “When you said I’m a pathetic, weak bitch that can’t even do a push-up, it got me thinking. Moving these guys around has really built up my core strength.”
“And since I’m an unlovable leach that belongs in my mother’s basement, I figured I could spend that time down there doing some planning. Turns out, impersonating somebody and convincing people to meet me places is very easy.” Ned volunteered from behind Charles.
MJ pushes off the wall to stand up straight. “Your point about me being a bossy, stuck-up cunt who’s only joy in life is making other people miserable made me realize it’s more constructive to put that energy elsewhere. These ones do whatever I tell them to.” She muses with a smile, poking the man in the cell with the toe of her sneaker. “Like…sawing someone’s arm off and eating it because they’re just so hungry.” She doesn’t break eye contact with him. He wants to look away, desperately so, but can’t.
Cindy shrugged. “And, really, it’s too easy. They clearly were asking for it.” She says, eyes fixed on Flash’s face. “If they don’t want us to treat them like this, they should really not flaunt themselves so much.”
Flash staggers back.
“All of you are sick.” He spits. “All of you.”
Parker frowns. “But, Flash, we just took your suggestions.” He says it so easily, taking a step closer to Flash. “Just because we’re pathetic and nobody wants us around, doesn’t mean we have to take it out on you.” He points out. “I mean, we didn’t involve you at all. You came to us.”
“That’s not what I fucking meant, and you know it.”
“Well, then,” MJ draws out. “What did you mean?”
He opens his mouth, closes it.
They all exchange looks, amused, like this is some sort of game, like it’s funny.
“Do you want us to stop doing this, Flash?” Charles asks.
“Of fucking course I do, you psycho.” He snaps. “The hell kind of question is that?”
Abe hums. “Well, I guess you’re right. It is getting a little boring.” Another moment of silence, another round of shared looks. Then, Abe hands Parker the knife he was holding and walks down the hall. Sally, Betty, and Charles follow him. There’s something light, eager in his voice. “We can do one last test! Number 18 can dissolve bone, yeah?”
A wave of visible excitement ripples over them.
“Should do, yeah.” Parker calls back. He opens the cell the burned man sits in and leans over him, studying.
The four come back dragging— Jesus, dragging bodies. The two Flash had already seen, talked to, he thought— and two more. The first, a Hispanic woman in a pencil skirt and blouse, stomach sticky with blood. The second, a red-haired man with a bullet hole between his eyes.
(“Spencer, are you on board?”
“Can I sleep through it?”
“Absolutely.”
“Delightful. Sure.”)
They leave the four in an uncaring pile in the middle of the hallway. Then they make a second trip and bring back a man, hair matted down with blood, and a woman with a yellow sweater and blue lips. Then the man—fuck, his arm really is gone, sawed off right in front of Flash—from the first cell.
The last one they bring is the one who did it, his mouth and chin still bathed in smeared blood. His hand, once clutching the blade, is slack, his eyes rolled back in his head.
“Is he still alive?” Michelle asks, leaning over to get a look at him.
“Yeah, just out.”
She tuts, snatches Abe’s knife from Peter, strides over, and grabs a fistfull of hair, wrenching his hair back. Michelle slits his throat ear-to-ear in one clear motion, leaning back to avoid the spray of blood that follows. Flash stares, frozen.
(“MJ, you want to be the one to kill me?”
“Swear not to get ‘blood’ on me?”
“Yeah, I can make it avoid you.”
“Sure thing, then.”)
Parker seems to have finished staring at the burned man in the last cell, uncuffing him with a key attached to his belt.
“Please,” The man rasps. “Not again.”
Parker just pats him on the side of the face. “Oh, don’t be a baby.” He admonishes, pulling him out of the cell with Ned’s help. Flash gets a closer look at his face, the mottled, deep tissue burns that look absolutely agonizing.
Cindy stabs him. Unlike Michelle, she doesn’t bother to move out of the way, not even blinking as the warm spray hits her dead on. Instead, she just wipes her mouth with the back of her sleeve. The eight of them stand in a circle around the pile, clearly thinking.
Flash, his heart thudding in his ears, skirts around them for the exit. He’s almost made it to the stairs when Sally’s voice stops him cold. “Do you think they’ll believe you?”
He freezes, caught. “What?”
“That we did this.” Abe continues for her. “I mean, us? Eight honor roll students, not a single detention between us? All our teachers love us, we have more community service hours than any other school organization, half of us are on the student council…”
Michelle smiles at him. It’s an ugly smile. “And, really, Eugene—we have Ivy Leagues to get into, perfect records to keep, recommendation letters to get. Did you really think we were going to let you blab?”
His heart leaps up into his throat. “What—I—I won’t, I swear—”
He blinks, and Parker is right there, reaching out for him, and all the others turn to smile at him, and—
Everything goes black.
Giving out candy at Stark Tower is fun. It’s not that late in the night, really—everyone just washed off their makeup and the copious amounts of fake blood staining them all, and changed into their real costumes for the night.
Lee and Dan highfive, and Mal compliments them both on how “extraordinarily unnerving” they were.
“My dream job as a kid was to haunt people.” Lee says, scraping the scar wax off the very real scar across her neck, Dan doing the same with the ones on the side of his face.
(Peter had been concerned, at first, speaking to the two of them and Bucky.
“Are you sure this is alright? I mean, this stuff seems pretty traumatic…”
It was Lee, surprisingly, who spoke up. “Yes. I still try not to wear stuff without a high collar. But…doing something fun with it seems nice.”
Bucky and Dan had nodded, and Peter had smiled.)
They all met back up at the tower—Peter, MJ, and Ned had all had the separate but identical thought of dressing as Rosalind Franklin, Cindy, Sally, and Charles were the Wonder Pets, Abe was Phineas and Betty was Ferb.
Tony, continuing the theme from last year, was Pepper. She was Rhodey, and Rhodey was him. Natasha was dressed as Hawkeye, and Matt was an avocado. Percy and Bucky showed up dressed as Morticia and Gomez Addams—Bucky in an immaculately tailored suit with a sword by his side, and Percy in a high-necked black shirt and long black skirt, regrettably reporting that he didn’t have the cleavage for the dress.
Abe had to be resuscitated in the corner.
Strange showed up half an hour in. “I didn’t master the Mystic Arts to portal a shithead teenager face-first onto his bed.”
Tony had grinned at him. “You’re a willing accomplice.” Was all he said.
Strange sighed, but didn’t argue. He was, to Peter’s amazement, wearing a cheesy wizard hat.
Wade Wilson also made an appearance. Betty scrambled towards him, peppering him with questions and taking notes on his every word. Once she released him, he spoke with Percy and Bucky for a few moments before taking his leave. “I’ve got a thing.” Was all he said.
“Is he going to kill somebody?” Rhodey asked as he entered the elevator.
“Nah. He binges all the Lab Rats Halloween episodes every year with his favorite hot dog vendor.”
“Ah.”
“Thanks for pretending to be a victim to my extreme laboratory malpractice!” Peter called at his retreating back. Wade gave him a thumbs up as the elevator doors shut.
Hordes of kids of all ages came to the tower, seeking out the king sizes Tony bought by the case. Peter and his friends took great joy in handing them out—MJ dumped an entire box of Hershey’s on a girl who recognized their costumes. Matt took his leave to go back to his firm, where Foggy and Karen had already begun to hand out candy. Every time Peter looked back at Bucky and Percy, who were sitting right on the receptionist's desk in the lobby, a few yards away from the front door, Percy was holding another rose stem, the head cut off and laying at his feet. Peter wasn’t sure how Bucky managed it, but he respected the commitment to the costume.
Rhodey and Pepper had, very subtly, made their excuses to go talk to whatever random supervising adult they could find, surreptitiously nudging Tony towards Stephen whenever they had the chance. Natasha caught on halfway through the night, a devilish smirk appearing on her face as she joined in. At one point, she directed a young girl dressed as Bruce Banner to Tony, who immediately crouched down and listened to all her questions with rapt attention.
It was Pepper who got the photo of the fond look on Stephen’s face as Tony told her about the cool stuff Bruce did in the labs here. It was immediately circulated to everybody, excluding Tony and Stephen, of course.
Once the steady stream of trick-or-treaters fizzled out, the SWORD members left. Peter and his friends ended up taking over the living room and fought over the television remote in a manner reminiscent of a swarm of angry bees with peanut allergies and asthma.
MJ won, obviously.
Also obviously—to Bucky, at least—she caved to Peter’s pleas to watch ParaNorman, furiously ignoring Bucky’s cocked brow. “Go kiss your boyfriend.” She snapped under her breath as she passed by on her way to the kitchen.
“You know what? I think I will. Excuse me.” He stood up, ignoring her horrified look, and walked right over to where Percy was speaking with Tony, draping himself over his back, hands settling over his stomach. “Cara mia.”
Percy leaned back into him. “Mon cher,” He returned.
Bucky pressed his lips to the side of his neck, and, in one smooth motion, he bent over to secure an behind Percy’s knees, and stood, lifting Percy with him.
“Night, Tony.” Was all he said, leaving an absolutely stunned billionaire behind. Stephen, too, looked astonished. “Is that normal?”
Tony dropped his head into his hands. “For them? Absolutely.” He looked up at the sorcerer. “You know, when they first got back, both their faces were covered in fake blood.”
Stephen’s brows just about met his hairline.
In the living room, Cindy was staring intently at the floor. “I think I just had a sexuality crisis.”
“Cindy, love, you’re already bisexual.”
“I know,” She whispered. “That’s the strange part.”
Peter and MJ shared a look, and she slowly shook her head and simply turned on the movie. “How long until they’ll be normal again?” Peter asked quietly—oh, he was right next to her, okay. MJ shrugged, forcing her eyes forwards to the screen. “Fifteen minutes?”
He huffed out a laugh and she could feel it on her skin. “Probably longer.”
“Well, maybe you need to get your weird, gay, older brother figures under control.”
Peter snorted, reaching up and grabbing a blanket off the back of the couch. “Fat chance,” He said as he unfolded it. “Bucky insists that anything that keeps him more than five feet away from Percy is homophobic, and the only person Percy listens to, other than Bucky, is his mother, and Sally Jackson’s time is far too valuable for such a thing.” He tossed the blanket over his legs, curled up to his chest. “Besides, they’re so mutually obsessed with each other that they probably don’t even notice other people are in the room in the first place. It’s a little romantic, in a strange way.”
“Borderline obsession combined with an unflinching willingness to commit crimes at the drop of a hat for the other?” MJ sighed, looking upwards. “Yeah, a little.”
He grinned and held out the other corner of the blanket to her. “I know, right?”
Suddenly, MJ was tossed back to earlier that week, the rare flash of anger on Peter’s face when Flash was being a dick to her.
“But sometimes…I really feel like making him regret being such an ass.”, the efficiency with which he’d planned everything. The way he was smiling at her.
Her mouth went dry.
She stared at him for a moment too long—his stupid, fluffy hair, the hoodie he was drowning in that she was positive might’ve belonged to Tony, his freckles and his big, brown eyes—
“Yeah.” She said lamely, taking the blanket, spreading it over her lap.
He smiled at her once more, and they lapsed into silence.
They stayed like that the rest of the night.
Meanwhile, a floor above, Percy was curled up against Bucky’s chest, head resting on his collarbone. Bucky was running a hand through his hair, twisting fingers through the subtle curls that had emerged as he had let it grow out.
“Tony’s texting.”
Percy tilted his face up. “Mmh?”
“The urchins all sequestered themselves in the living room, and Pepper—superior being that she is—dragged the rest of them to Tony’s apartment. You know, to give the kids some space.”
“Mm, I’m sure.” Percy drawled.
“It gets better. Rhodey had a work emergency—you know how the Air Force is on Halloween at ten at night—and left. Then Pepper, in a shocking turn of events, needed Natasha’s help and they both had to leave.”
He could feel how Percy’s shoulders shook against him. “Tony and Stephen left alone?”
“Naturally.”
“Gods, I love Pepper.”
“Don’t we all?”
Percy made a small noise of agreement before shifting, drawing the blanket—that same crocheted one he’d draped over Bucky, all that time ago, when he was still a stranger in the Tower, fresh out of his first BARF session—high over the two of them.
Bucky stares down at it, and he remembers a reserved, curt Commander who’d been a sole judgment call against killing him, looming like a shadow, always a step behind Tony. The man who could have been his executioner, who’d sat him down and stared him down into eating triangle-cut sandwiches and taking a nap.
Sometimes, Bucky feels so incredibly in love he feels like he’ll drown in it. He’s laying there, squished up on his boyfriend’s couch, in his apartment that’s not really just his anymore, because that’s Bucky’s coat on the rack, that’s his book on the table, half the drawers are his, and though there’s only one indent in the mattress, its wide enough for two, because even in his sleep, Bucky can’t stop reaching out for Percy.
Percy’s head fits right under his chin, his legs right with Bucky’s, his breathing right with his heart. It’s like there's a space; an empty, dulled cavern that's been waiting to be filled for eighty long years. An aching, gasping desert that’s finally been graced with rain, enough to turn the sand into mud, the flood out the dunes, to feed the cacti until they can reach the clouds, but it’s been starved for so long it doesn’t know what to do with itself.
His rainfall, his beautiful storm.
“You know I love you, right?”
Percy’s head rests right over his heart. “How can I not?” Is all he says.
“Just making sure.”
Calloused hands—on the palms from weapons, on the tips of the fingers from music—come up to his face. “You know your pupils dilate when you see somebody you love?” His thumb brushed under his eyes. “It’s how I tell you’re looking at me. Usually, I have to guess with other people. Not you.” Lips brush against his. “Never you.”
His phone buzzes a few more times—probably Tony having a gay stroke, or something—but Bucky ignores it in favor of kissing Percy again. “Love you.” He repeats. Then, “Querida,” He adds.
Percy snorts. “Mon amour.” He returns.
Flash wakes up in his Halloween costume, face-down on his bed.
When he looks outside, the sun is slowly beginning to reach upwards over the city. There's a dozen texts messages and missed calls, all from people he’d told he was going to the party.
He sits up in bed, scrolls through them with a frown. What the hell had happened—
Oh, God.
Flash wouldn’t look any of them in the eyes for the next week.
He didn’t even speak to them for two, and certainly said nothing against them for weeks after that.
It just might have been the most peaceful period the AcDec team had ever had.
Notes:
*shows up two months late* hi
here's 30 pages of bullying a transphobe/homophobe/creep
the AcDec kids coming to the wildest fucking conclusions just for the drama of it all is my roman empire
peter: i need you to pretend to be the murdered victims of my friends and i
the entire SWORD team: coolbucky when percy pretends to go completely feral and literally chomp his arm off: i am looking RESPECTFULLY
percy, calling wade: you want to traumatize someone?
wade: getting a plane ticket as we speakpercy bucky as morticia and gomez is healing tbh
tony: ok i need you to teleport this teenager who passed out from fear face-first into his comforter
strange, a simp: yeah okhappy halloween! be gay do crime!
plumbing baby. goodbye.
Chapter 41: christmas 3: theyre doing WHAT underneath the christmas tree?
Summary:
i have no explanation tbh
Notes:
(See the end of the chapter for notes.)
Chapter Text
The kettle whistled softly, spurts of steam leaking out as Bucky picked it up. He poured it over the bag and settled the lid of his mug over top of it, leaving it to steep. Leaning against the counter, Bucky exhaled, watching the twinkling lights wrapped around the fireplace. He was feeling restless, a little cooped up, which was strange, considering the sheer size of the Tower.
A part of him wanted to go out on a run, but a glance at how heavily it was snowing swiftly changed his mind—he could certainly stand the temperature, but, no matter what he did, the cold still seeped through his skin and settled in his bones, leaving a bitter taste in his mouth and painful whispers at the forefront of his mind. Instead, he wrapped one of the throw blankets around himself and curled up on the couch with the book he had gotten recommended to him by Vision. He wasn’t that far in, yet, but he’d been enjoying it so far. Both of them had been trying to expand their literary horizons, currently delving into a list of horror and fantasy books they’d collected. It was different from what he usually read, but in a good way.
Bucky flipped a page, the sound of the pad of his finger rasping against the paper oddly loud in the deserted common room. Tony was out on a conference in Tokyo and the Parkers were across the city, hunkered down against the storm. Vision, at the encouragement of Tony, had begun to make progress on his bucket list, and was somewhere in Dubai. Natasha…well, Natasha was doing something. Bucky had no idea what, and since she hadn’t shared, he hadn’t tried to find out.
SWORD had gotten a call from the WSC and had been sent out at the last minute, but, after discussing it, had decided to leave some of the team in New York, in case of the repeat of…whatever happened last year. Percy had taken Lee, Mal, and Ross, and left Dan, Spencer, Bridgette and Bucky to man the Hub, after much debate. Bucky wasn’t too worried about it—they were just there to escort a prisoner to trial, and the only reason the SWORD team had been deemed necessary was because very few others had clearance to know about the trial in the first place. Low risk, low stakes, and it would be over soon enough.
It did, however, result in him being alone in the tower for the last couple of days, which…well, Bucky liked solitude, that much was true, but he did miss everyone. He’s not ashamed to admit that mostly meant Percy. He absolutely did miss Tony’s company and talking to Peter, watching movies with Natasha and reading with Vision. The absent half of the SWORD team, too—Ross was funny in a crass way that reminded him of some of the Howling Commandos, Mal was sweet and genuine, Dan was easy going and friendly, and Lee…well, Lee was Lee, and Bucky meant that in a very positive way. He missed them all, but not like he ached for for Percy’s company, his warmth. Most of all, he missed waking up next to him.
Bucky always woke up first—at six in the morning, on the dot. And, for thirty minutes, he would do nothing but lay there, wrapped around his boyfriend, who, no matter how or where they fell asleep, always managed to find a way to cozy up to him during the night. Then, Bucky would tear himself away from their warm bed, go on a run with Mrs. O’Leary, and return and shower. The running water would always wake Percy, which Bucky still thought was hilarious, and the demigod would be slightly upright with a scrunched face and bleary eyes when Bucky exited the bathroom.
A single brush of Percy’s fingers instantly dried his hair, and, every time, Bucky would duck down and press a kiss to the crown of his head. And, usually, Percy would grab him and yank him back into bed, reminding Bucky of just how strong his boyfriend was, despite his leaner stature. Bucky never resisted it, falling onto the mattress, or onto Percy directly, with a soft laugh. On a good day, they’d have what seemed like forever to bask in each other's presence. Percy, still soft with sleep and surprisingly clingy, would bury his nose in Bucky’s collar, breathing him in, breath brushing over his skin. Bucky would settle his arms around him, metal and bone uniting to hold Percy, his thumb brushing the nape of his neck. Usually, Percy would fall asleep again like that, enveloped by Bucky, and he would stay perfectly still like that, giving his boyfriend every precious second of rest he could get.
Everything felt right, like that, their soft mattress and thick blankets, warmed to the core by his space heater of a boyfriend.
Even when gone, Percy made sure to call Bucky at some point during the day, late in the evening when he had hours to talk, if they were lucky, or a quick five minutes in between guard shifts, if they weren’t. Though Bucky loved to hear his voice, it would never be as good as holding him, as waking up next to him.
He sighed and flipped another page. There was an upside to this, though—Peter, Tony, Vision, Natasha, and the SWORD team were usually very distracting (so was Percy, honestly, but in a different and entirely welcome way), and, with their absence, he was making significant progress on his reading list.
The moment something in the air felt different, Bucky snapped to attention. Something cold had drafted in, like a window was open in the middle of the common room, ushering in wind and snow. He stood, backing away from the spot, eyes narrowed. A loud crack sounded, and he pulled out a knife.
There was somebody standing on the coffee table.
Long, white hair was braided with scarlet ribbon, trailing down their back and to their hips. They were dressed for winter, in numerous, thick layers, a dusting of snow still on their shoulders and hood. Long, pointed ears stuck out from the sides of their head, and when they turned to face him, he could see their eyelashes and brows, too, were white.
They hopped off the table, boots hitting the carpet and getting snow on the floor. “Hey!” They said excitedly. “Nice to finally meet you!”
Bucky didn’t lower his knife. “What do you want?”
His hostile attitude made them droop slightly. “I’m not here for anything bad, promise.” They brushed off their coat. “I’m actually here to help you out! You did me a big favor last year when you took Klaus down—he was a real douche to us magic users, and it really took the jingle outta my bell, you know? Things are way better now that Nick’s back, and I’ve been waiting forever to thank you, but, like, your world is so weird, I couldn’t get the spell to work until you guys reached a certain point in the year.” They looked out to the snowstorm visible through the window. “Pretty. Maybe the weather is why? Strange. Real strange.” They turned back to him. “My name’s Tinsel, by the way.”
Now that he could see them properly, he was struck with how similar they looked to the villagers they’d met last December, the blinding white hair and rosy cheeks.
His stance didn’t waver. “Excuse me?” Is all he said.
Tinsel ( Jesus Christ) bounced up on the balls of their feet. “I’ve been hanging out in this world for a couple of days, and, man, you’re having a bit of a rough time, huh? I mean, I read about the whole Winter Soldier thing you went through, and everything with the Avengers fighting and separating, and the brainwashing and the trial where that guy tried to kill you, and then you got kidnapped and all that, and then I was around here while I was catching up, and you’ve been, like, totally alone!” Tinsel rambled. “You did me, all of us, really, such a huge favor, and so I’m going to pay you back!”
Bucky was stunned silent. He…well, he wouldn’t say he’s had a rougher time of it recently compared to the last eighty years. True, so much has been awful, but he’s finally free of the trigger words, of the Soldier. He has a home, he has people who care about him, and he finally feels like he can atone. But, laid all out like that…
He frowns, and Tinsel barrels on.
“Being alone sucks! I can’t imagine having to go through that, and then just being by myself!”
Bucky was beginning to think there may have been a misunderstanding, here. Sure, he’d been alone the last few days, but that was absolutely not an accurate representation of his life—everyone just happened to be out at the same time. Hell, Bridgette, Dan, and Spencer were still in New York, they just hadn’t met up in person in the past few days while Bucky was apparently being stalked by a nosy magician named Tinsel.
He opened his mouth to speak, but they continued on. “So, don’t worry! I’ve got your back! This’ll fix things up, don’t you worry!”
Instant alarm bells.
“What are you going to do?” Bucky asked warily, his fingers tightening around the handle of the blade.
“Christmas magic, of course!” Tinsel enthuses. “You’re not going to be alone this Christmas, not after everything you’ve done for us! You, mister, are going to find love, and I’m going to help you!”
Never before has a statement left Bucky so completely speechless. “I—what? No—” Bucky gets out. Tinsel is already speaking over him. “It’ll be great! You’ll see! Oh, this’ll be so cute!” They enthused. To Bucky’s horror, they were waving their hands around in a way reminiscent of Dr. Strange, and a glowing, plasma-like substance was emitting from their fingertips. Cold wind began to whip around the common room, and snowflakes drifted down onto the carpet beneath their feet. “It’ll feel natural, promise! Once you all snap out of it, you’ll realize just how perfect the two of you would be!”
“What are you talking about?” Bucky demanded, holding up an arm to shield himself from the sudden onslaught of icy wind.
“Well, I’m not having you fall in love with a stranger, of course! All your friends will be there—your subconscious just has to make a choice!” Tinsel chirped. The snow fell heavier, the light spilling from their hands increasing in intensity.
No, no, no, there was clearly some sort of confusion here, some sort of mix-up, but when he tried to explain, he found himself unable to speak, overtaken by a sudden, final burst of cold wind, ice spiraling up from the floor in shining fractals, crawling up his legs and to his torso, spreading outwards to his arms and crawling up his neck, finally encasing his head. Through the crackling ice creeping over his ears, he heard Tinsel’s merry voice. “Have fun! It’ll be great, don’t worry!” He could feel himself begin to be pulled, not in any direction, but a distinct tugging sensation in his gut, pulling somewhere inwards and outwards.
The last thing he heard was Tinsel. “Just follow your heart!” They called out.
Then, everything went dark.
Westblooms was…different. Bucky didn’t know how else to describe it as he unlocked his front door. Maybe he’d spent so long away from anything like it that he’d become biased. Everyone was just looking at him, all the time. He stuck out, he knew, simply by being an unfamiliar face in a town this small, but it still bothered him, made the hair on the back of his neck stand up. He wasn’t sure if he regretted moving here, per se, fresh start, and all, but it was rough.
The town didn’t have much to offer, save for the research center near the outskirts and a small ecological preserve—he’d gotten an earful about both on the cab ride from the airport.
He shouldered the door open, shutting it behind him and dropping his bag on the entryway floor, toeing off his boots. On his way to his room, he checked his phone, clicking on the only text he’d gotten—from his new doctor, confirming their appointment for tomorrow. He replied, then left his phone on the counter to shower. When he was out, he had another—a sole thumbs up emoji.
Bucky went to bed, like usual, and tried to sleep, which resulted in little success, also like usual. He tossed and turned most of the night, chilled to the bone no matter how many blankets he piled atop himself. He caught a few hours, maybe, but it left him feeling no better. Eventually, a bit after the beginning of sunrise, he gave in, and got up. He got dressed, running through the motions like he did every day. He ended up going on a run around the neighborhood, passing houses that, though they all looked different, held the same small town charm that was beginning to grate on his nerves.
Even after completing the loop around the neighborhood a few times, he still felt restless, uneasy—though that wasn’t really unusual for him. He forced himself to clean up, then sit down and read the book that’d been laying on his coffee table for the last few weeks. The librarian had told him, with a sympathetic look in her eyes that God, he was really, really starting to hate, he could keep it for as much as he needed to finish it, when he told her how busy he was and asked about their renewal policy.
His appointment wasn’t in a hospital—rather, a research center near the edge of town. The security was tight, and he ended up being escorted in by a man who’s name tag read Happy, but his face read anything but.
Dr. Anthony Stark was waiting for him, a phone resting in between his shoulder and ear, talking as he worked on something on a tablet. Happy rapped his knuckles on the doorframe, and Dr. Stark nodded, saying a quick goodbye and hanging up. He grinned at the two of them. “Good to meet you, Barnes. Happy been treating you right?”
Bucky looked to the side, then back at Dr. Stark. “Yes.” Is all he said.
Dr. Stark ushered him in and sat him on an exam table in the middle of the room. “How’s it been treating you?” He asked as he moved to the computer in the corner.
“It’s fine.”
“Problems moving? Any joints not bending or rotating like they should?”
“No.”
“Any problems with the sensitivity? Grip strength too loose or strong? Tactile sense off at all?”
“No.”
“Any unexpected pain?”
Unexpected. “No.”
Dr. Stark looked over at him, a brow raised. “Lord, you sure are a talker.” He said dryly. “It does hurt, though, yeah?”
“Yes.”
Dr. Stark rolled his eyes. Then, he finished typing and walked over to Bucky. “Well, not much I can do about that one, I’m afraid. However, what I can do for you is make sure everything is working right, and maybe toss in a flamethrower somewhere.”
Bucky tried to stifle the soft snort. Judging by Dr. Stark’s grin, he didn’t do a very good job. “The thought is appreciated, but I believe my job is to do the opposite.”
The other man pulled up his chair and laid out a set of tools across his knee. “Firefighting, yeah? Very heroic. Continue doing the public service and strip for me. Need to get into your shoulder socket.”
Bucky took off his jacket, along with the sweater and shirt he was wearing underneath. “I’m pretty sure doctors are supposed to be more professional.” He commented as Dr. Stark began to unscrew a nearly invisible opening on his upper arm.
“Ph.D., not M.D., unfortunately for you.” Dr. Stark dismissed. “If you want a decent bedside manner, try Strange.” Bucky blinked. “Neurosurgeon. My consultant on all this.” Dr. Stark elaborated, waving his hand at Bucky’s arm. “Best in the business, little prickly, bit of a self-righteous douche. Actually, maybe don’t go to him.”
He tugged lightly at something in the wiring, and Bucky clenched his jaw. Dr. Stark looked up at him. “That hurt?”
“Yes.” Bucky said through gritted teeth.
“Oops.”
Bucky thinks he could have done worse than Dr. Stark.
Shuri calls him when he gets home. “How was it?” She demands.
“Hello to you, too.”
“Piss off, Barnes. How was it?”
He shrugs, though she can’t see it. “Stark is weird.”
Bucky can practically picture the little divot on her brow that seems to only appear when she’s talking to him. “Barnes.”
He sighs. “What do you want to hear, Shuri? It’s been a year and I still get pain so bad I can’t breathe in a limb that doesn’t exist? That I can’t stop staring at my mutilated shoulder every time I get the arm removed? It fucking sucks, Shuri. What else is there to say?”
A moment. “It’s only been eight months. Phantom pain is common. I don’t get it, not like you do, but, Barnes…it’ll get better.” She says, uncharacteristically soft. Bucky runs his hand over his face. “I know, I know. I’m sorry for snapping.”
“Forgiven.” She brushes off. “You’ll be back on your feet in no time. Stark’s brilliant. You saw what he did with Rhodes.”
Colonel Rhodes’s accident had been horrific. Bucky remembers hearing when his plane went down, the shock that had coursed through him. He’d met the man only a few times, but had liked him, his good nature and strength. The man had lost feeling in both his legs, and, a year later, was back with the Air Force, metal braces around his legs that had given him more grace and balance than their most agile recruits.
“I still can’t believe they’re having him help me.” Bucky admitted after a moment.
Shuri scoffs over the line. “Barnes, after what you did, I’m pretty sure you could demand a solid gold arm, and they’d give it to you.” She pauses. “They’re still talking about you, you know. Calling you a hero.”
Bucky can’t help the way his mouth twitches downwards. “Tell them to knock it off.” It’s not that he…regrets what he did, but he hates how everyone seemed to glorify it. Though lives were saved, he still lost his arm. He may not be grieving for people like he would have been if he hadn’t intervened, but he’s still grieving.
“I’ll punch Rodgers, how’s that?”
That makes him smile, just a little. “Sounds good.” Steve, most of all, had been like that. A hero, Bucky was, he said. Didn’t seem to get how angry Bucky was about it all, how hard it had hit him, how much he had lost, regardless of who he’d saved. “How’s your brother?”
Shuri groans, and Bucky sits down on his couch, knowing he’s in for the long haul.
He goes to the facility to see Dr. Stark, who has now demanded he call him Tony, twice a week. On Tuesdays, he spends the whole session with the man, who pokes and prods at his arm and once made him draw with crayons to get a feeling of the sensitivity of the new model. The following week, he’d almost decked the engineer when he saw the collection of crayon scribbles on the laboratory sample refrigerator the next room over. On Fridays, he went in for a short check-up—Stark seemed to function as his prosthetist, physical and occupational therapist, and mad scientist—and then spent an hour with the psychologist that worked at the research center. She was nice enough. Asked him a lot of questions, about his arm, about the incident itself, about how he felt now, about anxiety (it sucked) and sexual dysfunction (he’s fine) body dysmorphia (he’s fine) and his sleeping habits (they were shit) and his PTSD (also shit). In summary, it was exhausting.
Two months in, enough data had been collected and enough tests had been run, and Bucky, who had gone half out of his mind with restlessness, had joined the local fire department. The chief had come to see Tony during one of their sessions personally, and, after watching Bucky run through all the mobility and strength tests, had only asked one question. “Do you think he can do it?”
Tony had rolled his eyes so hard it looked like it hurt. “That is a Targeted Muscle Reinnervation prosthetic made with nanotechnology. It has multi-positional joints and has a melting point higher than any flame can get, in addition to being so well insulated he could stick his hand in a grease fire and grab onto an ice cube and not melt it ten seconds later. Personally, Chief, not hiring him would be a stupid choice.”
The Chief had looked stunned. Once he took in Tony’s words, he had just nodded, and Bucky began training the next week.
It helped. He worked long hours and was busy, and when he went home he was sometimes tired enough to actually sleep. He still woke up screaming some days, and tried to scratch or soothe an arm that was really just a hunk of metal, but it wasn’t as bad. His coworkers were nice, and, besides Cody always asking him to punch open cans for him with his ‘cyborg strength’, they were normal, treated him like any other person. They didn’t thank him for his service and everything he did and insist he was a hero and had done something amazing because they didn’t know, and it was like he could breathe for the first time.
Bucky leaned back as Tony argued on the phone. Stephen Strange, again, who Bucky had become acquainted with the two times he had dropped in to speak to Bucky about the nerve connections of his arm. Him and Tony seemed to be locked in a constant battle of snark and wits, and Bucky was tempted to either lock them in a closet or tell them to just fuck already, for Christ’s sake. It was in the middle of one the two of them arguing (flirting) that Bucky had met Peter, Tony’s son, who, despite the uncanny resemblance, had been adopted by the man two years prior. The kid was sweet and smart as a whip, bouncing into Tony’s lab with a bright smile to hand over his AP Chemistry test.
Once Strange and Tony were done, Tony had given his kid a hug and pinned his test up next to Bucky’s fucking crayon drawing that Tony refused to take down.
“He’s a nice kid.” Bucky had complimented once Peter had left.
Tony smiled, and it was unlike any other Bucky had seen on him. “Wish I could take credit for it.” He looked up at the paper on the fridge. “Kid deserves the world.”
Bucky, though he didn’t say anything, found himself agreeing.
Peter dropped in occasionally, usually plopping himself down on the floor and launching into long spiels about his day at school. From what Bucky had gathered, he has a best friend named Ned, a not-girlfriend named MJ, (“They have huge crushes on eachother, it’s exhausting,” Tony had commented. Bucky, who had just watched him argue with Strange with their lips about three inches apart, had just raised an eyebrow) and a group of friends on his Academic Decathlon team.
“Menaces, all of them.” Tony had said. “Smart, but horrible little creatures.”
“Hey, you said you forgave Charles and Cindy for the whole fire extinguisher thing.” Peter interjected.
Tony had just sighed.
There was also a guy named Flash. Bucky had said that was a stupid name, and Peter had nodded in agreement so fast Bucky was afraid he’d hurt his neck. “Yeah, he’s super mean to, like, everyone. He used to say all this nasty stuff to me—he’s transphobic—but one of my teachers apparently, like, put the fear of God into him, or something, and he mostly leaves me alone now.”
“Good teacher.” Bucky had said.
Peter nodded again. “He’s great! He might be in the mafia, or something—Cindy thinks the Bratva because she heard him speaking Russian, once, but she doesn’t speak Russian, so it really could have been anything—but he gives us snacks, so, it’s like, whatever.”
Bucky didn’t even ask why one of his friends thought the Bratva would be in Westblooms, Vermont, of all places. Their police force was, like, fifteen people, including the records and administrative assistants.
Time passed in a blur, and Bucky finished training. He worked strange shifts, but his sleep schedule was messed up anyways, so he didn’t really mind, but it did result in him going to get coffee at three in the afternoon. It was cold out, which he always hated, and he crammed his hands deeper into his pockets. Westblooms was, apparently, a very festive town—it wasn’t even December yet, and every single streetlight had been wrapped with tinsel and adorned with red ribbon. A twenty-foot tree had been put up in the park, and Bucky watched a group of volunteers string lights around it as he walked down the sidewalk.
The collision was sudden and rough. Bucky stayed unmoved and upright, which couldn’t be said for the other person. His arm shot out and, in one smooth motion, he grabbed ahold of them and kept them from hitting the ground.
It took him a second to recognize the cane clutched against their chest and the leash in their hand. A pair of sunglasses had tipped off their face, residing on the pavement next to the paws of an extremely large, black mastiff. He looked down at them, stunned.
Holy shit.
He was pretty. The most breathtaking green eyes he’d ever seen were framed by thick, long lashes, and freckles splattered across the bridge of his nose and his high cheekbones. Black hair, a thick red sweater, and a soft, friendly mouth.
Jesus.
He swallowed, dry. “I’m so sorry.”
The man blinked, parted pink lips curling up slightly in a smile. “Well, you caught me, didn’t you?” He breathed. Bucky’s arms were still around him, still pressing him close and keeping him upright.
“Suppose I did.” He managed, letting go of the man, his hand flexing once back at his side, the warmth already fading from his fingertips. He got down and picked up the man’s sunglasses from the pavement. “Are you alright?” He asked as he inspected them for scratches.
“Just fine.” The other man said, sounding slightly winded. Jesus, did Bucky really hit him that hard? Bucky stood, holding out the glasses. “Here.”
A beat. The man blinked.
“Oh, my God. Sorry. Your glasses. I picked them up.”
The man laughed, and holy shit, it was like the air was knocked right out of Bucky. He has dimples. God, he has dimples. “It’s alright, really.” He holds out his hand, and Bucky—he really doesn’t know what possesses him, honestly—instead unfolds the glasses, and slides them right back into their spot on the man’s face. “There.” He says.
The man’s face is pink from the cold. “Thank you.” Christ, Bucky must have really hit him hard. Next to him, his dog nudges Bucky’s leg with her nose, curious, pulling slightly on the leash. He settles a hand on the top of her head, which is almost next to his ribs, she’s so tall.
“Sorry—” He reigns her back to his side. “That’s Lea.” The man introduces. “And I’m Percy.”
Percy.
Something about the moment feels odd, but in an abstract, distant way. He can’t bring himself to care, enraptured by the man in front of him. If he focuses, he can almost hear music playing in the distance—some soft, instrumental song. He has no idea where it’s coming from, but he doesn’t really care.
“Nice to meet you, Percy. I’m Bucky.” His eyes don’t leave his face. It’s like he’s rooted to the spot, stuck on the sidewalk staring at this man, at Percy.
His eyes crinkle when he smiles. “Bucky? Bit of a strange name.”
Bucky still feels like he’s fighting for breath. His eyes are like the ocean. “How about you give me your number, and I can tell you about it later.”
Percy regards him for a moment longer, something searching and soft on his face. “Get your phone out, then.” He orders.
He’s almost late for work.
He doesn’t even care.
[Barnes]: It’s short for Buchanan.
[Unknown Number]: Buchanan, really?
[Barnes]: If it helps, it’s my middle name.
[Percy]: What’s your first name, then?
[Barnes]: James.
[James]: It’s James.
[Percy]: That’s a lovely name, James.
His next appointment with Tony, the man keeps shooting him with odd looks. Ten minutes in, Bucky gives in. “What?”
“You’re smiling. It’s weird.” Tony replies, casting him another glance over his shoulder.
Bucky frowns. “I smile.”
Tony says nothing, just looks at him again.
“I smile sometimes.” Bucky amends.
Another directed silence. “When I feel like it.” He tacks on. Tony huffs rolls his chair over, and puts something into Bucky’s metal hand. “Squeeze this as hard as you can.” He obliges, and Tony makes a considering noise. “Any chance you’re interested in additional metal parts?”
“I’m sorry?”
“Barnes, the average adult male has a grip strength of about seventy pounds, and that scale maxes out at two-hundred pounds.” He looked up. “You maxed it out.” Then back down at his hand. “And then you broke it.”
Bucky unclenches his fist to see warped metal. “Holy shit.”
Tony hums. “Might have done my job a little too well.” He shrugs. “Eh.”
“Eh?” Bucky repeats incredulously. “Tony, what the fuck?”
“I mean, you could already lift, like, at least half a ton with it—” Tony defends.
“What?”
Tony winces. “Anyways,” He drags out. “Did one of your enemies finally kick it? Seriously, I don’t think I’ve seen you smile this much, like, ever.” He squints. “You on drugs? Please say no. I don’t want to be responsible for a super-cyborg on LSD again.”
“No, I’m not—again? Tony, again? What the actual fuck do you do in this lab when I’m not here?” Bucky shakes his head. “You know what? Don’t answer that. Seriously, don’t. I’m not on drugs. End of discussion.”
Tony doesn’t look remotely satisfied, but doesn’t press further, especially because, not even a minute later, Peter bursts in and announces that Abe has gotten his leg stuck in the vending machine and needs help getting out.
The manic grin that appears on Tony’s face will forever haunt Bucky’s nightmares. “You know, Barnes here can get your friend right out. That thing will definitely crumble under at least 200 pounds of force.”
“No.”
Bucky, surrounded by a group of eight teenages, one who is knee-deep in a vending machine, ends up getting peer pressured into crushing the door of the vending machine until they can free Abe. They erupt in screaming cheers as the metal groans and snaps under his metal fingers.
It’s stupid.
It’s also the best he’s felt about his arm in a very, very long time.
[James]: What’s Percy short for?
[Percy]: …I feel like you’re going to laugh.
[James]: Only if it’s funny.
[Percy]: It’s pretty funny, admittedly.
[Percy]: Perseus.
[Percy]: My mother looked me in my tiny baby eyes, and named me Perseus Achilles.
[James]: Oh.
[Percy]: Yeah. you’re laughing, aren’t you?
[James]: Only a little, I swear.
[Percy]: I’m not taking this from somebody who willingly goes by Bucky Barnes.
[James]: :|
[Percy]: That means nothing to me or my text-to-speech.
The station responds to a call, puts out a field fire. Bucky goes back to the library a few more times, does his best to avoid the sad, pitying eyes of that one librarian. He calls Shuri a few more times. Tells her how he’s doing, and she seems glad.
The Chief pulls them in for a meeting. “We’re doing the annual school visits next week.” He announces. “Kelley, Cole, you’re on Fields Elementary, Johnson, Cody, you’re going to Orchard Elementary. Maria, Landen, you’re on the middle school, and Rumlow, Barnes, and Romanoff are on the high school. Teach them about fire codes, what the department does, and what the job is like. Clear?”
“Clear.” They chorus.
Romanoff—Natasha Romanoff, her name is—gives him a commiserating glance from the other side of the room. Rumlow, the third in their group is…well, he’s a dick, to put it succinctly. He and Bucky work opposite shifts, but the few times they run into each other, Bucky always leaves with a clenched fist and gritted teeth. He just shrugs helplessly at Romanoff.
They devise a basic plan of what to go over, highlighting certain parts and running through practice speeches in between calls. Well, Bucky and Romanoff do—Rumlow tells them he’ll be doing the local fire code and common violations, then promptly leaves and doesn’t speak to them about it again. They end up deciding that Bucky will give a brief overview of the training to become a firefighter—some of the kids will be graduating soon, and the Chief is always looking for more recruits—Romanoff will talk about what they do in the community, other than the obvious, Rumlow will do his thing, and then they’ll take questions.
It’s during one of their quick meetings that Romanoff sighs, eyes fixed on him. Bucky looks up at her. “What?”
“Oh, you know how I worry.” She says, waving a hand. Bucky blinks. “I’m sorry?”
She gives him a pitying look. “You need to get out more, Barnes.”
He says nothing, completely blindsided. They…they barely even know each other—Romanoff knows next to nothing about his social life. “What are you talking about?”
Romanoff sighs again, like he hadn’t even said anything. “I don’t want you to end up alone, Barnes. I know you’ve been having a hard time, but you need to learn to open up.”
What the actual fuck?
[Percy]: One of my coworkers just had to be taught how to do his taxes.
[Percy]: He is twenty-four.
[James]: …Has he been committing tax fraud this entire time?
[Percy]: Honestly?
[Percy]: Maybe.
[Percy]: Very grateful that this is the type of person that is shaping young minds.
[James]: What do you mean?
[Percy]: Oh, he’s a teacher
[Percy]: I work at the local high school
[James]: Really? I’ll be seeing you soon, then.
[Percy]: Good for you
[James]: …
[James]: You’re not funny.
[Percy]: Yes, I am.
They swing by the school for the assembly the following week. The students are settled in the bleachers, the teachers lined up against the padded walls of the gym. Bucky can’t help but look around until he spots Percy, cane in hand and Lea sitting patiently at his feet. He’s dressed in nice pants and a sweater vest, quietly talking to the person next to him, and Bucky’s mouth goes dry. The other teachers are either watching the students with narrowed eyes or similarly talking amongst themselves—the tallest person Bucky’s ever seen is leaning down to listen to a Hispanic woman with long, wavy hair. A woman with elaborate braids and a yellow sweater is speaking to a man in a wheelchair, and a spikey-haired man is nodding along to something Percy says.
The presentation goes fine. Though he’s speaking to the students, he can’t help but continuously glance back at Percy, who jolts the second Bucky starts speaking, his lips parting in surprise at the sound of his voice.
It’s probably not unique to him in the slightest, but Bucky can’t help but like that Percy can recognize him by voice alone.
The questions at the end are a little rough. Someone asks why they decided to become firefighters, and Romanoff tells her story about meeting some of their local department members as a teenager and deciding to join up right out of high school. Rumlow tells his, following his father’s footsteps and serving the community—he, too, joined right out of high school.
When it comes to Bucky, a girl in the front asks him why he moved here, of all places. He shouldn’t be surprised—the town is most definitely small enough for them to take note of an unfamiliar face, and he has no doubt that word has spread about the firefighter with a metal arm.
“Originally, I came here because of the Carter research center and their prosthetic work.” He says. “I served in the military beforehand, and never lost my sense of duty, unlike some things” He gestures to his metal arm, and that gets a round of laughs.
“You lost it in the military?”
He shifts, just a little. “I did.”
“Any more questions?” Romanoff intervenes. Bucky exhales slightly, his shoulders losing some of their tension as the discussion shifts. His eyes flick to Percy once more, who is listening with a tilted head and considering look.
Bucky looks down, face tight.
The assembly was slated for the last period of the day, and the kids trickle out to the parking lot once they’re finished answering questions. The teachers, too, take their leave, back to their classrooms.
Percy sticks around, and Bucky, after a second, makes his way to him.
“You’re a firefighter.” Is the first thing Percy says, his head cocked to the side, ever so slightly.
“You’re a teacher.” Bucky returns.
“You already knew that.” He taps the handle of his cane absentmindedly. “Will you do me a favor?”
“Of course.” Bucky doesn’t even think about it before agreeing.
“Walk with me back to my classroom? Kids always leave things around after the assemblies, and Lea, here, can only do so much.”
“It’d be my pleasure.” Bucky says, and he’s completely genuine. The hallways are a mess, like Percy said, and though he mostly avoids most of it with his cane and Lea, Bucky gently intervenes to keep him from stepping in a puddle and later on a notebook. He makes a note to try and find another faculty member—not only is that inconsiderate to the custodial staff, but to Percy.
Percy’s classroom isn’t what Bucky expected. There are no desks, for starters—instead, a rack of chairs and music stands against the wall. There’s a row of shelves in the back, loaded with instrument cases, and a small storage closet to the left for larger instruments. Percy’s office, similarly, has a few cases tucked into the corner. There are also bookshelves—a few textbooks, but also novels, all in different languages.
“Music?”
“Orchestra and language.” Percy says. “Weird combination, but,” He shrugs. “It works.”
Bucky hums and sits in the chair against the wall, near Percy’s desk.
It’s silent for a moment while Percy rests his cane against the wall and Lea gets a drink from the bowl in the corner. “A firefighter?” Percy repeats. Bucky ducks his head. “You already knew that.” He parrots. Percy makes a face at him. Then, “Your presentation was nice. The kids seemed to like it.”
“A boy in the back was knuckle deep in his nose the whole time.”
“...You can’t win them all?” Percy tries.
Bucky huffs in amusement. “Guess not.”
They lapse into silence. It’s oddly comfortable, the kind Bucky finds with Shuri and Ayo, the kind that comes with familiarity and closeness. It’s odd—he’s only known Percy a few weeks, and they’ve really only seen eachother in person a few times, but it feels incredibly easy, sitting with him like this.
“I’m going to tell you something, and you’re not going to laugh at me.” Percy declares.
Bucky, amused, looks at him. “Am I, now?”
“Yes, you are.” He bites the inside of his cheek. “I didn’t even know you were missing an arm.” Percy admits, cheeks a deep scarlet.
Bucky tries to hold it in. Really, he does, but he can’t help how he barks out a laugh before his hands come up to cover his mouth. “You—how did you not know?” He gasps out. Percy groans, burying his face in his folded arms. “How would I have known?” He complains. Bucky can’t stifle it any more—his shoulders shake and his ribs ache as he laughs.
Later, he would realize that it seems like the first time he’s laughed like that in a very, very long time.
“Stop laughing at me!” Percy demands, muffled into his arms. “How would I have known?”
Bucky’s smile is hurting his face. “I thought you would have at least heard about it, I mean, everyone seemed to know me the second I moved here.”
“Sorry for not being a gossip,” Percy mumbles, still slumped over. Bucky laughs again, softer this time, before reaching out and gently taking Percy’s hand with his, uncurling his fingers and placing it on the open palm of his metal hand. At that, Percy sits upright, a curious look on his face. “Can I—”
“Go ahead.”
Percy takes Bucky’s hand in both of his, running his fingertips curiously up and down his fingers, circling his palm, dipping down to his wrist. Bucky resists the urge to shiver—Tony wasn’t joking about the tactile sensitivity. Percy might as well be touching his skin. Bucky barely even breaths as Percy’s fingers skim up his arm, stopping halfway to his elbow. “How far up does it go?” He asks curiously.
It takes Bucky a moment to find his voice. “My shoulder.” He gets out.
Percy hums, and, to Bucky’s disappointment, lets go of his arm. “If it’s any consolation, it feels very pretty.” He says wryly.
“Much appreciated.” And, God help him, he’s not lying.
[James] Why does one town own so many Christmas lights?
[Percy]: Oh, you’re in for a real treat.
[Percy]: Christmas in Westblooms is serious business, James.
[James]: Should I be scared?
[Percy]: You’ll be fine.
[James]: I feel like you’re lying to me.
[Percy]: …Maybe.
“—it’s a protected reserve, they’re never going to get it approved. I don’t know why they don’t just drop it already.” Tony rambles.
Bucky looks up from his phone. “Sorry, what?”
Tony suddenly grins. “You textin’ someone, Barnes?”
“No.” He says, you know, like a liar.
Tony sighs. “Barnes, I know you’re tired of hearing this, but you need to get out more.”
Bucky is suddenly hit with an absolutely horrific sense of deja vu.
“I know it’s not easy for you to open up, but you gotta try. I mean, nobody wants to be alone on Christmas, Barnes.” Tony continues, ignoring Bucky’s dropped jaw and incredulous eyes. “We’re getting worried about you.”
Bucky looks around. “Who the hell is we?”
The room takes on a somber mood. He swears to every deity out there that someone is sadly playing the violin in the distance. “Just, promise me, alright?” Tony urges once more, completely ignoring him. “This isn’t what your father would have wanted for you.”
…What?
The rest of the day was similarly strange. At work, the Chief and Natasha roped every other person on shift into showing up pictures of their single family members. Half of them invite him out to ‘put himself out there’. Cody starts talking about dating apps, and Bucky flees the scene.
He instead goes for a short walk around town, stopping in the park to watch a group set up part of the annual lightshow. There’s music—something orchestral—coming from the other side of the park, and he finds himself drawn to it.
There’s a stage in the middle of the park—nothing fancy, though it is decorated with an absurd amount of tinsel. Spread out in neat arcs is an orchestra. He recognizes Peter in the far left side of the brass section with his French Horn, talking to Sally, who’s in front of him with a clarinet.
Percy’s there.
Something in Bucky’s chest both tightens and loosens. The man is standing in front of the orchestra, and he’s smiling as he talks to them. Bucky is absolutely entranced, listening with rapt attention as Percy raises his hands, two dozen instruments rising with them.
Carol of the Bells, Bucky realizes after a moment. For a high school, they’re surprisingly good. Really good, actually, though Bucky will admit he pays far more attention to the conductor rather than the orchestra itself.
The song finishes, and Percy waves for them to all go pack up. Lea is waiting at the edge of the stage, and Percy takes his cane out from his inner coat pocket, unfolding it and making his way off the stage. Without thinking (it feels like the most natural thing in the world, and Bucky has absolutely no clue as to why) he calls out to him. “Percy!”
He stops, turning towards Bucky. “James?”
Bucky makes his way over to him. “Hey. What are you doing out here? They not give you a music room, or something?”
Percy huffs out a laugh, his smile wide and practically blinding. “No, they give us a music room. We do a Christmas show every year to raise money for the music program, and it’s coming up. I just want them to get used to the stage and playing outside.”
“When is it?” Bucky asks.
“Oh. Uh, next Friday. At six.”
Bucky nods. “Cool. I’ll be there.”
Something soft overtakes Percy’s face. “Really?”
“Of course.”
Percy ducks his head. “That’s real sweet of you, James.”
Bucky just shrugs. Behind them, some of the kids are calling out goodbyes as they head to the parking lot with their instrument cases. Percy responds to each one with a smile.
A quick glance at his watch, and Bucky returns his focus to Percy. “Do you want to get coffee?”
Percy blinks. “Now? Not really a great time for coffee.”
Bucky shrugs. “It’ll be a great time if you’re there.”
He takes great pleasure in how quickly the other man flushes. “I—Okay. Yeah. Coffee.”
Their coffee date goes fantastic. Bucky has no idea what it is about Percy, but every time he so much as speaks, Bucky feels like he’s exactly where he’s supposed to be. Every smile, every laugh, and Bucky is a goner.
They go out for coffee again. Then they get lunch together. Then they take Lea to the park together. Bucky feels like a withering plant and Percy is the fucking sun, like his life depends on soaking up every minute of this man. It’s insane and almost scary and he doesn’t give a single shit.
He goes over to Percy’s and they bake cookies for his classes. Percy’s wearing an incredibly soft looking sweater and a flour-dusted apron, and Bucky wants to do so many things to him.
They get lunch again, and they take it to the park and sit on a bench together while Lea runs around. Percy sits next to him, right next to him, and he can feel the warmth emanating from the other man.
It’s only after they’ve said their goodbyes does Bucky realize that Percy left his scarf behind.
[James]: I have a hostage.
[Percy]: Oh, shit.
[Percy]: Is it Lina from the bakery on Main? Please tell me it isn’t Lina. Her croissants are the only reason I haven’t moved.
[James]: …It’s your scarf, dumbass.
[Percy]: Oh.
[Percy]: To clarify, Lina and her croissants are safe, yes?
[James]: Yes, Lina and her croissants are safe.
[Percy]: Thank the Gods. Is there a good time I can come by and pick it up?
[James]: I just got off work. If you’re not busy, I can drop it off right now.
[Percy]: That’s sweet of you, but you don’t need to go out of your way.
[James]: I’d do it just to see you, no scarf involved.
[James]: Is now a good time?
[Percy]:
[Percy]: Yeah. Now would be fantastic.
Bucky pulls up to the school to find it mostly empty. A quick look at the time confirms that school had let out half an hour ago—it’s mostly just faculty, now. He quickly signs in at the office, and, with a visitor's pass, heads in the direction the secretary had pointed him in.
He can hear the yelling down the hall.
“How fucking dare you?” A man, slightly raspy and angry.
“Mr. Rumlow, please calm down.” It’s Percy, sounding stiff and uncomfortable. “I will not be discussing anything with you until you regain control of your temper.”
Another voice—the tall blonde with a muddled accent. “Mr. Rumlow, I’m going to have to ask you to leave.”
Rumlow carries on like they’re not even there. “You suspended my fucking kid, I think I have a right to be pissed.” He spits. “Who the fuck do you think you are, huh? This is going on his record, you know? You’ve fucked up his life.”
Despite how uncomfortable he seems, Percy remains unmoved. “Mr. Rumlow, he did that himself. Your son made his choices, and now he has to live with the consequences. The matter is out of my hands now. If you have a problem, I believe you’ll need to take it up with the police department.” He says icily.
It’s silent. Then, there’s a crash, and Bucky bursts into the room.
There's another teacher, leaving out the side door, seemingly dragging someone along with them. Right before the door shuts, Bucky meets their eyes, unnervingly clear blue that feels almost familiar. They nod at him once, and the door swings shut behind them.
Percy is standing in the middle of the room, his glasses askew and his cane on the floor at his feet. He’s bleeding.
Bucky bends down at his feet, picks up his cane. “Percy?” He prompts softly. Slowly, he reaches a hand out and settles it on his collar, fingers curling over his shoulder. “Are you alright?”
When he pressed the cane into Percy’s hand, he takes it, hand going overtop Bucky’s. He doesn’t let go. “James?”
“Hey, darling.” He confirms, free hand coming up to cup Percy’s jaw, soft skin against his calloused hands. He tilts Percy’s face side to side, taking in the fresh split of his lip and steadily trickling blood from his nose, catching in the seam of his lips and smearing across his cheek. Suddenly, things begin to make a lot more sense. He steps closer, closing enough distance that he can see how Percy’s lashes flutter. “Percy, love, did he hit you?”
He can feel the exhale against his hand. “Some of my students came to me about his son. Kid ended up getting suspended.” A weak smile, pulling painfully at the split lip. “He wasn’t too happy.”
“I’ll fucking kill him.” Bucky breathes. “Who?”
“Doesn’t matter.” Percy shakes his head. “Just some douche.”
Deep breaths, he has to remind himself. Be pissed later. He skims his thumb across Percy’s cheekbone. “Percy…” He shakes his head. “I’m taking you home.”
“You don’t need to do that.”
“Percy.” He repeats gently. “I’m taking you home.”
Percy ducks his head, leaning against Bucky’s hand. “Okay.” He says quietly.
They go out the main entrance, Bucky quickly returning his visitors pass. December air nips at them out on the sidewalk, and Bucky stops Percy with a strong arm. Before Percy can even ask, Bucky holds up the scarf he had forgotten and loops it securely around his neck. “There.”
The look he gets—flushed cheeks, parted lips, wide eyes, almost makes Bucky forget the seething rage now resting inside him. Almost.
It is enough, however, for him to momentarily table it.
Momentarily.
The next day, he goes into work, and Romanoff is standing by the coffee machine. “Word of advice,” She says as he fills his mug. “Avoid Rumlow if you can.”
“Already do that, but continue.”
She rolls her eyes. “Apparently, his kid got in some trouble, or some shit. He’s been a bitch all morning.”
Bucky’s hand tightens on his mug, and he’s suddenly very glad he’s not holding it with his metal hand, because it would have undoubtedly shattered. “Hm.” Is all he says.
The end of Bucky’s shift, after he finishes his equipment inspection, he catches Rumlow going out into the parking lot. Bucky follows him. It’s dark out, the lot only illuminated by the streetlights overhead. Rumlow doesn’t even see him coming.
“Hey.”
Rumlow whips around. “The fuck do you want, Barnes?”
Bucky grabs his hand and yanks it forward, under the light. Rumlow’s knuckles are split. The man tries to pull his hand back, but Bucky’s grip tightens until he cries out. “You think you can just do whatever the fuck you want, huh?” Bucky demands.
“What the hell are you talking about, you psycho? Let me go,” Rumlow snarls.
Bucky hears something in Rumlow’s hand pop. “You think you can just go around taking shit out on whoever you want?” He asks, leaning in. His voice lacks the bark of Rumlow’s, instead coated with something cold and sharp.
“I think you need to mind your own fucking business, pal,” Rumlow hisses.
Bucky is on him before he can even think, fingers twisted in Rumlow’s collar, lifting him off the ground and slamming him against the side of his stupid fucking truck. “Who,” Bucky’s grits out, his voice low, “do you think you are?” Rumlow grabs at his wrists, digging his nails into his flesh in effort to make him let go.
It doesn’t work.
Bucky shakes him, hit head hitting the wall once more, before he abruptly lets go, letting the man fall to the ground. There’s something cold in his words. “Stand up.”
Rumlow, stunned and clutching the back of his head, does nothing.
“Stand up.” Bucky snarls. Rumlow gets to his feet, the veins in his neck bulging and his face taking an ugly shade of purple. The second he’s upright, Bucky hits him, the sound of his knuckles impacting on his jaw brutal and satisfying in equal measures. Rumlow drops.
“Yeah, not so fun when it gets dished back, ain’t it?” Bucky gives Rumlow, who looks only half-conscious, one last frozen look. “You go anywhere near Percy again, and I swear to God, Rumlow, I’ll snap your fucking neck.”
The next time he sees Percy, he doesn’t say anything, but Bucky has a feeling that he knows. It’s impossible for him to explain, because, logically, how would Percy know? But…there’s just something about Percy, beyond the inexplicable that swirls in his eyes. He knows, Bucky’s almost certain of it.
But he doesn’t bring it up, so neither does Bucky.
Not until they’re about to split up. Percy tugs Bucky forward—and holy shit, he’s fucking strong— and wraps his arms around Bucky. He’s warm and he smells like the ocean and lavender and Bucky feels so incredibly right like that, wrapped up in his arms.
“Thank you,” Percy breaths into his ear.
Bucky can hear practically nothing but those words, replaying in his head, for the rest of the day.
Rumlow doesn’t show up for work the following week. Calls out sick. Romanoff seems to enjoy his absence. The entire station does, really. Unfortunately, the good mood they’re in only results in more attempts to set Bucky up on a date.
If he has to hear about one more cousin or nephew or family friend, he swears he’s going to lose it.
The first time Percy comes over to Bucky’s house, he scares the absolute shit out of him. Shuri and Ayo had sent him a new book, and—though he’d told Percy, assured him many times, the door was unlocked and he could just walk right in, his sudden presence made him tense up. The man was stealthy.
“Shit–” Bucky hissed, turning around to see Percy standing a tad awkwardly in his living room.
Percy snorted softly, taking in his rigid stance. “You gonna hit me? Should we take this out to the parking lot?”
Bucky stood, slipping a bookmark in between the pages and setting his book down on the coffee table. “‘Course not,” He says, coming to stand in front of Percy. He adjusts the scarf from around his neck, relishing in the immediate pink tinge to his face. “I don’t hit pretty teachers who are kind enough to bring me cookies.”
Percy, cheeks still warm, huffs at him and shoves the tupperware into Bucky’s chest. “Ass.”
“I call you pretty, and you’re mean to me?” Bucky’s grin is unrepentant as he puts on his own coat. “I see how it is.”
“I’m glad someone does.” Percy deadpans. That gets him an eye roll as the two walk back outside, setting off for the park, Lea excitedly wagging her tail. Percy lives extremely close to the park, likely for this very reason. They cross the street and head for the park gates.
“You’re not funny.”
“You love me.” Percy dismisses. It…it sounds so normal, so factual, and Bucky suddenly feels like he can’t breathe. The park is full today, but everything seems to go dead quiet around them, like this conversation is the only thing that matters.
“Yeah.” Bucky says, as the world around him narrows to a knife's edge. Suddenly, he's elsewhere, standing on a balcony overlooking the city, missing his arm and staring at a man who had sacrificed so much. “Yeah, I do.”
Percy goes still. “James…”
Everything is like static around him. All he can see is Percy, his dimples and his freckles and his eyes. “I think I’ve been in love with you for a long time.”
“Fuck off.” And then, Percy is surging forward, Bucky’s collar is fisted and he’s yanked down, and Percy’s lips are warm and soft against his.
Clarity rushes in like water through a broken dam. One hand still gripping Percy’s waist, the other cupping his jaw, Bucky suddenly lets out a choked exhale. He blinks, fully stopping and looking around.
“What,” He breathes. “The fuck.”
Percy, who seems equally utterly lost, is tilting his head to the side, a deep furrow in his brow. “James…” He trails off, blinks. “Is my radar off, or—”
“Where the hell are we?” Bucky breathes out. His grip on his boyfriend—his boyfriend, they’ve been together for a long time, why, how did he think he didn’t even know him—tightening.
“Westblooms, Vermont.” Percy recites automatically, stupefied. “I’m a fucking teacher in Vermont. Oh, my God, all my employees are teachers. Who the fuck let any of them influence children?”
Bucky breaks away from searching around them to stare. “That’s what you’re worried about?”
“Yes! Quite frankly, it’s very concerning!” He focuses on Bucky for a moment longer. “Oh, my Gods, you’re a firefighter. And—and a Navy Seal! Why were you in the fucking Navy, James?”
“I–I don’t know!” Bucky defends. “And, not anymore, apparently!”
Percy groans, thunking his head down on Bucky’s chest. “I hate this.” It’s unclear what exactly he’s referring to.
“Magic.” Bucky mutters, taking another look around them, the Christmas tree and the tinsel and the lights and they’re surrounded by inoffensively blank looking couples and families, none of whom seem to be paying them any attention at all, despite how loud they were a moment ago. A cold gust of wind kicks up, and it hits him like a freight.
“Tinsel.” He hisses.
Percy makes a face like he’s accepting that his boyfriend has finally lost his mind.
“There was a fucking elf.” Percy’s soothing, consoling face only deepens. He looks like he’s considering how well Bucky would suit a straightjacket. “No, no—I’m serious. One of the people from the fucking dinosaur place we went last year—Percy, stop laughing, there was an elf in the common room and they kept complaining about my love life—are you even listening?”
“Not really.” Percy wheezes.
“Fuck you. Honestly, fuck you.”
“I don’t think this is that type of movie.”
“See, you act like I’m insane and then you say shit like that. Real manipulative shit, love. Pretty sure this is what Shannon warned me about.”
“No, Shannon told you to stop taking credit for the Zodiac murders.”
“It could have been me.”
“But it literally wasn’t.”
“I hate you.”
“Sounds about right.”
Bucky kisses him again. “Movie?”
“Tell me this doesn’t scream Hallmark to you.”
He looks around again. It’s snowing, just a little, enough to dust coats and hats. Kids are running around in winter gear that's both perfectly clean and also matching. There’s a stand handing out free hot chocolate at the corner of the park. In this economy? Bucky’s eyes narrow. “Shit.”
“Yeah.”
“I hate Hallmark movies.”
“You liked that one with the knight.” Percy reminds.
“The Knight Before Christmas is a classic. Shut your whore mouth.”
Bucky said that quite loudly. Not a single person around them, all families with young children, reacted. His eyes narrowed further.
“Shit.” He says again. “What the fuck do we do?”
“The movie usually ends a bit after they get together.” Percy offers. “Maybe it’ll end soon? And we’ll…wake up? Get let out? I mean, I’m still definitely supposed to be escorting a dangerous prisoner to trial.” A pause. “It’ll be fine, probably.”
“We’ve already broken the movie, though. I mean, besides us being out of the norm for this type—”
“Diversity win! Couple kidnapped and trapped in a Christmas movie hellscape is an interracial, gay, and disabled!” Percy mumbles. Bucky ignores him. “Those movies are rated PG, and we have sworn way too much.”
“You did also beat Rumlow unconscious.”
“...Right. I did do that.”
Percy nods.
“Isn’t he dead?”
“I am fairly confident in my answer of yes.”
“...Hm.”
“He’s probably not real?”
“... Hm.”
“Do you think everyone else knows?”
“Considering I haven’t gotten a million texts from Tony, I’d say no.”
“Shit.” They seem to be saying that a lot, recently.
“What do we do now?”
Percy makes a face. Snow is clumping on his lashes, contrasting against his dark hair. His face is flushed, and his lips are still so, so warm. Bucky looks around, the mindless groups wandering around them. He looks back to Percy—his eyes, something that no amount of magic could ever change, swirling and crashing like waves against a rocky coast. He’s chewing on his lower lip as he thinks, the adorable scrunch in his brow present.
Fuck it. Might as well.
Bucky’s hand on his waist slides down a little lower to his hip. “Well, I know what I’d like to be doing.”
Bucky didn’t think it was possible, but Percy’s face tinges even darker. Then, after a long moment, “You know what? Sure.” He gently squeezes the side of Bucky’s neck. “Take me home, Jamie.”
Waking up with Percy in his arms almost makes him forget they’re not home. His head is on Bucky’s chest, curled into his side, an arm wrapped tightly around him. Bucky doesn’t even entertain the notion of trying to get up, more than content to lay there with his boyfriend, his thumb lightly skimming up and down his bare arm.
He’s warm.
This whole time, he’d been confused as to why he’d been so cold. Blankets and layers did nothing, failing to chase away something that lived deeper than his skin. Percy was so close to him it was like they were one, an all-encompassing warmth radiating off of him.
“Finally figured it out.” He whispered aloud.
Percy made a soft sound, face scrunching. “Mmh?”
Bucky presses a kiss to the top of his head. “Nothing, love.”
The peace doesn’t last.
“Two people have given me speeches about how I need to open up and get myself out there.” Bucky says the next day, dropping down at Percy’s dining room table.
Percy chokes on his cereal. “I’m sorry?”
“Last week, Tony looked me in the eyes and told me that this isn’t what my father would have wanted.”
The furrow in his brow makes its grand reappearance. Then, something strikes him—Bucky can almost see the little lightbulb appearing above his head. “James,” He breathes. “James, Jamie, love, you’re the emotionally distant protagonist from the big city.”
Horror. Absolute horror. “No.” He gasps.
Percy, the bastard, is cackling. “You totally are!”
“Okay, well, that means you’re the sweet small-town boy who’s been spurned by a past love!” He snips back. “And your small business is failing!”
The color drains from his face. “No, my small business!” A beat. “Wait, I’m a teacher at a public high school. Never mind.”
Bucky just sighs.
They’re washing the dishes when Percy suddenly turns off the tap. “Wait, is this why I keep hearing tender and emotional music whenever we talk?”
“Thank fuck, I thought I was just imagining that.”
They spend the weekend together. Sunday night, laying in bed, they both agree to continue on with…whatever the fuck is happening. Their best lead at the moment is just trying to finish the movie. Typically, there’s another plot that’s not where the main characters get together, though it usually is a driving force for their relationship, Percy had pointed out.
Bucky had groaned, rolling over to bury his face in Percy’s hair. “I cannot believe your encyclopedic knowledge of shit Christmas movies has actually become useful.”
“Gods forbid I hyperfixate in peace, asshole.” Percy replied, holding James like he was the most important thing in the world.
Thirty minutes of complete silence later, Bucky lets out a muffled scream into his pillow. “Natasha is going to try and get me to open up emotionally.”
Percy, the unfeeling bastard, laughs at him.
The next morning, Natasha keeps mentioning her various family members and friends his age. “She’s nice, I promise. Loves reading, so you’d have something to talk about.”
Bucky, who’s so far beyond the point of caring, just buries his face in his hands.
He misses her calculating look.
At the end of his shift, the Chief calls him in.
He proceeds to tell Bucky about his nephew—a sweet young man, just broke up with his boyfriend, goes to college not far from here—
Bucky screams in the middle of the fire station.
Then, he abruptly remembers that Rumlow exists in this world. Bucky goes to his house. He kills Rumlow.
He’s pretty sure this is the kind of stress relief his therapist was talking about.
[Percy]: James this is so fucking weird
[Percy]: Dan is grading stuff
[Percy]: Mal is writing an email about attendance records
[James]: Awful, but not as horrific as what I just went through.
[Percy]: Oh, dear.
Over dinner, they revisit the topic of how to get out of their festive prison.
“It could have something to do with the B-plot.” Percy suggests again.
“Maybe.” Bucky acknowledges. “But what could that even be? Unless you have a failing small business…” He trails off hopefully. Percy shakes his head regretfully. “Still no. Nor am I a single parent with a child that could get suddenly hurt, sick, or go missing.”
“Damn.”
“Maybe it’ll be over on Christmas day? The movies always end right after Christmas.”
“It could be a social aspect? Especially if we’re right about the character archetypes we fit into—maybe if people actually fucking know we’re together, they’ll leave me alone.”
“Kiss under the mistletoe at the work Christmas party?”
Bucky stares at his boyfriend through his fingers. “Love, at this point, I’ll fuck you on the floor under a Christmas tree, if that’s what it takes.”
Percy chokes on his pizza, and Bucky almost has to give him the Heimlich.
“Hey, Barnes—” Natasha pokes her head into the breakroom. “Have you signed up yet?”
He looked up at her. “Signed up?”
“I keep forgetting you’re new here.” She fully enters the room and places a clipboard down on the table across from him. “Every year, for Christmas, the town does a volunteering event down at the preserve—cleaning up trash and weeding out invasive plants. The whole station always goes. There’s usually a group that hands out hot chocolate, too.” She prods. “It’s a good time, Barnes. Do some community service, help out nature…meet some people…”
From behind his sandwich (triangles, cut in triangles, Percy made his lunch) Bucky seethes. “Natasha…”
She puts her hands up. “Fine, fine! Just…come, okay? Please?”
“Maybe.” The second she leaves, he pulls out his phone.
[James]: Did you know about the preserve clean-up?
[Percy]: Mal was just talking about it.
[Percy]: Let me guess; your frozen, shriveled heart will be thawed while weeding plants and picking up beer cans and used condoms?
[James]: The fact that she genuinely thinks that is extremely upsetting.
[James]: I’m sorry, used condoms?
[Percy]: I’m still a little unclear of whether or not I had my abilities and just forgot about them, or something, but now I am very, very aware, and, James, I swear to the Gods
[Percy]: These kids think they are so fucking stealthy.
[James]: …Are they?
[Percy}: Not in the slightest.
[Percy]: It’s not even because I’m blind. They do this to all the fucking teachers, and, James, sometimes it works.
[Percy]: Yesterday two kids asked to ‘go to the bathroom’ and came back, not only covered in hickies, but with Taco Bell.
[Percy]: Dan did not notice.
[James]: …Any chance that’s just the magic?
[Percy]: Unfortunately for humanity, both Dan and most teenagers are just like that.
The clean-up lasted two weeks up until Christmas. In the name of trying to go along with whatever the fuck was happening, Bucky signed up with the rest of the station, and Percy signed up with the rest of the school staff.
“I’m pretty sure they’re going to put me on hot chocolate duty, so…have fun with the trash, love.”
Bucky smiled sweetly at his boyfriend. “You sure you don’t want to echolocate used condoms? For the good of nature?”
The face Percy made in response made Bucky just about keel over laughing.
The first day, he got paired up with Natasha. The two of them got assigned a sector of the preserve and combed over it with rubber gloves and trash bags. She did most of the talking, but that was typical for them. He listened as he sorted through what could be recycled, adding in short comments about whatever story she had launched into.
At the end of the day, they reported back to the entrance of the preserve, where dumpsters were lined up. True to his prediction, Percy was sitting under a small portable canopy with Bridgette and a woman he didn’t recognize. He must have stared for just a moment too long, because Natasha, not even ten minutes later, cheerily informed him that she had to run some errands tomorrow and he would have to be paired with someone else.
And, wouldn’t you know, the woman from the hot chocolate table had volunteered to stand in for her.
The next day, Bridgette was waiting for him. She introduced herself with a smile, and, when he shook her hand, he could feel the entire station’s eyes on him. He did not give a single one of them the satisfaction of eye contact as he went to grab some garbage bags for the two of them.
It was easier to talk to Bridgette. While she didn’t really remember at the moment, they had spoken before. Gone on dangerous, international missions together. He knew her. She didn’t know him, but she was still Bridgette.
“Don’t get me wrong, I love my wife, but…I cannot mess with bugs.” She was saying with a shiver. “I’m happy for her, don’t get me wrong, but when she volunteered to do the entomology survey…” Bridgette shook her head. “The hot chocolate stand was just calling my name.”
He’d laughed at her, just a little, and she’d thrown a crushed soda can at him.
The Chief, Martins, Cody, and Landen are all standing very, very inconspicuously at the dump site. Bucky makes the mistake of smiling at Bridgette as she speaks while they’re in view, and the group breaks out into furious whispers.
He looked them all dead in the eyes as he waves goodbye to Bridgette and politely asks her to give her wife his regards.
He lived through the Great Depression, the second World War, and then became an assassin, and yet he has never seen a group look so utterly devastated.
The third day is, somehow, worse. He gets paired up with Ross, and Percy is visibly holding back a laugh as the two of them shake hands. Don’t get him wrong—he doesn’t hate Ross, not in the slightest, but one can only hear the phrase deez nuts so many times before beginning to fight the urge to return to being an assassin.
By the return, the thought of strangling Ross must have reflected on his face, because Maria, Kelley, and Cole—the ones oh-so-casually waiting near the entrance, lose an alarming amount of color.
Thursday, heavy snow results in the clean-up being postponed. The roads are too dangerous to go out, and practically the whole town stops to take a breath, to watch the snowfall from the safety of a heated home.
Bucky spends practically the entire day in bed, having hauled his space-heater boyfriend atop him. Percy, his head on Bucky’s chest and his arms wound around his waist, is more than willing to lay there with him. They switch between quiet words and bouts of comfortable silence.
Percy rubs the side of his face against Bucky like a cat. His breath is warm against his neck. Bucky runs his hand up and down Percy’s bare skin, thumb tracing up and down a scar that goes a few inches up his spine—it’s one of the older ones, a spear that caught Percy when he was sixteen. Bucky feels as if he knows each and every one, the story and the pain and the feel of the mark against his fingertips and his lips.
They spend hours like that, lazing in eachothers arms and exchanging languid, soft kisses. Percy’s hair, the longest it’s ever been since Bucky’s met him, twines around his fingertips as he gently tugs his boyfriend back up to his lips. “Love you.” He murmurs against him.
Percy’s knees rest on either side of his hips. “I know.” He says, ducking down to kiss him once more. “And I love you,” Another kiss. “Enough to fall in love with you twice.”
Bucky’s phone rings shrilly. He groans and grabs for it.
“HammerTech.” Tony snarls through the line.
Bucky blinks. “...No, this is Bucky.”
“Fucking HammerTech, Barnes! They bought the fucking preserve!”
Next to him, Percy’s eyes widen and he sits up. “What?” He whisper yells.
“They bought the preserve?” Bucky repeats.
“Yeah! They’re going to turn it into some fucking rental properties to advertise their piece of shit temperature regulation systems. They’re going to tear down the entire fucking thing!” Tony yells.
“Shit—they can’t do that, can they?”
“I didn’t fucking think they could, but here we are.”
Percy, who could clearly hear both ends of the lines, frowned. He moved to get out of bed, but Bucky’s arm around his waist tightened. Percy let out a small huff, but leaned in to him.
“It’s a crock of shit—I’m sorry, Barnes, did I just hear another human being with you? In your home?”
Bucky thunks his head onto his pillow.
“You’re in bed?” Tony shrieks. “Oh, my God, Barnes! You’re in bed with someone!”
Bucky looks at Percy, who’s wearing his sweatshirt and—well, that’s it, actually—in his bed, Bucky’s arm around him. He rubs a small circle into Percy’s hip with his thumb. Then, in the flattest voice he can muster, “Don’t be an idiot, Tony. Who the fuck would I be with?” He slides his hand a little lower. “I’m going to look into this HammerTech shit. I’ll call you back.”
He drops his phone on his nightstand and hauls Percy into his lap.
“Fall in love with me twice, hm?” Bucky asks, something soft and satisfied and all-consuming on his face.
Bucky looks into HammerTech, just like he said he would. Just…a few hours later.
“Not that much seems different. Justin Hammer, still a piece of shit. Not a supervillain, but—”
“That preserve is one of the most biodiverse green spaces in the whole region. Hundreds of native species rely on it, and it’s home to a dozen endangered and threatened species. Justin Hammer wants to build condos on it. He’s a supervillain.”
“...That’s fair. This Christmas kind of fucking sucks. Last time was better.”
“I did get to fight a dinosaur.”
“You were hot.”
“Thank you.”
A beat. Bucky looks up from his computer. “Why don’t we just kill him?”
“What?”
“I mean, we solved last year’s problem with murder.”
“...We did do that.”
“I killed Klaus.”
“See you in Jingle Hell. I remember. It went on the list of reasons I’m in love with you.”
“Aw.” Bucky blinks. “So, we’re killing him?”
“Oh, most definitely. He’s a dead man walking.”
They decide that it’s more than a two-man job. Especially, the next day, HammerTech surveyors come into town.
The reception they receive is…less than optimal. Kids throw snowballs. They’re made of ice and rocks, but they call them snowballs, and, really, who is Bucky to correct them? They walk by a barista telling one of the surveyors that they’re entirely out of coffee, sorry, as she serves someone else a large cup.
“Do we have time?” Bucky mutters as he and Percy walk down the sidewalk.
“A Girl Scout Troop just walked into the site with hardhats and safety glasses on.” He says. “Some of them are in my classes. They love the preserve. Use it all the time.” Percy hums. “They also just got their advanced electrical engineering badges.”
At the edge of town, the entire surveying site goes dark.
Bucky leads Percy right into Tony’s lab, where the man himself is standing, back to the door. “Hey, Stark!” Bucky yells. Tony turns and does a double take. “Mr. Jackson? Barnes, did you kidnap my kid’s teacher?”
“He enjoyed it.” Bucky dismisses. He strides forward, grabs Tony, a burning intensity in his eyes. “Look at me. Tony, none of this is real. All of this is fake. I don’t even think this is a real town. We’re under the influence of a powerful spell casted by an elf named Tinsel.”
Tony very slowly reaches for his phone and nods. “Yes, we are, Barnes. Yeah. Why don’t you take a seat and tell me more about it.”
Bucky does not do that. He lifts Tony clear off the ground. “Tinsel, Tony. Listen to me. Are you listening? I’m done with this Hallmark matchmaking Hell. No town has this much cheer or charm. Do you understand?”
Tony looks over Bucky’s shoulder at Percy, who’s clearly not paying attention. “Mr. Jackson?” Tony gets out.
Percy looks up. “Yes. Tinsel. Hallmark.” He confirms.
“Barnes,” Tony says slowly. “I’m going to call your psychiatrist, alright? Everything will be fine. Just calm down. Did you take anything? Any pills, did you drink?”
“I’m not high, I’ve been involved in a Christmas matchmaking scheme.” Bucky breathes, eyes alight. “Tony, we’re getting out of here. All of us.”
Tony’s eyes are wide, face pale.
“We’re grabbing the others, we’re killing Justin Hammer, and we’re leaving.”
“You want to kill Hammer? Jesus, Barnes, why didn’t you just say so? I’ll get the car.”
The car ride is quite nice, actually. Percy gets passenger. Bucky goes in the back.
“So, have you snapped out of it, or is this just your natural bloodlust overpowering the spell?” Percy asks politely.
Tony, from the driver's seat, is smiling. He hasn’t stopped smiling since the words kill Justin Hammer had been spoken fifteen minutes ago. “I have no idea what you’re talking about.”
Percy hums, going silent as he thinks. There has to be something he can say to get Tony to remember—something that doesn’t fit in this world, but is important enough to be unforgettable. Something that gave him the same rush of feeling as Bucky’s lips on his did. Something he cares about. Not just important, but your entire world.
“Spider-Man.”
Tony turns onto the main road. “What about him?”
“Who is he?”
“I’m sorry?”
“Spider-Man.”
“He’s—he—” Tony falters. “He’s a hero.”
“Oh,” Percy relaxes into his seat. “I’ve never really been into comics.”
“No.” Tony’s voice is distant. “He’s real. I—I know him.”
“What, in Westblooms, Vermont? He on the PTA?” Bucky says from the back.
“In New York. He lives in New York. So do I. We—” Fortunately, the road is deserted, because Tony slams on the breaks, tires screeching against the road. “What the fuck?” He screeches. “Where am I?”
Bucky grins. “Drive to the school. We’ll fill you in on the way.”
It’s a day off for the students—the only ones there are for a few sports and activities, including AcDec.
Tony walks right into the empty classroom and grabs Peter. All his friends, sitting in a circle on the floor with flashcards, look extremely confused. “Hi, Mr. Jackson.” Cindy says after a second. “And…you’re the firefighter, right? From the assembly? Mr. Barnes?”
Bucky grins. “That would be me.”
Behind them, Tony quietly talks to Peter. “Hey, kid. Can you do me a favor?”
“Sure!” Peter says immediately. “What do you need? Is everything alright?”
Tony looks at the kid— his kid— for a moment. “Do you remember your Uncle Ben?”
Peter’s face goes somber. “Of course I do.” He says. “Why?”
“Think about him for me. About…what happened to him, about what you did after. You don’t have to say anything. Just…think about it.” Tony prompts gently. He watches as Peter stares at the carpet, his brow furrowing. He blinks once, twice. Then, he looks incredibly lost. “What…”
Suddenly, Percy is there. “Spider-Man.” He says. “Spider-Man and…”
“Iron Man.” Peter finishes without even thinking about it. “Spider-Man and Iron Man.” He looks up at them. “What is that? Why do I know that?”
“Where did you meet Tony, kid?” Percy prompts.
“2010. Stark Expo. He saved my life.” Peter says it immediately, the way he recites answers and natural laws, like it’s one of the simplest facts of life. “Iron Man saved my life. He made me want to be a hero.” Then, the boy goes completely still. His head snaps up and he meets Tony’s gaze. “Oh, my God.” He breathes. Then, he barrels into Tony with a hug.
Meanwhile, on the other side of the room, Bucky looks at the assembled AcDec kids. “So,” He says after a long moment. “We brought you something.” On the nearest desk, he places a drink cooler and a stack of cups.
The kids don’t even question it. Abe shoves Sally with an out of my way, nerd, and fills a cup. Cindy is right behind him. Bless their hearts, they don’t even ask any questions.
“Essential oils.” Cindy says after taking a sip.
“Dried watercolor paint bricks.” Abe corrects after trying it.
“Lunchable pepperoni.” Betty says, something faint in her voice.
“Subway floor.” Ned disagrees. “Rat poison.” He’s staring at his cup. Then at Peter. Then at MJ.
“Laced grape Fanta.” Charles’s voice is soft.
“...Where did we get that?” Sally says quietly. “It…why do we know what that tastes like?”
MJ hasn’t even taken a sip. Her knuckles are white around her cup. Her eyes are locked on Peter.
“Okay, while you’re all in this exact state of mind, I want you to look at Mr. Jackson, over there.” Bucky directs them. “Now, imagine you’re in a school. A different one. The building has collapsed. He’s there, covered in blood, and he’s holding up a giant piece of the ceiling with his bare hands. He has just saved your life. And…”
Charles drops his cup. “Holy fuck, our teacher is hot.”
“How have we been learning anything?” Sally is already drooling.
“We haven’t,” Abe says, dazed. “Because—”
Bucky points at Betty.
“Because that’s not our teacher. He’s not a teacher. He’s a government agent. He’s a Commander with powers and he—” She says.
“Carried me after Peter beat the shit out of a Rhino man. He’s stacked. It was like being held by Ti-6Al-4V titanium alloy.” Cindy finishes.
Bucky leaves them with their Drink. Their cups will probably catch the drool. Ned and MJ have walked over to Peter. The three of them are having a quiet conversation. Peter is nodding along while also draining their cups of Drink.
“What did you do?” Tony whispers to Bucky.
“They just kind of came that way.” Bucky replies.
Percy doesn’t even notice.
The staff is next.
“Mal, where do you work?”
“Certainly not Party City.”
“We don’t have a Party City in Westblooms. Why did you deny that so quickly?”
“Certainly not because I secretly have been a manager at Party City for the last few years while also maintaining my top secret government agent job.” A beat. “Wait, what?”
“Yeah. Also, I really don’t know how you thought you could keep that one from me.”
“Hey, Dan?”
“Yes, strange fireman?”
“What’s with the tramp stamp?”
“How did you know about that?”
“I saw it while you were in the hospital—”
“—because I got shot in the ass on a mission. Fuck. Forgot about that.”
“...”
“Wait—”
“Ross?”
“What’s crackin’, Jackson?”
“I told you the next time you said that—”
“You’re sending me to work in Lee’s creepy morgue, I know.”
“Correct, though that might be preferable, considering you willingly spend seven hours a day surrounded and outnumbered by thirty teenagers.”
Cue horrified screaming.
“Hello, Bridgette.”
“Hi! Are you with Jackson?”
“Yep. But you already know that, because I told you—”
“Never repeat that. I told you to never repeat those words. Ever. I get you’re in love, but never say that about my boss to me again.”
“Boss, hm? Thought you were all teachers.”
“He’s the Commander, Barnes, you know this.”
“Oh?”
“...Hm”
“Lee.”
“Jackson.”
He puts a single hand on her shoulder. “You pay taxes here.”
“Jesus, Mary, and Joseph.”
“Hey, Spencer. You’re Lee’s TA, right?”
“...Yes.”
“Right. So, this is all fake, mutants and aliens are real and waiting for us in the real world.”
“...”
“Sorry, let me rephrase: you’re a ginger, the world’s most horrific and unnatural phenomenon. Keeping that in mind, do you really think that aliens and Enhanced are out of the question when you look like that?”
“...No.”
“Good talk.”
They all take a seat in the classroom. The AcDec kids still haven’t closed their gaping mouths, but now they’re looking at the newly assembled SWORD members as well as Percy. Bridgette is quietly soothing a distraught Lee— “We can do some civil disobedience to make up for your good citizenship when we get back, baby, don’t worry—”, Ross is staring at the classroom, horrified, Dan is mistrustfully staring at Bucky, and Mal is giving Percy nervous looks, and Spencer just seems resigned.
“—so, we’ve figured out the secondary plot seems to be the destruction of the preserve. We stop it, movie is over, we get to go home, Questions?” Percy briefs. The AcDec team nods in sync without even processing any of his words. Whores.
“How are we going to stop it?” Bridgette asks politely, one hand still rubbing a very distressed Lee’s arm.
“We’re killing Justin Hammer.”
Ned raises a hand. “And we’re sure this is all fake? Killing a famous tech CEO would really mess up my college applications.” There’s a murmur of agreement.
“Well,” Bucky says. “Considering I worked with Brock Rumlow, I’m pretty confident in saying that this isn’t real.”
“Who?” Cindy whispers to Peter.
“Hydra guy that Percy killed a while back. He sucks.” Peter whispers back.
Tony chokes. “Rumlow is here?”
“…Was.” Bucky replies.
Tony gives him a fantastic impression of the :/ emoticon.
“In my defense, he did hit Percy.”
Tony squints. “ …Alright.” He relents.
Ross breaks in. “Okay, but how are we actually going to do it?”
Percy grins. “First, we need to get some more help, I think.” He turns to Tony. “How is Stephen doing, by the way?”
After some quick rock, paper, scissors—somehow entirely unrelated to the decision, Bucky’s not really sure what it was for—they split up in the same groups as last Christmas. Well, they plan to. They still need Natasha and Strange.
First things first—Natasha.
“How do you plan on breaking her out of it?” Percy asks quietly as they walk into the station.
“Trust me on this one.” Is all Bucky says.
They get a few wide-eyed looks from Bucky’s coworkers as they walk through the bullpen. Bucky definitely catches a shocked “...Is that guy Barnes’s hostage or something?”
Rude.
The breakroom is empty except for Natasha. She looks up when they enter, and something delighted curls over her face when she sees Percy. She opens her mouth, probably to make some sort of comment about him finally making friends or putting himself out there, but Bucky beats her to it. “Hey, Romanoff.” Then, he grabs Percy, spins him to face him. A hand on either side of his face, Bucky yanks Percy forwards and kisses him soundly. Automatically, Percy’s hands come up to rest on his chest, even as a muffled, surprised noise escapes him. His lips are soft and familiar, he tastes like chocolate chip cookies and something uniquely sweet and God, Bucky loves his boyfriend.
“Fuck, Barnes, are you trying to eat him? Jesus Christ.” Natasha finally says. Bucky breaks the kiss and is treated to Percy’s flushed face and slightly gasping breath. He looks at Natasha, hands still cupping Percy’s jaw. “You remember now?”
“…That is certainly hard to forget.” She blinks as it all comes back to her. “Why the fuck did I think you needed to be set up?”
He shakes his head solemnly. “I’m just glad you see the light.”
“Yeah, I’m pretty sure Percy did, too. Were you trying to set a record or something? Do you not need air?” Natasha asks incredulously. Bucky grins, unrepentant, as he waves her off. “Come on. We’ve got a murder plan to carry out.”
Natasha doesn’t even ask. She’s one of Bucky’s favorite people.
Even though she is definitely making a lot of gestures to the gaping firemen as she follows him and Percy out the front doors.
Natasha thinks he can’t see her stick her pointer finger through the connected pointer and thumb of her other hand, right at the Chief, after pointing to him and Percy.
Natasha would be wrong.
…He really does enjoy how Cody chokes on his coffee, though. The Chief also might have passed out. Maria and Landen barely catch him. Johnson and Kelley both drop their stacks of paperwork while Cole gives Cody the Heimlich.
“…That was your plan?” In the parking lot, Percy finally finds his voice, slightly hoarse.
“Yep.”
“…Think we can get Tony and Strange to do something similar?”
“…In the name of Christmas miracles, maybe.”
Meanwhile, at the research center, Peter Parker kicks open the door labeled Stephen Strange, MD. Fortunately, the man is there at his desk, because, otherwise, that would have been very awkward. “Dr. Strange.”
The man’s eyebrows are raised. “Yes, Peter?”
“Oh, you know who I am. That’ll make things easier.” Peter strides into the room.
“…Of course I do. T—Dr. Stark never shuts up about you.”
Hm. Momentarily tabling those emotions so he doesn’t start crying in the middle of the plan. That would just be embarrassing. “Do you believe in magic?”
“…No.”
“Hm. That doesn’t make sense, because you totally do.”
“I really don’t, kid. Do you actually need something?”
“Just for you to admit you believe in magic and that you also do magic.”
“Peter, I don’t.”
“Yes, you do.”
“I do not.”
“But you do.”
“But I don’t.” Strange’s teeth are gritted.
“You totally do,” Peter sings, leaning further into his space.
“I. Do. Not.”
“Yes. You. Do.”
“Kid, I swear to God, I’m trying to work—”
“On your wizard stuff, I know. Because you’re a wizard.”
Strange slams a hand on his desk. “I’m a sorcerer, damnit!”
Peter grins, going silent. Strange blinks, then looks around. Peter watches expectantly as the man takes in his surroundings. Then, quietly, “Wong is never going to let me hear the end of this.”
Grabbing his hand, Peter drags him out of the office. “Come on, Mr. Dr. Strange! We’ve got things to do! Christmas movies to escape, CEOs to kill, and you’ve still gotta kiss my dad!”
“Yeah, okay— what?”
“Don’t even worry about it, actually.”
“Mission success!” Both Peter and Bucky yell as they enter Percy’s home. Strange’s face is bright red, for some reason. Actually, so is Percy’s. Weird.
Lee, still suffering from the knowledge that they had been paying taxes, had helped herself to Percy’s kitchen and had stress baked some snickerdoodles. The AcDec team is spread out on the carpet in front of the fireplace with Mrs. O’Leary, SWORD team members scattered on the couches and in the kitchen. Tony is helping wash dishes, sleeves rolled up. Strange makes a noise like a dying animal, and Tony looks up. He smiles as the sorcerer. “Hey, Stephen.”
He clears his throat. “Tony.” He acknowledges. Natasha gives Bucky a look, and he nods. She grins.
Well, as long as he’s not her victim anymore.
They stand around Percy’s kitchen, cramped shoulder-to-shoulder. Peter and Natasha, with creepily similar smiles, end up nudging Tony and Stephen to stand next to each other. Percy is pressed up against Bucky’s front, Bucky’s arm around his waist and chin on his shoulder. Lee is supporting both Dan and Bridgette. Peter is holding Ned, bridal-style. Cindy has Charles on her back.
“There’s a survey team—twelve, out in the preserve. Not sure where they’re staying. The inn refused them any rooms, so,” Percy shrugged. “They have a base out on the edge. Nothing big.”
“But,” Bucky continued for him. “Go big or go home, and we can’t really go home at the moment. Thanks to the efforts of our local PTA, Girl Scout Troop, and Native Plant Society, Hammer himself is coming to Westblooms for a press conference about the development.”
Charles, staunch birdwatcher, nods solemnly. “He will not make it home.”
They split up into two.
Tony, Stephen, Natasha, Percy, Bucky, MJ, Ned, and Peter go in one direction, and the SWORD team, plus the remaining loose teens, head for the preserve. Cindy and Charles delegate them Team Silly Goose and Team Serious Goose. None of them really have the heart to argue.
Team Silly Goose—consisting of the SWORD team, Sally, Cindy, Betty, Charles, and Abe, loads up in Lee’s truck and Mal’s Volkswagen. Mal’s car only really fits four, so her, Bridgette, Mal, and Ross get in. Lee drives her truck, Dan in passenger, and Spencer, Sally, and Cindy get in the back. She puts Abe and Betty in the truck bed.
First stop, Bass Pro Shop.
The only other person in the store, a large, bearded man in a camouflage jacket, gives them some strange looks. Lee, whom he had to crane his neck to make eye contact with, just nodded at him. He nodded back.
Loaded with their bags, they then head out to the preserve, passing some very, very triumphant looking Girl Scouts in hardhats and neon vests on the way. Lee and Mal park on the side of the dirt road, hidden behind a bend. It’s barely four o’clock, but the sun is already dipping low on the horizon, casting long shadows about the trees. They kill their lights, sitting patiently in the darkness. It’s dead silent out, save for the distant rustling of wildlife in the foliage surrounding them. They wait for almost fifteen minutes before the road comes to life, a short procession of trucks speeding past them, going in the opposite direction.
“Jackpot.” Ross whispers. “Alright, everyone out.”
The frozen grass crunches quietly under their feet as they creep up the side of the road, approaching distant, blinding lights. Charles makes some very angry, vulgar comments about light pollution and bird migration.
The surveying site is a hastily constructed camp, a circle of trailers and a few canopies. There’s already construction equipment parked nearby. Mal pulls out a flashlight from her Bass Pro Shop bag. “Not everyone left,” She whispers, shining it across the gravel pathway. One of the trailers still has lights on.
“Here, take these Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port.” Ross replies, handing out the radios.
Cindy pokes at hers, experimentally turning it on and off. “Wow, this is a really cool Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port.”
“Right?”
“Are we sponsored?”
“...No.”
Armed with their radios, they spread out. Dan heads for the largest trailer, a bundle of cords and a USB in his hand, and Charles trails along after him. Mal and Cindy go for the occupied one. Bridgette and Betty go for the nearest abandoned one. Lee and Sally head off to the side, towards the construction equipment lined up against the gravel. Abe, Ross, and Spencer grab another Bass Pro bag and head for the back of the trailers.
“Three, two, one—” Mal whispers through their Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port. Bridgette grabs a rock and smashes the lock of the empty one. Betty stares at her, open mouthed, and the woman grins, tossing the heavy stone in her hands. Charles, hyped up on candy canes, rams his shoulder into the door of another until it gives and grants him and Dan entry. Mal and Cindy just open the door of the occupied one, walking right inside and ignoring the surprised shouts of the person inside.
Dan and Charles head straight for the computer inside the large trailer. Dan pulls out a computer from—well, Charles has no idea where—and connects it to the desktop. Then, to Charles, “Fuck up the rest of the trailer while I do this.” He commands. Charles, constructed of many complex allergies and delicate, pale skin, grabs a sledgehammer and proceeds to have the time of his life.
One trailer over, Betty and Bridgette first go for the cabinets and take every canned good they can find. Then, Bridgette does Betty’s hair in a beautiful braid. Lastly, they crack open the cans with a large meat cleaver and begin to make artwork out of the contents.
In the last trailer, a terrified scientist scrambles back against the wall. “Hey, there.” Mal says, a wild grin on her and Cindy’s faces.
Meanwhile, outside—
“Is this enough?” Abe asks.
Ross looks down consideringly. “Eh. A little more won’t hurt.”
They look to Spencer, who is asleep in a grass patch a few feet away.
Abe pours more fertilizer.
The plants will take over the trailers soon enough.
Muffled screaming sounds from the middle of the small trailer circle. Abe dumps the rest of his supplies into the ground and follows Ross towards the commotion. Cindy and Mal are very determinedly restraining a terrified man with wrapping paper. Cindy gags him with a length of candy-striped ribbon. Through mad laughter, Mal calls out to them. “You guys ready to leave?”
“We are!” Charles yells, appearing in the doorway of his and Dan’s trailer with a flushed face and wild look. He’s holding a sledgehammer. It’s dented.
Betty and Bridgette emerge as well. They have matching hairstyles and their hands are covered in all sorts of tinned foods, similar to kindergarteners after a lengthy finger-painting session. “We’re leaving?”
Across the site, there’s the deafening roar of an engine. They all whip around, and are suddenly blinded by an enormous pair of headlights. It’s massive, at least thirty feet tall, and they crane their necks up to stare at the cab. Sally pokes her head out, waving crazily. “Look what we got!” She screams down to them.
“Holy shit,” Ross breathes. “Lee, you crazy motherfucker.”
Lee revs the engine of the construction hydraulic shovel. “Hop in.”
They don’t all fit in the cab, but it’s not even a problem, because the majority of them get into a fight about which of them get to ride in the shovel itself, until Lee patiently tells them that it can hold over a hundred tons, and that they can all fit in the hydraulic shovel.
Spencer wanders over, face scrunched with sleep. He pokes his head through the broken window of the trailer Betty and Bridgette were in. “Who broke the window with a can of green beans?” He wonders aloud. Then, “Oh, shit, is that a baked bean and canned corn recreation of René Magritte’s Son of Man?”
“Yep!” Betty replies proudly.
He looks around for a second before his eyes land on the giant excavator in the middle of the site. “Oh.” He scales the side of the machinery and slides into the shovel with the rest of them. Then, he looks over to see an unfamiliar, scared shitless man restrained with snowman wrapping paper. “Hey, who’s the new guy?”
Justin Hammer steps out of his hotel—the next town over, to his annoyance, because, apparently, every single inn was completely full in Westblooms—to see his limousine waiting for him. The chauffeur steps out and opens the door for him, and he wordlessly gets in.
He pulls out his phone and makes a call to the team lead, telling him to gather everyone and head into town for the press conference. Then, he speaks to his assistant, going over last minute details and practicing the speech he’d had her write for him.
By the time he can relax, they’re already at the edge of Westblooms. His chauffeur takes him through the main road, up to the town’s only public park, where a large stage sits. It’s usually made for community theater and music performances, but it’ll have to do. He’s driven into a side parking lot, and the car is put into park. After a few long minutes, Justin looks up from his phone for the first time. “What’s the problem? I have a schedule to keep.” He demands.
His chauffeur turns around from the front seat to look at him and—it’s a teenage girl. The passenger seat is also occupied, by a boy who looks her age. “Sorry about that, Mr. Hammer.” The girl says, sickly sweet. “We’ll get right on that.”
She gets out of the car. The boy follows and opens the door for Justin. He steps out, giving them a long, annoyed look. God, this is the best this shithole town can do? Two fucking teenagers? He was certain he told his assistant to have his own people brought into town with him, but apparently she’s just as useless as he thought.
The girl pops the trunk.
To Justin’s mild horror, a third person crawls out—another boy, curly brown hair and freckles. “Hey, Mr. Hammer!” He says with a wide smile.
Justin takes a step back from the trio. It’s only then he realizes that they’re not wearing the uniforms for his limousine company. He doesn’t recognize the car, either. He turns, and—his bodyguards aren’t here.
“Come on, then! We can’t be late!” The freckled boy from the trunk chirps, grabbing Justin by the arm and pulling him into the park with a surprising strength. The two other teenagers follow calmly.
The entire town seems to be packed up against the stage, every single one of them in festive sweaters. He can almost smell the holiday cheer emitting from the mass. Justin pulls against the arm tugging him along, but to no avail. Sitting on the edge of the stage, a redheaded woman and a man in a thick green sweater talk quietly.
“Hey!” The girl standing next to him calls. “We got him!”
Suddenly, the crowd is silent, thousands of eyes turning to rest on Justin and his teenage kidnappers. He stops dead, but the boy drags him on further, through the crowd that parts like the Red Sea.
“Is that the preserve douche?” Someone from the crowd yells.
“Excuse me?” Justin exclaims before he can even think twice. “My name is Justin Hammer, CEO of HammerTech!” He says indignantly.
A little girl up front boos him.
“Hey!” He exclaims.
The two at the edge of the stage stand up to accompany the three teens to the center. Another man, broad shouldered and brunet, also joins them. “It’s the emotionally closed off fireman who needs to learn to love!” Someone from the crowd yells again.
The man ignores that last part with a surprising amount of grace. The yells of preserve douche continue.
A group of Girl Scouts at the front of the crowd are practically frothing at the mouth. A cluster of elderly with binoculars around their necks are clutching their canes aggressively.
“So,” A voice next to him says. “You want to chop down the preserve, displace all the natural, endangered wildlife, and turn it into a bunch of cash-grab condos?”
Justin splutters, turning to look at the man. Percy just raises an eyebrow at him.
The crowd begins to jeer.
Justin scrambles for the speech his assistant had written. “Removal of the wildlife will be done cautiously and with minimal harm—”
“What right do you have?” Another voice screams out. “Who are you to take their land?”
“We don’t want you here!” A tiny Girl Scout screams. A group of PTA mothers is scowling at him.
Justin looks around frantically and catches the eye of a man on the edge of the offstage right. “Stark?” He exclaims. “What the fuck?”
Tony Stark gives him a mock salute from where he’s reclining against the wall. Next to him, renowned neurosurgeon Stephen Strange is also there, for some fucking reason.
“Show some respect to Dr. Stark!” A grandmother yells, waving her cane. “He is a very nice man!”
Tony goes bright red, and Strange gives him a shit-eating grin.
“This guy is an asshole!” A teenager from the crowd announces. Yells of agreement follow.
“Wants to take our fucking preserve!”
“Ugly fucking condos!”
“Natural wildlife is important, dickhead!”
“Viva la native plants!”
Justin stammers. “It—the land has been bought. I bought that land.” His voice rises. “It’s my fucking land, now! Get used to it!”
A moment of silence, and then the crowd bursts, anger boiling up and out. Screams overlap each other, accusations and insults hurled from every direction.
MJ, a horrific little instigator. “Should we hit him with the wizard?”
“Wizard!” Someone screeches.
Justin Hammer looks absolutely horrified as the chant picks up. “Wizard! Wizard! Wizard! Hit him with the Wizard!”
“Send this fool to the shadow realm!”
“Banish this loser!”
Tony shoved Strange up to the front of the stage. He, too, is chanting.
“…I do not think this is what happens in Christmas movies.” Strange hisses to Tony. Tony just shrugs.
They hear the sudden crash from all around. Westblooms takes a momentary pause from their mob justice to watch as a 30 foot, 500 ton hydraulic powered excavator rolls into the park, a shovel full of screaming teenagers and almost the entire staff of Westblooms High School. With surprising ease and dexterity, the operator lowers the shovel and the occupants hop out. One of them is dragging a man restrained in wrapping paper.
It's silent for a moment before the man in wrapping paper spits out a bright red bow. “He’s an awful boss! Hit him with the wizard!”
Screaming cheers rise up once more.
Stephen Strange sighs, and Justin Hammer is picked up by a glowing tendril of magic and dumped in the excavator shovel. Inside the cab, Lee slowly swivels the excavator, and then presses full throttle on one of the controls.
And that is the story of how Justin Hammer is flung to New Jersey by a 6’9 Norwegian in a Santa Hat.
“Well,” One of the PTA mothers says. “That was nice. See you all tomorrow?”
Murmured agreement as the crowd begins to disperse.
Then—
“Wait!” It’s the Chief. He’s pointing at Bucky. “But did you open your heart for true love?”
“Oh, yeah! Hey! Random guy! Did you fall in love?”
“I almost forgot about that! Did you finally break down all those emotional barriers and let someone into your cold heart?”
The audible smack of Bucky’s hand to his forehead is heard around the world. “That is so not what this is about!” He yells.
“Uh, it kind of is.”
“Just a little.”
“I mean, that's why I’m here.”
“Same.”
Bucky appears to be doing breathing exercises. Then, overtop the crowd,
“Hey, Jamie!”
Bucky turns to Percy and is abruptly grabbed around the waist, and, in front of the entire town, dipped and kissed. Thoroughly.
The exploding cheers are overlaid by end credit music.
Bucky opened his eyes.
Slowly, he pushed himself up. He was sitting on the couch in the common room, his book still on the coffee table.
His mug of tea was still steaming.
Slowly, Bucky stood, blinking a few times to try and dispel the grogginess.
“That was adorable.”
Bucky whipped around. Fucking Tinsel was still standing there, beaming at him. “I mean, a little insane that you still beat the shit out of that guy before you remembered you were a super soldier assassin, but, still! So cute!”
They must see how entirely unamused he looks because Tinsel gives him a sheepish smile. “It worked, didn’t it? You guys are totally in love! You just needed a little push.”
…Fuck. Bucky’s so fucking tired.
He sighs dramatically. “He’s not here, so it doesn’t even matter.” Does he feel bad, manipulating the Christmas spirit? Not at all.
Tinsel claps their hands together. “I can fix that!”
A rush of snow, and Percy in unceremoniously dropped onto the couch. “What the fuck?”
Tinsel is bouncing up and down. “There! Now you just gotta show him how you feel!”
Bucky looks at his boyfriend. “Yeah. Yeah, I’ll show him. Later, Tinsel.” He grabs Percy by the waist, hauls him over his shoulder, and walks to the elevator. “Thanks for the help.”
As the elevator door closes, he can hear their voice. “...Well, damn. Wish they were all that upfront.”
Inside the elevator, still slung over his shoulder, Percy blinks. “James, love, what the fuck?”
Bucky gives his lower back a pat. “Don’t worry about it, darling. Merry Christmas, by the way.”
“...Merry Christmas.”
Notes:
i think i got possessed by mike perry, ceo of hallamark, and also a violent toddler on shrooms
thats the only feasible explanation for all of thisanyways guys meet tinsel
welcome to 60-ish pages of bucky being an absolute fucking simp
i hope you guys know during the scene where bucky and percy meet and i use the words 'his hand flexing once back at his side' i mean like in the 2005 pride and prejudice movie
one of the reasons i really excited to write this is that when bucky and percy actually met there was too much trauma and shit going on for bucky to properly flirt with percy like he so desperately wanted to
bucky: so my name-
percy: I Will Call You James
bucky:
bucky: :)tony and peter <3 <3 <3
did i put rumlow in here just to kill him again? yes. yes, i did.
bucky, the closed-off emotionally distant guy from the city, and percy, the small town christmas lover who's been burned by love before (lea stole his garlic bread when he trusted her to watch his plate while he went to the bathroom)
i love natasha, the little meddler. shes one of my favorite little guys
bucky and percy being so gay and violent that they break out of the genre
this is also The Knight Before Christmas propoganda. its on netflix. watch it.
"i love you, enough to fall in love with you twice" is my christmas gift to you all
TONY AND PETER IM AFHDSAGHKJDSQHGK
and YES i brought back the Drink from the end of The Lost Soldiers, it has so much power that it elicited the EXACT same reactions from them
bucky is such a shit i love him
SWORD is also little shits and i love them toobucky just wants to kiss his boyfriend yall pray for him
peter tony bucky and percy all got snapped out of it because of people they love. natasha snapped out because of her matchmaking scheme dedication, and strange out of pure annoyance. love that for them.
i am not sponsored by Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radios with Charging Port, for the record
christmas spirit is being gay doing crime and saving native wildlife
lee is not only forklift certified, but can drive pretty much anything with an engine. bridgette always tells her she doesn't need all these certifications. but lee showed her. this was her big day.
spencer just wanted to nap :(
justin 'preserve douche' hammer
for the record, eveyone DOES remember...all this. they just agree to never speak of it.
lastly, MERRY CHRISTMAS AND HAPPY HOLIDAYS! i love you all, and you amaze me constantly! have a great day :)
plumbing baby. goodbye
Chapter 42: lady of the lake? i think you mean leo in the lake
Notes:
(See the end of the chapter for notes.)
Chapter Text
drinking groundwater is good for the soul
teletubblees: you need to get dan into protective custody before we all kill him.
pj masks: …i need a bit more information to do that, i’m afraid.
teletubblees: tell your boytoy to check twitter.
pj masks: dan got twitter?
pj masks: i thought we all agreed he couldn’t do that.
teletubblees: and yet.
annlis @anli
we need more autistic cunt representation
dan @barbielaptop
@user1563632 lol
lee @user1563632
run.
dan @barbielaptop
caught bridgette jiménez lehey kissing another girl today at 9:34:21 AM
bridgette! @lavendarmenaced
Dan, are you referring to my wife?
dan @barbielaptop
#exposed
bridgette! @lavendarmenaced
You literally cried at our wedding.
dan @barbielaptop
‘ohhhh my computer has malware’ you mean your free friend????? you’re calling me and complaining about the free tamagotchi????? fuck you @mothmanass
mal(practice) @mothmanass
excuse me???
dan @barbielaptop
i may be an ugly and unlovable bastard in human terms but in gargoyle terms? lets just say i’d be at the top of the cathedral. @rossBOOMni, on the other hand, has a face that demands to be smashed with a sledgehammer in either terms.
ross (NOT the one from friends) @rossBOOMni
i have never felt more violent in my entire life
dan @barbielaptop
yo mr white drive me to barnes and noble i need to pick up the newest warrior cats book bitch
dan @barbielaptop
@spencer.st.james
spencer :) @spencer.st.james
what is this supposed to mean?
dan @barbielaptop
not arguing with a man with a fat ass, like whatever you say cake boss
Lee @user1563632
we all know who this is about, and the fact that you didn’t even try to @ him further lowers my opinion of you. i’ve told him about your account, by the way.
dan @barbielaptop
WHAT THE FUCK NO
dan @barbielaptop
wait he hates twitter
dan @barbielaptop
whats he gonna do lol
bridgette! @lavendarmenaced
I don't even feel bad for you.
dan @barbielaptop
???? bridgette ????
bridgette! @lavendarmenaced
You sent me 37 text messages that just said “girlkisser”
bridgette! @lavendarmenaced
Oh, 38, actually. I’m going to speed up the process.
bridgette! @lavendarmenaced
@jbarnes
dan @barbielaptop
oh.
scientists hate this local new yorker @jbarnes
hello, daniel.
centenarian, 30 ton hell puppy, toph from avatar = blended family
pb&j: so what did dan do?
jamie <3: dont worry about it, love
jamie <3: its been dealt with :)
pb&j: yeah alright
our family tree is a wreath
framk: hey so somebody shoved leo in the lake
sparky: oh my god why?? thats so mean
RARA: good.
pied piper: lmao
framk: …you guys are a very odd throuple.
pied piper: we prefer to be called an MLM, actually
framk: …right. hazel?
horse girl: @furbyslayer
pied piper: why’d you have hazel do it lazy ass
framk: pretty sure that nico and hazel are the only ones he has notifications on for
furby slayer: not true
pied piper: percy loves us all equally <3
furby slayer: i have them on for you as well, frank
pied piper:
framk: aw
furby slayer: i do love you all, but, piper, you send so many fucking memes and they dont even make sense to me
pied piper: ok its not my fault you’re like a year older than me but act like you’re EIGHTY
furby slayer: …
framk: hey piper
framk: is the idea of eminem throwing a crab funny
pied piper: like at someone?? not really??
framk: is this picture funny
pied piper: yeah lmao
framk: mhm….
pied piper: what
RARA: babe…
pied piper:
pied piper: !!
pied piper: so what im hearing is, i need to make my shitposting more accessible
pied piper: got it
pied piper: percy love of my life :( why didn't you tell me sooner??
furby slayer:
sparky: be nice
furby slayer: im finding it
sparky: percy…
furby slayer: my disability was the only thing saving me from your shitty fucking memes for the past couple years and i didnt want to disrupt my peace
sparky: PERCY
furby slayer: i didnt find it.
sparky: yeah no SHIT
pied piper: sobbing a little
furby slayer: cope.
pied piper: still sobbing but now im a little turned on
horse girl: piper??????
pied piper: what??? god forbid women do anything smh
furby slayer: frank, hazel, what did you need?
sparky: obsessed with how he’s just ignoring that
pied piper: ok mankisser
sparky: im sorry?
framk: is there anything we need to be worried about in the lake?
framk: leo’s just floating in the center and hazel and I need to know whether or not to leave him there
furby slayer: he should be fine.
pied piper: you heard me you whore
sparky: WHORE???
pied piper: two girlfriends and you’re still obsessed with another man. WHORE
sparky: you have a girlfriend and a boyfriend and you’re still making thirst comments about another man????
pied piper: oh so you’re gonna slut shame me?? Huh????
RARA: he will not.
pied piper: HA
RARA: jason is far too sweet to do that. I, however, am a bitch.
RARA: and you are a whore.
pied piper: REYNA???
pied piper: THATS IT
pied piper: OPENING APPLICATIONS FOR NEW PARTNERS
pied piper:
pied piper: heyyyyyyyy percy
furby slayer: do not.
horse girl: why are you harassing him
pied piper: idk its not my fault hes the ultimate package
sparky: wow.
pied piper: why are you booing me im right
pied piper: pretty eyes, cute dog, always warm and wears soft clothing, strong enough to hold me, can bake, and he’s literally royalty???
RARA:
sparky:
sparky: heyyyyyyyy percy
furby slayer: hi, this is bucky. percy gave me his phone and told me he didn’t want to deal with you people anymore.
furby slayer: frank, hazel, he says you two are the exception and he is very excited to get brunch with you both this weekend.
horse girl: hi bucky! we’re excited to see you two as well :)
pied piper: revolting.
furby slayer: hi, piper.
sparky: please ignore her, she’s normally better behaved than this
furby slayer: jason, i admire your optimism, but we both know that is a lie
furby slayer: oh?
furby slayer: hm.
furby slayer: excuse me.
furby slayer: goodbye.
mcshizzle: hes so strange
mcshizzle: no wonder he and percy work well together
horse girl: LEO!!! YOU GOT OUT OF THE LAKE!!!
centenarian, 30 ton hell puppy, toph from avatar = blended family
pb&j: why did you give this horrid thing back to me
jamie <3: lea is napping and i didn’t want to wake her up but we need to TALK
jamie <3: also i muted the chat for you because piper jason and leo started shrieking about something
pb&j: i love you so much
jamie <3: and yet you didnt tell me you were ROYALTY
pb&j: very technically, i suppose?
pb&j: its not like im going to inherit anything so i didnt see why it was important
pb&j: sorry
jamie <3: dont be sorry
jamie <3: this is fantastic
pb&j: …why?
jamie <3: because shuri keeps winning arguments by calling me a peasant and telling me royalty is always right
jamie <3: but now i can tell her that shes the princess of one country, sure, but my boyfriend is the prince of the fucking OCEAN
pb&j: i knew you were just using me for my status
jamie <3: dont forget your ass <3
jamie <3: STEVE ALSO OWES ME MONEY
pb&j: babe what
jamie <3: we made a bet on whether or not i would be able to seduce royalty one day
pb&j: …when was this?
jamie <3: 1933
pb&j:
pb&j: the implication that you seduced me is very bold
jamie <3: whats that supposed to mean
pb&j: i mean you just had the aura of a sad damp cat in a box in an alleyway and i was like ‘ooh’ and picked you up and took you
jamie <3: thats not how i remember that
pb&j: yeah?
jamie <3: pretty sure my variety of traumas and dashing good looks swept you off your feet and you immediately became obsessed with me
pb&j: ill call tony and tell him that you’re still having memory problems again <3
jamie <3: fuck you
pb&j: see this is why i dont feel very seduced
pb&j: you’re kinda mean
jamie <3: where are you
pb&j: and now you’re threatening me
jamie <3: answer the question
pb&j: our room
pb&j: if you try and attack me i swear to god
jamie <3: SWORD has the day off
pb&j: is this you trying to make me not call tony about your dementia
jamie <3: it is not
jamie <3: you don’t have anything to do today, right?
pb&j: a meeting at 4, why?
jamie <3: cancel it
pb&j: ???
jamie <3: you said you didn’t feel seduced. cancel your meeting
pb&j: jamie its not even noon, my meeting is at 4
jamie <3: im very thorough. cancel the meeting.
pb&j: ...oh
pb&j: canceling the meeting
Notes:
hot take: lee...doesnt really know buckys name. whenever percy talks about him he always calls him either 'jamie' or 'dickhead', some people call him 'barnes' some people call him 'bucky' and she just...never really asked. she didn't learn about american war heroes, okay? she can tell you all about norweigan ones, but shes not entirely sure what exactly sergeant james barnes...did. so she just kind of goes 'your man' or something and percys like 'yeah :)' and it works out for everyone
also the vast majority of these tweets are from SOMEWHERE but for the life of me i cant find the originals, if any of you happen to know where theyre from please dont hesitate to tell me
rip dan
leo in the lake...what will he do...
shuri screaming PEASANT at bucky and he just starts muttering under his breath about socialism
percy: hey so i need to cancel the meeting
hanover: why?
percy: ...
percy: listen...also can anybody see the image description i put in for the eminem crab picture?? just wondering
plumbing baby. goodbye
Chapter 43: your honor hes literally just a teenage girl
Notes:
(See the end of the chapter for notes.)
Chapter Text
bucky’s victims and also percy’s bimbos
moonmoon: [Video Attachment: A girl filming her boyfriend, who’s hair she has tied up in many pink ribbons.]
moonmoon: want to do this to him
avril lavigne: cindy what
tungsten dioxide whats this: im scared to ask who
murphy’s law: cindy i thought we talked about this
moonmoon: abraham lincoln <3
president lincoln: hello?
moonmoon: the 6’4 hunk with the on point hat game
moonmoon: not you, great value brand abe
president lincoln: what the fuck man
president lincoln: he wouldn't let you do that anyway
moonmoon: YOU DON'T KNOW
moonmoon: YOU WEREN'T THERE
The News(™): yeah…cindy i don't think the 16th president of the united states would let you tie a little pink bow around him
moonmoon: no he totally would you guys just don't see the vision
moonmoon: within ten minutes of meeting me he’d have a bow on his hat and he’d be telling andrew johnson how coquette he is
The News(™): cindy he was fighting a war
moonmoon: you are a WOMAN why are you hating like a MAN
moonmoon: betty i am literally just a teenage girl don't take this from me
moonmoon: ill siphon your gas
The News(™): :/
terminator: what are you people yapping about
nedleedle: abe
terminator: ?
nedleedle: the hot one
terminator: oh rip 💔
terminator: definitely one of the assassinations i regret the most
president lincoln: there is a great hatred festering in my heart
president lincoln: wait
avril lavigne: uhhhhhh
Scary Captain: …should you have said that?
terminator: what
tungsten dioxide whats this: sergeant…did you
tungsten dioxide whats this: did you kill abraham lincoln?
terminator: probably
moonmoon: 💔
terminator: sorry cindy
tungsten dioxide whats this: I Do Not Think You Were Supposed To Say That
terminator: eh
Scary Captain: you might want to tell pj that one
terminator: ugh i guess
murphy’s law: abe are you feeling unsafe rn
president lincoln: fuck all of you
nedleedle: omg you whore
president lincoln: those in glass houses shouldn't throw stones, nedward
president lincoln: coughSLUTcough
nedleedle: 😦
nedleedle: peter come defend me
tungsten dioxide whats this:
tungsten dioxide whats this:
tungsten dioxide whats this: h
nedleedle: peter…
tungsten dioxide whats this: ned…
tungsten dioxide whats this: i cant tell lies…im a civil servant of the people…
avril lavigne: didnt you like blow up a building yesterday
tungsten dioxide whats this: first off NO that was not my fault and second off that building had it coming anyway >:(
terminator: [Audio Message: “Are all of you fucking stupid? What the actual fuck is wrong with you kids? You go to one of the best schools in the Godsdamned state. Abraham Lincoln died in 1865. James wasn’t even born until 1917. What is wrong with all of you? You’re on an Academic Decathalon team, for fuck’s sake. Are you stupid? Is that it? He didn’t fucking kill Abraham Lincoln. Jesus Christ. Fuck.” ]
terminator: so percy says hi
The News(™): hhhnng
murphy’s law: just moaned a little
moonmoon: nothing like an aggravated manhattan accent to kickstart your day and i mean that in the most sincere way possible
avril lavigne: yeah so on second thought we definitely skipped a couple decades
nedleedle: indeed we did
moonmoon: so bucky hasn’t killed any presidents
moonmoon: that's good i guess
terminator: mmmm no i definitely have
terminator: it wasn't abe though i guess
terminator: his name was jim or something i think
The News(™): bucky did you interfere in foreign elections
terminator: yeah all the time lol
terminator: pretty sure this one was in america though
terminator: everyone spoke english
murphy’s law: i don't think we’ve ever had any presidents named jim though
terminator: well my memory is pretty solid these days and there was definitely a lot of red white and blue involved
terminator: his name was like jim k fonnedy or something idk
terminator: maybe he was australian
president lincoln: ooh maybe
tungsten dioxide whats this: maybe you should tell pj and he should like contact australia or something about it
terminator: if australia hasn't said anything, how important could it really be
terminator: besides hes busy right now and it looks important
our family tree is a wreath
pied piper: ass of tits?
my chemical ron weasley: peanus
furby slayer: id just like people to stop trying to kill us
furby slayer: peaceful retirement? home ownership? raising our 30 ton fluffy daughter? a boyfriend who isn’t easily convinced by a group of teenagers that he killed abraham lincoln?
sparky: percy…
sparky: lets have reasonable expectations here
furby slayer:
furby slayer: peanus
ethically sourced sluts
vintage bi: i don't like that look on your face
antique gay: rude
vintage bi: you have a distinct plotting expression
vintage bi: listen i barely smoothed things over with the POTUS facebook account after the last time you had that look
vintage bi: are you going to make dumb decisions on the internet again
antique gay: i like it when the strangers on twitter validate me, tony
vintage bi: attention whore
antique gay: really?? ‘I am iron man’ ??? bitch ???
vintage bi: yes but i accept and embrace mine
vintage bi: please don’t do anything stupid
antique gay: im literally just a teenage girl tony
vintage bi: …you are a 101 year old man
vintage bi: who taught you to say that
antique gay: cindy :)
vintage bi: dear lord
scientists hate this local new yorker @jbarnes
i believe this is the ‘coquette’ that i have been hearing about
[Video: Though the face is cut off, you can see a man standing in front of the camera in a tee and basketball shorts. “What are you doing?” He asks softly.
The camera swivels to the left, revealing James Barnes cutting a piece of pink ribbon. “Don’t even worry about it.”
“See, now I’m gonna worry about it.” The man says, but obligingly sticks out his leg when Barnes approaches. Barnes ties the ribbon around his thigh and makes a neat bow. Behind the camera, a teenage girl giggles quietly.
The man just stands there with the bow tied around his leg. “...”
“Okay, now just like…flex.”
After another moment, the man does. The ribbon snaps and falls to the ground. Unfortunately, the camerawoman does as well.]
You Know Who I Am @TonyStark
I am going to block you one of these days
You Know Who I Am @TonyStark
How did you even get him to do that
scientists hate this local new yorker @jbarnes
he likes me so he does things when i ask, tony
scientists hate this local new yorker @jbarnes
also he's still a little bit in shock about the whole abe lincoln thing
You Know Who I Am @TonyStark
The whole what thing?
scientists hate this local new yorker @jbarnes
nvm
piru @pirepiro
HNNFDSFGDFAHBDSDH
annlis @anli
what the fuck what the fuck what the fuck
james @jimmyjammy
james barnes i Understand You
mimi @wheresmybeans
kicking my feet and giggling my god what the hell
bearbi @bearbi3
biting at the walls of my enclosure
Ferris wheel fighter @ihatecarnivals
respectfully 👀
our family tree is a wreath
horse girl: percy? you there?
furby slayer: yeah sorry
furby slayer: james and those teenagers i was telling you about just wanted me to do something really quick
pied piper: ?
sparky: odd
furby slayer: yeah they were giggling about something idk but then cindy passed out
furby slayer: she does that a lot actually
framk: does she have like a condition or
furby slayer: shes definitely got something
furby slayer: shes weird
furby slayer: all of peter’s friends are
furby slayer: tbh im more concerned about their influence on james than potential hydra plants in the WSC
mcshizzle: honestly that seems fair
mcshizzle: those children are fucking weird
my chemical ron weasley: very much so
my chemical ron weasley: also we’re still on for the bird call/voodoo contest today right
pied piper: of course
sparky: obviously
RARA: I will be there.
furby slayer: already got time off work
Notes:
unstoppable force (cindy and her undying lust for abraham lincoln) vs immovable object (bucky being convinced he killed him)
bucky, standing trial for everything he did while he was the winter soldier: your honor im literally just a teenage girl
hanover: you're so right. free of all chargespercy, a history guy, vs the acdec kids, stem people
jim k fonnedy
buckys so coquette omg <3
listen...percy has some fucking THIGHS okay. send tweet
percy: so...potential hydra plants could kidnap him and try to bring the soldier back.
percy: these fucking teenagers, on the other hand, are worse.plumbing baby. goodbye
Chapter 44: the 𝓰𝓲𝓷𝓰𝓮𝓻
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
[Tony Stank has added Natasha Romanoff to the chat]
Tony Stank: oh i know you did not just laugh out loud
Natasha Romanoff: 100% no mr. stank you must be hearing things
Tony Stank: i should have left you in wakanda where i found you
baby avenger: but ya DIDNT
Natasha Romanoff: im shaking a little who named you that
percenary: :)
Natasha Romanoff: will you consider a marriage proposal
skrunkly raccoon: i will rip your transverse cervical nerves out with my teeth
Natasha Romanoff: intriguing
[percenary has changed Natasha Romanoff’s name to ‘the 𝓰𝓲𝓷𝓰𝓮𝓻’]
Tony Stank: he strikes again
the 𝓰𝓲𝓷𝓰𝓮𝓻: wh
the 𝓰𝓲𝓷𝓰𝓮𝓻: i???
skrunkly raccoon: hey guys big life update
Tony Stank: oh god
skrunkly raccoon: i have decided that i am healed now and should ⋆✮🎀𝓆𝓊𝒾𝓉 𝓉𝒽𝑒𝓇𝒶𝓅𝓎🎀✮⋆
Tony Stank: hey how about lets not???
percenary: is this about the
skrunkly raccoon: YES
the 𝓰𝓲𝓷𝓰𝓮𝓻: what
percenary: still???
skrunkly raccoon: ITS WORSE NOW
skrunkly raccoon: STOP LAUGHING I CAN HEAR YOU
Tony Stank: some context would be nice
skrunkly raccoon:
percenary: ok so basically
skrunkly raccoon: do not
percenary: the therapist james has to meet with every now and then from the WSC (not linda, linda is great)
skrunkly raccoon: stop
percenary: is a Certain Way
skrunkly raccoon: perseus achilles jackson i am warning you
percenary: and is CONVINCED that bucky is still brainwashed because he keeps saying the minimum wage should be raised
the 𝓰𝓲𝓷𝓰𝓮𝓻: im fucking sobbing
Tony Stark: oh my god
baby avenger: just lasdguhedd so harfdd i hit a buildijgn
nedleedle: why did MJ just hit the ground wheezing
nedleedle: OH DSJGFJKSHAKJHFKS
skrunkly raccoon: thats IT
Tony Stank: oh i just heard percy scream
the 𝓰𝓲𝓷𝓰𝓮𝓻: yikes
baby avenger: damnb
Tony Stank: peter are you concussed again
baby avenger:
baby avenger: mno
mindiana jones: as soon as i stop laughing my ass off ill go get him
Tony Stank: thank you
Tony Stank: kid you have got to stop doing stuff like this
baby avenger: i font jnoiw wjhat yorure tlaking abooiut
Tony Stank: jesus christ
baby avenger: iim doijng famtasdtic
nedleedle: ok every time mj stops laughing peter sends another text and it gets her started again and its beginning to scare me
nedleedle: she laughs like the joker mr stark sir
nedleedle: I Think I Am Going To Go Find Peter Now
the 𝓰𝓲𝓷𝓰𝓮𝓻: should i check on percy? its been a couple minutes now and i can't hear anything
Tony Stank: uhhhhhh i mean
Tony Stank: be prepared to be scarred for life because every time they get in any sort of altercation, there's a slight chance it ends with them
Tony Stank: well
mindiana jones: they might be fuckin
Tony Stank: they might be yes
the 𝓰𝓲𝓷𝓰𝓮𝓻: hm
the 𝓰𝓲𝓷𝓰𝓮𝓻: ill take that risk only because i really want to know the rest of that story
Tony Stank: godspeed, soldier
the 𝓰𝓲𝓷𝓰𝓮𝓻: 🫡
nedleedle: i have retrieved the boy
nedleelde: [Photo attachment: Peter is laying face down on his bed. Ned has put a blanket over him and is giving a thumbs up]
Tony Stank: ned you're the only bitch in this house i respect
nedleelde: thank you
nedleedle: completely unrelated i am now sobbing
the 𝓰𝓲𝓷𝓰𝓮𝓻: mission: accomplished
the 𝓰𝓲𝓷𝓰𝓮𝓻: my eyes: not in need of replacement
the 𝓰𝓲𝓷𝓰𝓮𝓻: [Video attachment: Bucky is standing on one side of the common room, Percy on the other, a couch in between them. They seem to be having some sort of stand-off.
Percy: Stay away from me, you horrible man.
Suddenly, Bucky lunges, clearing the couch, and Percy screeches, backing away. Unfortunately, he does not make it in time, and Bucky pins him, proceeding to dig his fingers into Percy’s ribs. The wheezing, yelping laughter Percy lets out makes Natasha’s shoulder shake with silent laughter. ]
Tony Stank: rip percy
nedleedle: rip 😞
baby avenger: hr wull br missedd
Tony Stank: GET OFF YOUR PHONE
spidey @spidey-official
dude i will never forgive craigslist for banning me after i wrote a post seeking a sworn nemesis. whoever reported that is obviously my nemesis but i was so pissed.
spidey @spidey-official
2k likes for me to go to craigslist headquarters with a mission
spidey @spidey-official
actually, putting that on hold because bucky barnes just laughed in my face and called me a loser for turning to craigslist instead of picking fights in the streets and waiting for one to stick
spidey @spidey-official
he’s not my nemesis but he’s up there now
spidey @spidey-official
and now, to extract my justice, avenge my honor, and fulfill a dying man’s (his boyfriend) wish im going to tell a little story to you all
spidey @spidey-official
Bucky, who spent most of his life helping his best friend get by with his 900 disabilities and illnesses: we don't have universal healthcare by now?
his therapist, making a note that he is still a russian communist:
scientists hate this local new yorker @jbarnes
count your fucking days
spidey @spidey-official
what are you gonna do? huh? go after me? a silly sticky little guy? gonna track me down for having a laugh? take your eyes off your revenge seeking boyfriend for a moment and see where it gets you
Avengers!!!! @superherostan
SCREAMING
piru @pirepiro
Spidey 😭
annlis @anli
taking no shit and no prisoners my god
james @jimmyjammy
HIS THERAPIST THINKS HES STILL A FUCKING COMMIE DEAR LORD
mimi @wheresmybeans
Leftist king
bearbi @bearbi3
im still not over spideys craiglist ad???? what???
iron man <3 @starkswife
not the universal healthcare backlash
Bblimm @blooo
thats sad but also im dying holy shit
Ferris wheel fighter @ihatecarnivals
dfdshjgHDSLKgj;lfkhjsljDFA
tony stark stan account @ilovehim
i love it here
our family tree is a wreath
furby slayer: opening new boyfriend applications
pied piper: OUTTA MY WAY GAYBOY IM BOUTTA GET IT
horse girl: what happened
furby slayer: i TRUSTED HIM and he TOOK ADVANTAGE of my WEAKNESSES
framk: …he found out you’re extremely ticklish?
furby slayer: >:(
furby slayer: im going to send him back to the shelter
sparky: 💀
my chemical ron weasley: not the fucking shelter—
sparky: he is still alive though right
furby slayer: yes 🙄
sparky: dont 🙄 me last time thalia tried to tickle you, you bodyslammed her into the bottom of the canoe lake
furby slayer: she had it coming
horse girl: to clarify, though, you have not harmed your boyfriend?
furby slayer: no but im thinking about it
furby slayer: as soon as i get free he's dead
framk: free??
furby slayer: i have been restrained by multiple fluffy blankets and also him
pied piper: percy
pied piper: percy is he with you
furby slayer: yes
pied piper: you literally use text to speech??? he can hear all this???
furby slayer: yep
furby slayer: i want this smug asshole to know what's coming
framk: your relationship astounds me
furby slayer: tbh he might not even be listening, he’s on his phone
furby slayer: hey whats that supposed to mean
framk: love you to death, you have very strange taste
furby slayer: rude
framk: wade wilson, percy??
furby slayer: not seeing the problem
sparky: percy’s type is Person With A Blade
horse girl: thats not true!!
furby slayer: i mean
furby slayer: my standards are apparently MUCH LOWER THAN I THOUGHT THEY WERE
my chemical ron weasley: did you yell that last part at him
furby slayer: yes
furby slayer: bastard is ignoring me
scientists hate this local new yorker @jbarnes
my boyfriend doesn't use pet names as much as i do, which is very funny because i will crack my little gay knuckles and say some shit like “good morning my world, my life, my darling love and my whole heart” and mean it with my chest and he will reply “hello james” i love him so much
our family tree is a wreath
furby slayer: hes tweeting nice things about me again
furby slayer: fucking asshole
Notes:
percys main weakness 😔
shout out to mj's joker laugh
breaking: local teen seen dragging spider-man off the pavement; "he'll be fine guys i swear"
free my man percy, forcibly burrito-ed in three very soft blankets and being held by his boyfriend (he's in time out)
percy, dictating each threat outloud to his phone: >:(
bucky, holding him with one arm and tweeting with the other: kicking my feet and giggling
credits to the people who's posts i have appropriated:
thecyndimistuff on tumblr
shock on tumblr
literalyaflame on tumblrplumbing baby. goodbye
Chapter 45: pribe ❤️🏳️🌈
Notes:
(See the end of the chapter for notes.)
Chapter Text
NYC Pride @pridenyc
The annual NYC pride event will be held today, starting at 11:00! Vendors list and performance schedule linked in bio! We hope to see you there!
bider-man @spidey-official
some friends and i will be keeping an eye out to ensure the safety of everyone attending! happy pride :)
bearbi @bearbi3
no cops at pride just spidey :)
mimi @wheresmybeans
and maybe the avengers????
tony stark stan account @ilovehim
begging for another tony stark body glitter era appearance
SSEA
Tony Stank: are you guys all ready?
skrunkly raccoon: yes
the 𝓰𝓲𝓷𝓰𝓮𝓻: yep
baby avenger: yessir!! i am crouching menacingly above the streets!!! i have a cape now!!!
gitc: its true we took pictures he looks pretty sick
mindiana jones: its a sick ass cape
Tony Stank: percy?
the 𝓰𝓲𝓷𝓰𝓮𝓻: is the sword team with you?
skrunkly raccoon: he was lured in by an ice cream cart
skrunkly raccoon: he’s food motivated <3
skrunkly raccoon: wait this’ll be easier for everyone
James Barnes has added Tony Stark, PJ, Natasha Romanoff, Peter Parker, Ned Leeds, Michelle Jones, Lee Van Keppel, Bridgette Lehey, Daniel Wén-Campbell, Ross Bunmi, Mal Tanuk, and Spencer St. James to the group.
]James Barnes has changed James Barnes’ name to ‘ bucky’]
]James Barnes has changed PJ’s name to ‘percy’ ]
]James Barnes has changed Peter Parker’s name to ‘webs’ ]
]James Barnes has changed Natasha Romanoff’s name to ‘nat’ ]
[Bridgette Lehey has changed Daniel Wén-Campbell’s name to ‘dan’ ]
[See more…]
[Mal has changed the group name to ‘chappel roan fans here to attack people’]
Tony: is everyone here?
lee: yes.
webs: so ominous!
bridgette: lee and spencer are at an emergency med station with the red cross, dan and mal are sitting on the patio of one of the bars lining the main street, and ross and i are in the crowd :)
nat: in the crowd as well
bucky: so are percy and i
ned: mj and i are taking pictures by the park
Tony: you better get a cute one of me
mj: the rainbow accents of the suit are very visually compelling, i’ll give you that
Tony: thank you
Avengers!!!! @superherostan
RAINBOW IRON MAN SUIT! I REPEAT, RAINBOW IRON MAN SUIT
piru @pirepiro
SPIDEY GOT A CAPE!!!!!
annlis @anli
dropped my water bottle and the BLACK WIDOW picked it up and handed it to me. I need immediate medical attention. Oh my fucking god. She's so fucking fine guys. Oh my god.
chappel roan fans here to attack people
webs: i have a gun now!
Tony: WHAT
webs: took it from an angry man :)
ned: peter that was a police officer ❤️
webs: i don't care ❤️
Tony: pete i swear to fucking god
webs: mr stark!!! he was being a little bitch!!! he kept being mean to the others!!!
webs: he was harassing this one store owner and when i stepped in he started yelling at me and said my cape was ugly :(
bucky: so hes mean AND a liar
webs: and then he kept telling me that it was his job to be here even though he was trying to shove his way into a privately owned queer business that was literally just vibing
webs: and i told him it wasn't his job to be here, and he said it was, and when i asked him if he was a boykisser like me he got real mad
Tony: and then you took his gun?
webs: and then i took his gun ❤️
dan: checked with the local PD and yeah that guy was absolutely not supposed to be there lol
dan: congrats on the free gun spidey
webs: thank you!!
bearbi @bearbi3
spidey if you’re seeing this you have unlimited free cupcakes from my bakery now. you're doing great sweetie. have fun with the gun
iron man <3 @starkswife
everyones real brave till spidey gets armed
bearbi @bearbi3
update he took the bullets out and started throwing them at people
Bblimm @blooo
its called being innovative
bearbi @bearbi3
he ran out of ammo
bearbi @bearbi3
he threw the gun
bearbi @bearbi3
someone caught the gun??
bearbi @bearbi3
HOLY FUCK ITS DEADPOOL
bearbi @bearbi3
HE TRADED SPIDEY A SWORD FOR THE EMPTY GUN HE CAUGHT
chappel roan fans here to attack people
[bucky has added wade to the chat]
mal: omg????
mal: deadpool at pride?????
bucky: you’re surprised?
mal: ok sorry that infamous mercenary deadpool hasn’t made his position on homosexuality clear???
percy: his position on homosexuality was in my bed.
percy: hello, wade
wade: percy!!!!!!
ross:
bridgette:
dan:
wade: we were just close like that 🥰
Tony:
Tony: wait.
Tony: percy…
mj: holy mother of god
Tony: you said you were friends with deadpool.
Tony: friends.
ross: WHAT THE FUCK WHAT THE FUCK WHAT THE FUCK
wade: 🍆
Ferris wheel fighter @ihatecarnivals
just saw tony stark walk into a lamp post lol
tony stark stan account @ilovehim
thank god for that suit protecting his beautiful face
chappel roan fans here to attack people
ross: BARNES???
bucky: nice to see you again, wade
wade: ♥️ hello you fine specimen of a man
dan: ?!???!??!!???!!!!?!?!?!?!!!!?!!
lee: evil pansexual
wade: omg how did you know!!
lee: smart
wade: 🤩
Tony: …did you just use a stolen gun as a bookmark in One Hundred Years of Solitude???
wade: 💁
minions(™)
malpractice: guys
malpractice: deadpool then barnes. both assassin/merc types with a penchant for weapons, literature, and a brutal sense of justice
danimals: oh my god
danimals: does this mean jackson has a type?
malpractice: i think it means much worse
malpractice: i think it means THEY have a type.
ross lynch, specifically in teen beach movie: fuck.
danimals: so what im hearing is we need to keep all these other freaks away from him
malpractice: absolutely yes
malpractice: barnes buys us mcdonalds after missions, there is no way we can let any potential competition anywhere NEAR jackson
mandy @mandapanda
attention all wlw in the area, i think i just met god
mandy @mandapanda
so im at @pridenyc and someone next to me tripped and dropped their drink and long story short i got cut by some glass
mandy @mandapanda
walked over to one of the med tents to get a bandaid and holy shit guys
mandy @mandapanda
this really nice guy led me into the tent and had me sit down, and thank god he did because i would’ve folded so fast
mandy @mandapanda
God herself came in. at least 6’7, guys. biceps as thick as my leg. gayest little shag haircut i've ever seen. pulled glass shards out of my leg and i didn’t even complain even though i'm a little bitch who cries when i get flu shots
mandy @mandapanda
after she finished she bandaged it and pat my head and told me i did good and hhhhhhghdsjghhooooooly god you guys
mandy @mandapanda
stuck around long enough for her to take off her flannel and she had sick fucking tats and those BACK MUSCLES too oh my god
mandy @mandapanda
the other guy at the tent definitely noticed my lesbian revelations. so. got laughed at by a ginger. worth it though.
chappel roan fans here to attack people
Tony: everyone doing alright?
webs: got a churro :)
bucky: i am with wade now
spencer: our med tent is getting really swamped for some reason that i totally don't know
spencer: on a completely unrelated note, bridgette you should come find your wife
bridgette: omg i love my wife sure
natasha: beat a college GSA in a drinking contest by the park
ned: met a dog wearing a pride bandanna
ned: petition to put him in the friend group
webs: agreed!!
Mj: obviously
webs: hey there's a guy on my rooftop im gonna go kick his ass
Tony: WHAT
ned: i think he's high on queer solidarity
mj: TOO MUCH TRANS EMPOWERMENT PETER STOP
Tony: PERCY STOP HIM
Tony: PERCY
Tony: FUCK
[webs has added dd to the chat]
wade: like the boobs?!
dd: no.
dd: what?
dd: no.
webs: it was just daredevil lol
dd: stark your child is insane
Tony: yeah
dd: good cape though
webs: 😎
minions(™)
danimals: SOUND THE ALARMS WE HAVE A POTENTIAL INCOMING
malpractice: SHIT
piru @pirepiro
went to find lesbian jesus like @mandapanda mentioned and maybe the prettiest femme ive ever seen walked up to her and kissed her and called her corazón
piru @pirepiro
some gay people are really out here winning
annlis @anli
hhhherfbgjdkabdsHBQVRWADH
mimi @wheresmybeans
went to make my pilgrimage and got distracted by a butterfly out front of the tent and the femme one saw it and got excited and it started to fly away so LESBIAN JESUS LIFTED HER ONTO HER SHOULDERS SO SHE COULD SEE THE BUTTERFLY BETTER
james @jimmyjammy
and while all the useless lesbians were drooling i took it upon myself to flirt with the ginger twink that was also working there
piru @pirepiro
gay excellency at its finest
james @jimmyjammy
he also wanted to see the butterfly, lesbian jesus shifted her girlfriend(?) onto one shoulder and put the twink on her other one
james @jimmyjammy
in other news im experiencing a brief bout of heterosexuality
chappel roan fans here to attack people
mal: heyyyyy mr daredevil
mal: would you say your job is beating people up
mal: for no particular reason
dd: no. i have an actual job.
minions(™)
danimals: thank god
chappel roan fans here to attack people
web: the fact that your unquenchable thirst for justice bleeds into your day job is one of my favorite things about you!!
minions(™)
ross lynch, specifically in teen beach movie: FUCK
chappel roan fans here to attack people
dan: cool cool cool
dan: uh
dan: …what are your hobbies?
dd: why are you asking me these questions
ross: uhhhhh
ross: HE THINKS YOURE CUTE
minions(™)
danimals: WHY WOULD YOU SAY THAT
chappel roan fans here to attack people
dd: thank you. i will not be giving away any of my personal information.
minions(™)
malpractice: HE HAS THE BRUSQUE AND STANDOFFISH BUT POLITE MANNER DOWN
danimals: LEE BRIDGETTE SPENCER WE NEED BACKUP
chappel roan fans here to attack people
dan: 👍
Tony: …okay
Tony: hows everyone else?
webs: got more churros and my tummy hurts
mj: he ate 29
Tony: oh
ned: it was awesome
spencer: med tent good
bucky: dd met up with wade and i
bucky: he has strong opinions on thurgood marshall’s works
minions(™)
malpractice: FUCKING SHIT
danimals: WE NEED TO KEEP HIM AWAY FROM JACKSON
ross lynch, specifically in teen beach movie: he’ll fall in love with jackson so fast oh my god
ross lynch, specifically in teen beach movie: we cannot lose our boss to this man
danimals: oh god what if he and barnes start fighting
malpractice: what if deadpool joins in????
danimals: our boss is simply too easy to fall in love with
chappel roan fans here to attack people
dan: me mal and ross are great
nat: won three more drinking contests
nat: but i think the important question is
nat: how are YOU, tony
nat: i see you made a friend
Tony: what?
Tony: stephen just dropped by for a minute
nat: mmmmhm
Tony: moving on haha
Tony: percy?
webs: ruh roh
Tony: percy????
nat: now that i think about it he hasn’t messaged in like a while
nat: like, a long while
Tony: this may actually be the worse case scenario
Tony: barnes can you please go collect your freak of a man. hes doing things
barnes: no i set him loose on purpose he needs enrichment
Tony: goddamnit
Tony: i asked stephen to do magic to track him down but he said he ‘doesn’t want to go anywhere near that nutcase’ and he ‘doesn’t want rabies’ 🙄
mj: found him
mj: hey barnes i think you don’t have a boyfriend anymore
bucky: goddamnit
mj: the drag queens got him like an hour and a half ago
mj: i think they want to steal his cheekbones
wade: they’re very nice cheekbones, to be fair
bucky: shit they are
mj: but his eyeliner…its flawless…
Tony: barnes just tore off so fucking fast wtf
webs: tracking percy down through boyfriend senses alone
webs: amazing
ned: he is going…very fast
webs: spidey sense if it was an ally
nat: i feel like keeping you from getting shot makes it an ally
webs: oh yeah
mj: oh shit he found him
mj: DFHEQWKDJBGKJQRBE
ned: mj keysmashing?????
mj: he absolutely BODIED him
mj: full tackle, right around the middle, any linebacker would be jealous, extra points for putting a hand behind his head so he didn't get a concussion, 14/10
mj: he is now squishing percys cheeks and telling him he looks pretty
mj: drag queens are losing their shit
mj: IS THAT KATYA????
mj: fuck i love it here
dan: to be clear, daredevil is nowhere near him, right?
mj: what
dan: nothing
Notes:
happy pride im back and ready to ruin your lives 🏳️🌈 (cue thunder)
spidey got a cape and gun. trans rights.
wade being an avid reader is something that is so important to me
sword: jackson is simply too loveable EVERYONE BUT BARNES STAY BACK
bucky is their emotional support parental figure <3lee and bridgette are the ultimate femme/masc couple. they are so powerful
spencer watching a horde of lesbians drool over his sort of boss is so fucking funny to me
and then him getting flirted with also and escaping to lee because he's a very not functional gay and was turning a concerning shade of pinknat is just here to vibe and drink. her mere presence keeps people from starting shit
shout out to OwO_Jackolantern for the 'can you please go collect your freak of a man' bit
matt time!! wade time!! stephen time!! everyones here
anyways do i post percybucky smut as a seprate work this pride month yes or no
happy pride everyone! be gay and do crime!!
plumbing baby. goodbye.
Chapter 46: stickers
Notes:
(See the end of the chapter for notes.)
Chapter Text
[James Barnes has been added to the chat]
areyoushuriaboutthat: barnes you little bitch
areyoushuriaboutthat: what the fuck
[James Barnes has changed their name to ‘Bucky’]
Bucky: ???
Bucky: shuri???
areyoushuriaboutthat: i had to find out ON TWITTER
Bucky: huh
areyoushuriaboutthat: YOU HAVE A BOYFRIEND??? YOU LITTLE FUCKER THIS IS WHY IM HOMOPHOBIC
Bucky: you are gay
areyoushuriaboutthat: irrelevant! how could you do this to me
Bucky: i really thought t’challa would have told you
areyoushuriaboutthat:
areyoushuriaboutthat: T’CHALLA KNOWS??? YOU TOLD MY FUCKING BROTHER AND NOT ME??????????
Bucky: ok well in my defense, he asked like, months ago
Bucky: and you’ve been knee deep in off the grid vibranium mines
areyoushuriaboutthat: not my fault your shitty phone couldn’t reach me
areyoushuriaboutthat: plus you should have figured out how to send me a message via dreams and you know it
Bucky: :/
areyoushuriaboutthat: so!! tell me everything!
Bucky: define everything
areyoushuriaboutthat: well a name would be a good place to start dipshit
Bucky: you?? dont know???
Bucky: the great shuri????
areyoushuriaboutthat: stoooop >:(
areyoushuriaboutthat: he literally doesn’t exist digitally
areyoushuriaboutthat: you're dating a CAVEMAN
Bucky: 🥰 yeah 🥰
Bucky: i can put him in here?
areyoushuriaboutthat: sure!!!
[Bucky has added ‘PJ’ to the chat]
areyoushuriaboutthat:: HELLO
PJ: hi
areyoushuriaboutthat: NICE TO MEET YOU
PJ: we’ve already met, actually
areyoushuriaboutthat: ????
areyoushuriaboutthat: when?
PJ: well, to your credit, the first time wasn’t in person
PJ: and the second time, you were preoccupied
Bucky: please stop being cryptic babe
PJ: :(
PJ: it was on that video call a while back when you guys were first implementing BARF
PJ: and then again when you came to the tower for the first session
areyoushuriaboutthat:
areyoushuriaboutthat: oh my fucking god
areyoushuriaboutthat: BARNES
areyoushuriaboutthat: WHAT THE FUCK
areyoushuriaboutthat: YOU HOOKED UP WITH YOUR POTENTIAL ASSASSIN???
Bucky: listen,,,...,
PJ: i didnt do it 🙄
areyoushuriaboutthat: YOU ALMOST MADE T’CHALLA PISS HIS PANTS
PJ: just him?
areyoushuriaboutthat:
areyoushuriaboutthat: OK MAYBE NOT JUST HIM BUT
PJ: 🥰
Bucky: babe???
PJ: hehe
[PJ has left the group]
areyoushuriaboutthat: barnes you are insane
Barnes: shuri i feel like you don’t understand
Barnes: [Image Attachment: It’s a photo of Percy, stretched out on their bed, early in the morning. Sun from the gap in the blinds rests on his face, casting his skin in a soft glow. He’s smiling softly in the camera’s direction]
Barnes: [Image Attachment: Another photo of Percy, this time working out. He’s shirtless. He’s sweaty. It’s a whole thing.]
Barnes: i see this and i’m expected to just?? not???
areyoushuriaboutthat: ok damn ig
areyoushuriaboutthat: …you managed to rizz up the guy who was literally the failsafe to kill you
areyoushuriaboutthat: barnes i was a little familiar but not fully familiar with your game
robert <3
local milf: lee said ‘i would like to be a clam. i want to be reincarnated as a clam’ and i said ‘i’d still date you if you were a clam’ and she went ‘i dont think i'd be concerned about such matters. i’d be a clam’ and then made clam sounds
certified monster fucker: need me a freak like that
egg: can you stop being a desperate slut for like. a few minutes
certified monster fucker: im going to be so honest with you mal
certified monster fucker: i honestly dont think i can
class traitor: thats some real bold words from you, mal
class traitor: being real critical considering you left for your bathroom break 45 minutes ago
class traitor: you’re working at that fucking party city again aren’t you
egg: i have no idea what you’re talking about
class traitor: you know what
class traitor: @supremeoverlordjackson
class traitor: permission to use my powers for evil
supreme overlord jackson: i’m busy.
supreme overlord jackson: granted as long as i don't have to do paperwork.
class traitor: 🫡
egg: [Audio recording: “I’m terribly sorry, sir, but for the last time, no, you cannot pay us in stickers. I don’t care how many stickers you have. This is a Party City and—holy shit that’s a lot of stickers. Okay, just…give me those and you’re free to go—don’t tell anyone about this.”]
local milf: MAL???
thor understudy: that does not seem like a good business practice
egg: What
egg: HUH
egg: i didnt fucking record that
egg: DANIEL
class traitor: stickers?? really dude???
egg: i am going to find you and beat the shit out of you
class traitor: shiver me timbers 😧
trusted with scalpels
doc mcstuffins: lee?
doc mcstuffins: how long until they realize i’m in the chat
doogie howser, i guess: spencer…
doogie howser, i guess: they’re so fucking stupid
doogie howser, i guess: you really need to grasp this
doc mcstuffins: trust me, the chat is helping
robert <3
certified monster fucker: im bored now :(
class traitor: our father has left us to fend for ourselves 😞
local milf: our BOSS is literally doing work at the WSC
local milf: you'll live
certified monster fucker: no i think i need to do something irresponsible now
certified monster fucker: lee!!
thor understudy: bwoah?
certified monster fucker: you should bring me a bottle of that evil homebrew shit you make
thor understudy: 👍
certified monster fucker: hell yeah
certified monster fucker: you guys in?
class traitor: duh
egg: sure
certified monster fucker: bridgette?
local milf: …that stuff is like. really strong
egg: but lee will be there to supervise
local milf: well maybe lee wants to participate
class traitor: bffr she used to take that shit to class in a water bottle
local milf: ok fair im in
egg: omg just had a brain moment
[Mal Tanuk and James Barnes]
Mal Tanuk: do you want to come drink with us
James Barnes: ?
Mal Tanuk: jackson’s gone and i'm betting you’re bored
Mal Tanuk: drunk dan and ross are really funny
Mal Tanuk: same with bridgette, every fucking time she falls to the ground sobbing about how much she loves her wife
James Barnes: sounds wonderful, im in
trusted with scalpels
doc mcstuffins: this seems like an awful idea???
doogie howser, i guess: let it happen
doogie howser, i guess: you need credits for your toxicology lab, yeah?
doc mcstuffins: oh you are so unethical
doogie howser, i guess: i think you mean efficient
banned from lithuania :(
jello slut: wade i need to bite that man and shake him around with my teeth like a rabid dog
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: oh ?
jello slut: hnnnnnngbsfjakjbkv
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: ur little boyfriend ?? or are we talking about spanish formula one ferrari driver carlos sainz again?
jello slut: ok first off don't bring carlos into this
jello slut: second, little??? that man is not little??
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: i can say that
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: im literally taller than him
jello slut: what does height have to do with this
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥:
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: whore
jello slut: didnt you literally spend two months catfishing hydra agents
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: and?
jello slut: right
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: anyway are you going to have a homosexual seizure or
jello slut: he’s so fdehjsgjehgkj i cant help it
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: i mean im not going to disagree due to the fact that i am a person with eyes
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: mans got hella shoulders
jello slut: yeah he does
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: did he do something or were you just thinking about him real hard
jello slut: oh i left him unsupervised with SWORD
jello slut: they got him drunk and
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: supersoldiers can get drunk???
jello slut: pretty sure lee fed him the paint thinner moonshine they make, so, as it turns out, they can
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: i would trust lee with my life
jello slut: please never talk to lee i dont think it would end well
jello slut: [Screenshot attached]
jamie <3: freckles u are a very freak and straange. iam deeplu in love with u
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: damn
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: gay people are insane
jello slut: wade be so fucking fr you literally texted me while sucking dick the other day
(っ◔◡◔)っ ♥ number 1 hello kitty fan ♥: oh dont worry im including myself in that
Notes:
shuri and bucky being odd friends is so silly to me
shoutout to that moment in TLS where percy menaces the wakandan royal family for hurting tony's feelings
shuri: gay people truly know no bounds. inspirational
spencer the ultimate chat lurker
'trusted with scalpels' is spencer and lee btw. spencer is doc mcstuffins :)
'banned from lithuania :(' is wade and percyin case any of you were wondering, this is spanish formula one driver carlos sainz
https://pin.it/2wYGfxPIP
https://pin.it/6EbYLw28Fwade catfishes hydra agents. its canon now
bucky calling percy 'freckles' :)
plumbing baby. goodbye
Chapter 47: halloweenie 3: BIG pumpkin
Notes:
(See the end of the chapter for notes.)
Chapter Text
“Who washed dishes?” Tony’s voice called down the hall.
Bucky looked up from his book. “What?”
Tony comes into view, holding two forks in a clenched fist. “All the fucking forks are gone!”
“You’re holding two.”
Tony gives him a look. “Yeah, and these are the only two in the whole kitchen. Where are the rest of them?”
Bucky shrugs, returning to his book. “I didn’t wash dishes.”
With a dramatic huff, Tony turns on his heel and returns to the kitchen. After ten minutes of pettily loud clanking around, Bucky sighs, slides his bookmark between his pages, and stands up. “You can buy more forks, billionaire!”
“Fuck you!”
Bucky snorts and heads to the elevator to let Tony stew in peace.
Ten minutes later, he finds himself sitting in his and Percy’s apartment, using Mrs. O’Leary’s massive head on his lap as a table. He made it fifteen minutes before he was disturbed. Both his and Mrs. O’Leary’s heads snapped upwards towards the ceiling at the sound of a loud thump from the floor above. A moment later, Bucky heard the elevator stop at his floor—based on how light the footsteps where, it was Peter who stepped out and walked up to his front door. “Bucky?” The boy called.
“Come in!” He called back.
Peter, looking disgruntled, walked into the living room. “It’s cold,” He complained. “I was trying to do my homework, and the vents turned on, and I got a tad spooked. Fell right off the ceiling,” He said sadly. Bucky disguised a huff of laughter, then patted the cushion next to him. Peter squeezed between the cushion and Mrs. O’Leary, leaning into her warmth as he balanced a notebook on his knee. “Thank you,” He mumbled into his sweater, half-focused already on his work.
“‘Course, kid.” Bucky said warmly. “I’ll ask Fri about the vents, later.”
A few rooms away and a couple hours later, Natasha stood in the center of her room, frowning. Her hair was tied up in a claw clip, away from her face, as she surveyed her shelves. “I swear to God…” She said quietly as she scanned each nook and cranny.
She next wandered to her nightstand, where she’d set her phone to charge an hour beforehand. Natasha opened the drawer where she’d put it, and her brow furrowed. There was only junk there—a few of her discarded pens and some change.
“Shit,” She whispered, shutting the drawer and turning to the rest of her room. She had 2048 to play, damnit.
Midafternoon the next day, Percy dropped down face-first onto his mattress with a low groan. It took him a few minutes to move, but when he did, he wiggled under the blankets, smashing his face into a pillow. He had an alarm set to go off in ninety minutes—a damn good amount of sleep, for him.
His eyes slipped shut, and just as he was about to drop off into sleep, someone turned on the shower a floor above him. Percy jolted, then sighed. He must be more tired than he thought, not to realize somebody had been walking around above him.
Usually, stuff like that didn’t bother him. There was always water moving around, in some fashion—if that kept him up, he would have died from exhaustion years ago. It was only big stuff—turning on showers or baths, typically, but even that was the equivalent of Travis Stoll’s annoying habit of sneaking up on people and breathing down the back of their neck. Annoying, yes, but you shivered a little (punched Travis) and moved on.
When he was on the brink of sleep, though, it was enough to break him out of it.
He was familiar with everyone's routines to have a vague idea of when they were going to shower, and it typically didn’t overlap with when he tried to sleep, so it was never an issue. He wasn’t going to make it one now, either.
Percy curled onto his side, determined to at least get a few minutes. Also, there was a coin in the sheets, for some reason.
Later that night, Bucky leaned forward, squinting at the screen in front of him. He pondered for a moment before making his move. To Craig’s (his Words with Friends nemesis) ‘versemen’, he added on to make ‘bouleversements’.
“Ha,” Bucky said under his breath. “Suck my dick, Craig.”
He closed the computer—Craig was a slow ass bitch, it’d take him a while to respond and take his turn. As he reached up, something bright caught his eye. Bucky rotated his arm. Stuck to the back of his tricep was a small magnet that looked like an apple.
Bucky squinted at it, then at the closed computer. “I don’t know how you did this,” He whispered to Craig, “But I was trained by the KGB. I’ll find you.”
Down in the labs, Tony hunched over a prototype widow bite. He’d been shocked about six times already, but, like, whatever. He was wearing gloves.
He was only on his second cup of coffee—he had one more before Fri snitched and set Percy on him. Tony repressed a shiver. Never again.
Above him, his music abruptly cut off. He paused, looking up, expectant. When Fri didn’t say anything, he called out, “Everything good?”
“Fine, Boss.” She said, “Apologies.”
The music resumed, the current song ending with a loud, drawn out note. Then—
Crashin', hit a wall—
Tony looked up. “What the fuck?” He looked down. "Why is there a penny here?"
Natasha methodically began to put every single item back in the fridge. She’d literally gone to get the vatrushka that morning, and though all her friends were assholes, none of them would eat it when they knew how far out of her way she’d gone to pick it up.
But it wasn’t in the fucking fridge.
Slowly, she glanced at the pantry.
Maybe…
Peter curled up in a ball, knees tucked up to his chest under his hoodie. Well, Percy’s hoodie, but Peter had…appropriated it. It was soft, purple and with a faded design on the front. He pulled out his phone, resting it on his knees.
He scrolled aimlessly for a few minutes, occasionally sending things to his friends. He sent Ned a little dog named Crumpet and then MJ a video of a small child getting hit by a beachball.
Equally enthusiastic responses were received.
A sudden wave of cold hit and Peter screeched. He jumped up—or, well, tried, but his legs were trapped under his hoodie, so he actually just ended up face planting directly onto the floor.
Thank God it was carpet, at least.
Hey, a penny!
Bucky looked down. Letter magnets on his arm. Why were there letter magnets on his arm.
Hoe it read.
“Not polite.”
Percy yawned, leaning over his desk.
“You good?” Mal asked from where she was sitting, perched on his desk with her papers balancing on one of Lee’s books as a makeshift clipboard.
He leaned back in his chair. “Fine,” He waved her off. “Appreciate the concern, though.”
Mal hummed and kicked her feet as she continued her paperwork.
His employees were like raccoons, or something. Mal was productive when she sat in odd places, though, so he let it slide.
Later, he tried to take a nap on the couch in his office, but one of his employees must have been having some serious issues, because, holy shit, the toilet flushed like nine times.
“I swear to the Gods,” He whispered. If he had to remind Dan that he’s lactose intolerant, again, he was going to be very upset.
“Hello?”
“Hi, this is Miranda calling from the God’s Truth Foundation. I’m just following up on your interest form you submitted last week. Do you have a moment?”
“Uh, I’m sorry, but I think you have the wrong person.”
“Oh! My apologies. Thank you for your time. Have a blessed day.”
She hung up, and Bucky stared down at his phone. He was fairly sure his number was, like, classified, or something.
Huh.
Bucky kicked a penny as he stomped to the next room.
Tony stared at the top of his mini fridge. He’d sworn he’d brought some cutlery down with the prepped lunch he’d made the other day.
He crouched to take a quick look under the table, then behind the mini fridge. He found some change, but nothing else. He squinted at the tupperware.
Natasha stared at her bed.
Her pillowless mattress stared back.
“What the fuck.” Then, “Mrs. O’Leary?”
Peter paced up and down the hallway, eyeing the vents every time he passed one.
“Unacceptable,” He mumbled. “Unacceptable, unacceptable, unacceptable.” He shivered a little bit.
...
"Hey, another penny!"
Percy dug the butt of his palms into his eyes. “Who is having a bath,” He whispered aloud, “At three in the morning?”
Next to him, James slept soundly, despite his phone having gone off at least six times during the night.
“Hello?”
“Hi, this is Rhonda from the official church of scientology. We—”
“Wrong. Number.”
“Are you sure? Sorry, but it says right here—”
Bucky hangs up.
‘I need ya, I need ya, I need you right now
Yeah, I need you right now
So don't let me, don't let me, don't let me down’
Tony throws a screwdriver against the wall. “FRIDAY!” A penny rolled across the lab.
Her nightstand was gone.
Her nightstand was gone.
Peter pulled on his sixth sweater. This one was Bucky’s. He scooched away from the vents.
Percy stepped into the shower. He reached a hand out to turn it on, then paused. “Something feels odd.” He declared.
“Hi, is this James? I’m calling about your car’s extended warranty—”
“I don’t own a car!”
“Okay, something’s wrong.” Tony declared, hands on his hips. “I’ve asked every single person in this damn tower, including Fri, and nobody has any goddamn clue where all our forks went! We have three sets, and I only have the two that were in the sink!”
“They’re just forks, Tony.” Nat said. “The real issue is who the fuck has been moving my shit.”
“What shit?”
“Not relevant.”
“I’m sorry?”
Another loud thump. “WHY IS THIS TOWER SO COLD?” Screamed Peter, two rooms over.
“Natasha, what are you stashing in my tower?”
“Shouldn’t you know?”
“Excuse me?”
“FUCK ASS BOB?” Bucky read aloud, staring down at his arm. “What is a fuck ass bob?”
From the floor, Peter’s muffled voice, “Your old haircut.”
“Okay, that was not my choice—”
Natasha turns to him, points, and says, “Okay, but you still had one,” Then, back to Tony, “You’d know, because you’re the one moving shit!” She accused vehemently.
“I am not!” Tony defended, aghast. “You take that back!”
“Oh, yeah? Where have you been all day, then?” She challenges.
Tony stomps into the kitchen and yanks open a drawer, staring at Natasha the entire time. “I’ve been looking,” He slowly enunciates, “for these fucking—” Tony looks down at the drawer. “PENNIES?”
Bucky’s head snaps up. “Did you just say pennies?”
“Yes, fucking pennies!”
“Fucking pennies!”
“Who gives a shit about pennies? Where’s my stuff?” Natasha cuts in.
“I don’t have it!” Tony insists at the same time Bucky goes “Wait, what stuff?”
“My stuff!”
The elevator door opens with a pleasant ding.
Percy Jackson, soaking wet and with an absolutely foul look on his face, steps out. Natasha, Bucky, and Tony all go dead silent as they stare at him. Reflexively, Bucky wrinkles his nose, sniffing the air. Percy stops in between them and the elevator.
Softly, he says, “I don’t know who did this,” His voice is measured carefully, “But I am not in the fucking mood.”
“Is that…” Bucky ventures. “...chicken stock?”
“Yes.” Percy says. “Yes, it is, because somebody here thought it would be funny to put chicken bouillon cubes in our showerhead.”
Tony sucks in air through his teeth, and Natasha bites the inside of her cheek.
“I am going to skin someone alive. I smell like chicken.” He hisses, and, wow, he actually looks pretty pissed. Natasha gives Percy a critical look, brow furrowed. “Is everything else alright?” She asks carefully.
Percy flexes his fingers, curling into fists. “I have been trying to take a nap for about three days now,” He says pleasantly. “But I swear to the fucking Gods, every time I’m about to fall asleep, somebody turns on a tap or a shower or flushes the fucking toilet!” Behind them, in the kitchen, an ominous creaking sounds. Percy takes a deep breath and pinches the bridge of his nose. “Jamie, what the Hell is on your arm?”
Bucky looks down. “It says fuck ass bob.” He reports.
“And why,” Percy grits out, “do you have magnets that spell out fuck ass bob on your arm?”
That gets a scowl out of Bucky, who casts a glare at Natasha. “Great question, because I only know two people capable of sneaking them on without me noticing, and one of them has been busy fighting the plumbing.” He snaps.
Another muffled thump from down the hall.
“Or… three people.” Bucky hisses.
“You better not mean Pete,” Tony says.
“Are you really going to pretend this isn’t something he’d do?” Natasha asks. Tony winces. “Peter!” He calls.
A very disgruntled teenager enters the room a moment later, rubbing his shoulder. “Hi,” He grumbles.
“Took a fall?” Natasha asks.
“More like six,” Peter sighs. “Somethings up with the ventilation, I swear, because I keep getting assaulted by freezing wind when I’m trying to relax.”
“On the ceiling?” Tony confirms.
“Yeah, on the ceiling. Where else?”
A shrill ringing interrupts them. Bucky yanks his phone out of his pocket and holds it up to his ear. “What? No! No, I, I don’t—I’m not a scientologist! Why do you keep calling me?” He yells into it. Then, he hangs up and stuffs his phone back into his pocket. “What?” He snaps at them. “This isn’t even about me! Peter, sweet, kind child, have you been putting magnets on my arms?”
Peter tilts his head to the side. “No? I mean, not to my knowledge.”
“The fuck? Not to your knowledge?”
“I be getting into situations.” Peter says with a delicate shrug. “Oh, but now that you’re all here, what’s up with all the glitter?” He asks. “I mean, I love pizzaz, don’t get me wrong, but seriously, I got glitter in my socks! I needed those!”
“Wait, needed? Past tense, needed? Why don’t you need socks anymore? What did you do?” Percy interjects.
“Glitter? Seriously?” Tony asks. “Shit, I hate cleaning up glitter.”
“Oh, like you clean,” Natasha says, rolling her eyes.
“Well, I’ve sure been cleaning up a lot of pennies recently! Pennies!”
“Oh, my Gods,” Percy says. “There were also pennies in the fucking shower.”
“But my stuff wasn’t?” Natasha tosses her hands up. “Because, at this point, I’d take that.”
“What stuff?” Percy and Peter ask at the same time.
“My stuff! It’s missing!”
“Natasha, you do not need cyanide pills right now!” Bucky says, ignoring his buzzing phone in his pocket.
“CYANIDE PILLS?” Tony shrieks. “Natasha! What the everloving fuck? Why? What are you doing?”
A pause. Then, levelly, she responds, “I be getting into situations.”
The buzzing continues. Bucky picks it up, screams wordlessly into it, then hangs up. When he pulls his hand out of his pocket, he’s holding a penny. This time, Percy and Tony scream, one out of rage and the other out of fear.
“Ooh, a penny!” Peter plucks it from Bucky’s hand. “I’ve found twenty six already!”
“Wait, wait,” Percy says, “You know how many there are?”
“Huh? No, of course not. I just like pennies. My friends and I are going to melt them down to make a lifesize statue of Mr. Harrington. Cindy will finally stop giving me shit for not contributing enough! This means I get to stop being the group roach!”
“I’m sorry?”
“Me too, honestly. It’s a very unfortunate position to be in.”
In the distance, a toilet flushes. Percy clenches his fist so hard his knuckles crack.
“Okay!” Bucky says loudly. “Clearly, something’s up. How about we all take a breather and meet back in an hour.”
“An hour?” Tony repeats. “Barnes, we have two fucking forks in this house and every second that passes my AC/DC is being replaced with the fucking Chainsmokers!”
“An hour,” Bucky gritted, “Because I think if somebody doesn’t get some sleep, the tower will get blown up.”
Simultaneously, the group looks at Percy—pissed off, sleep deprived, and smelling faintly like chicken noodle soup—and nods.
“...You can use my shower.” Natasha offers in lieu of agreement.
“Thank you.” Percy says tightly.
Bucky does manage to get Percy to sleep for a total of 45 minutes—accomplished by calling in Mrs. O’Leary and using their combined weights to squish him into the mattress until he fell asleep.
In the meantime, nobody does much, unwilling to risk causing a disturbance and incurring both Percy and Bucky’s wrath.
A sleep-deprived demigod and a protective super soldier was probably the only way this situation could get worse.
Tony sat in the kitchen, elbows resting on his knees, lips pursed and eyes locked on the silverware drawer. Natasha, on the other hand, laid on her floor, surrounded by the rubble of her torn apart room. Peter sat in a pile of pennies.
They reconvene in the common room.
“We’re establishing alibis.” Tony declares.
“For the last three days?” Percy asked with a frown.
“Last week,” Natasha corrected. “That’s when my phone first went missing.”
“I got my first call ten days ago.”
“A fork went missing two weeks ago, too.”
They sat in silence for a bit. “Okay, solemn oath time.” Percy says intently. “I swear that I, to my knowledge, haven’t been sneaking pennies into places, magnets onto Jamie’s arm, stealing forks, moving Natasha’s stuff, or fucking with the ventilation. I didn’t put glitter anywhere, mess with Tony’s playlists, sign Jamie up for every fucking call list possible, or fuck with myself via the plumbing. I swear all that on the Styx.” Outside, thunder boomed. Tony’s brows shot up. “Uh, is that the one that—”
“If you lied, fate worse than death, blah, blah, blah—I told you I’m not fucking around.”
“...Right.” Tony cleared his throat. “I swear all that on the Styx, too, I guess.”
“I swear it on the Styx.” Natasha, Bucky, and Peter all repeated. When none of them instantly died a horrifically agonizing death, they moved on.
“Pepper and Rhodey haven’t been here every day this has happened, and Vision’s been gone the last three weeks.” Tony said. “So they’re out.”
“SWORD hasn’t been here in months,” Percy added.
“Neither have my friends.” Peter finished.
“Okay…so we’re looking for someone who can get into the top of the Tower without any of us noticing, including Mr. Radar over there,” Tony said, nodding towards Percy. “Someone who can sneak up on and mess with a supersoldier assassin’s arm, break into a superspy’s room, get into my mainframes, and not set off Peter’s spidey-sense.”
“...”
“Well, damn,” Natasha said, leaning back.
Percy’s eyes were narrowed. “Call Strange.”
“Stephen?” Tony blinked.
“Yes, you gay bitch, Stephen Strange. Do you know any other Stranges? Call him.”
As Tony pulled his phone out, he cast Percy a glance over it. “I don’t think I like you very much when you don’t take naps.” He muttered.
“You’re being haunted.”
Strange gets five, horrifically identical looks, not dissimilar to how Wong’s iPod looks when it glitches out from all the Beyonce he has downloaded.
“Haunted.” Tony is the first one to speak.
“Yeah, haunted.” He confirms.
Wordlessly, Bucky hands Percy a throw pillow. The demigod holds it up to his face, screams into it, and demurely sets it back down on the couch. “Okay.”
“Okay?”
“Okay.”
Then, he stands up, phone in hand. Only Bucky and Percy’s sharp ears can hear the conversation that follows.
“Hey, Mal. Can you—yeah—could you get everyone into the bullpen? No, it’s—I’m fine, Mal, thank you for asking. Yes, this is a bit urgent. Thank you.”
“How come he’s all polite now, but when it’s us, he’s making us do death oaths and calling me names,” Tony complained, leaning into the couch cushion.
“Because I’m cultivating a safe and supportive work environment,” Percy says blandly as he returns. “They’re gonna call through Fri in a second.”
Sure enough, a moment later, FRIDAY transfers a video call to the television screen in front of them. The SWORD members gather around the webcam—Dan sitting directly in front, Ross sitting on the desk on the far left, Mal spinning around in her office chair a bit back from the space between them, Bridgette in a chair pulled up to the right, with Lee and Spencer standing behind them all. “What’s crackin’?” Ross asks, popping his gum.
“Tower’s haunted.”
“What?”
“Tower’s haunted.”
They all stare for a second.
“Have you perhaps moved any boundary stones recently?” Lee asked. “Messed with the city zoning plans?”
“What? No!” Tony exclaimed. “Why would you even ask that?”
“Deildegast.” Lee did not elaborate further.
Stephen takes over. “If I’m right,” He says, “It’s just a plain, old ghost. I don’t know why it's chosen to haunt here, but what you described is the trademark of a fairly weak ghost. Pranks, mostly, that slowly escalate as they settle into their haunt.”
“Can they move around at all?” Bridgette asked.
“Well, a bit, but they usually stay attached to a specific set of people. Why?” Stephen asked.
Bridgette shrugged. “All our ‘m’ and ‘n’ keys keep getting mixed up with each other. It’s been pretty frustrating.”
Percy raised a brow, and Dan flushed. “We were just kinda…waiting for you to notice.” He admitted.
“I’m blind and dyslexic, why and how would I notice?”
Ross raises his hand. “And what is the genitals situation on this ghost?”
Tony has to hold Stephen back from opening a portal and jumping the profiler.
“But how do we stop it?” Percy grits out. Stephen, who’s still, and probably always will be, a little wary of Percy, winces. “Well, you’ve gotta find the body, salt, and burn it.”
“You’re fucking kidding me.” Natasha says.
“Unfortunately, no.”
Percy wordlessly presses the heels of his palms into his eyes. “And how do we find the body?”
“There’s a spell I can cast; it’ll point you in the right direction, but I’ll need something the ghost has interacted with,” Strange mused. “Perhaps—”
Peter stuck his hands in his pockets and pulled out a giant fistfull of pennies.
Strange stared.
Peter blinked. “Do you need more? I have more.” To prove it, he stuck his hand in his other pocket, and—yeah, okay, another fistfull of pennies.
“...”
“I have some in my room, too.”
The spell required the penny pile, a few candles (they used the scented ones Percy had picked up on his Target trip with Matt Murdock the prior Halloween), and some borax.
“Body finding spell, no borax, no glue,” Mal mumbled as they watched Strange set it up. He drew some funny little shapes with the borax, lit the candles, and did a few hand motions that, to Bucky, seemed similar to finger knitting, only, you know, without the string.
The borax jumped up, swirled in the air a few times, before disappearing in a cloud of hot pink dust. The candles blew out on their own. The pennies remained unaffected (to the untrained eye, for no mortal could describe how those pennies had internally transformed).
“Alright,” Stephen said. “You smell…” He picked up the candle on the left. “Evergreen Mist, and you’re heading in the right direction. Smell…Summer Storm, and you’re going the wrong way. Got it?”
“Just to clarify; we’re sniffing out a body?”
“The body, and yes, you are. Good luck.” That last part seemed to be mostly directed to Tony. “I’ll be seeing you later.”
“Wait, you’re leaving us to find the ghost?” Peter asked incredulously. “I haven’t watched Ghost Files or Buzzfeed Unsolved in forever! I’m not qualified!” He lamented.
“And you won’t be for at least two years. Body searching is for adults and search dogs, and you are neither.” Tony said sternly. Peter just sighed.
“Fuck it,” Natasha muttered. “Let’s just go. Percy, you on sniffer dog duty?”
He sighed. “Well, Mrs. O’Leary is certainly busy, so I guess. How long will this take?”
Stephen shrugged. “Depends how good at sniffing you are. A few hours, probably.”
“I’ll get the shovels,” Bucky groaned. He pointed at Stephen. “We better be back in time for our Halloween party.”
“...I suggest you go in costume, then, to save time.”
“Oh, fuck you.”
“Wait, what should I do while you’re gone?” Peter asked.
“I don’t know—penny hunt? Hang out with your friends? Whatever you want, kid, as long as it follows the Code.”
“No significant property damage, no people lost, no people acquired, no toxic substances, no Drink, and no more marsupials.” Peter recited. Tony gave him an approving nod and a head pat.
Fifteen minutes later, all dressed and carrying their tools, they set out. They didn’t get many strange looks, thankfully—it was Halloween in New York, after all. The sun was just beginning to dip towards the horizon, bathing the city in a soft orange glow that matched the color of the trees lining the streets.
Percy led them, taking twists and turns seemingly at random, occasionally stopping or doubling back. Thirty minutes later found them standing in front of a large, wrought iron fence.
“...It’s better than digging one out of a river, I guess,” Tony offered.
“I don’t think it is.” Percy replied flatly.
“...Right.”
“RISE!” Peter screamed. “RISE, MY SON!”
“Our son,” MJ corrected mildly as she flipped down her welding mask. “We all contributed to the penny pile.”
“Yeah, but Peter brought the ghost pennies,” Abe breathed. “Ghost pennies, MJ.”
Off to the side, Ned feeds a blindfolded Charles an unwrapped Twix bar.
“Left,” Charles announces after a second. Betty, behind him, nods and marks it on a clipboard. 38 consecutive correct guesses.
“FUCK!” Sally screamed. Charles slipped off his blindfold. MJ flipped up her welding mask.
“Yes?” Abe asked politely.
“My Temu costume was supposed to come today, but apparently, some dipshit decided to stuff cocaine in between my packages, so border control seized it!” Sally waved her phone at them.
“Yikes.”
“Damn.”
“L.”
“Not radical, I fear.”
“Oh,” Peter said. “Unfortunate. Penny?”
She took the penny. “Thank you, Peter. You’re the only bitch in this house I respect.”
Ned unwrapped another Twix. “We could run to Spirit Halloween,” He offered.
Sally stood up. “Ned, you’re the other bitch in this house I respect. You and Peter should have respectable babies together.”
“We’re trying to focus on ourselves for a bit,” Ned said cordially. “Anyways. Who wants to come?”
Obviously, the answer was all of them
However, none of them could drive. Cindy was the only one bothering to get a license at the moment, and after she rammed into that preschool soccer field, she wasn’t allowed to be at the wheel for six months.
“We need a responsible chaperone,” Peter said, forlorn.
From the couch, Mrs. O’Leary yawned.
Slowly, the eight teenagers turned to her.
“She seems quite responsible,” Commented Abe.
“Respectable, even.” Added Sally.
They all smiled.
There was something awfully eerie about this whole thing. Which, like, duh, they’re standing in the biggest cemetery in the country, under a full moon, on Halloween, with two shovels and a tarp.
“Well,” Tony said, voice pitched low. “Who wants to go first? Because it’s not me.”
Bucky gave him a nasty look. “Why the fuck are you wearing a suit?”
Tony shrugged delicately. “We do have somewhere to be after this. Won’t have time to change.”
“Okay,” Percy said, quiet as the rest of them, picking up one of the shovels. He tested its weight in his hands, rolling the long shaft in his palms by curling his fingers. “But what are you supposed to be?”
“Well, Pep and Rhodey and I have already all been eachother, so we all decided to be Happy.”
“Bet he loved that,” Natasha commented idly, picking up the other shovel. Her gloved hands flexed as she stuck the tip of the shovel into the dirt, using her heel to leverage it down deeper into the earth. Percy followed, beginning to dig on the opposite side of the marked grave. The pale moonlight washed him out, turning the stark crimson of his scarf, once the color of fresh, free-running blood, to a desaturated pale.
“He will.” Tony said, lips twitching upwards in the dim lighting.
Bucky craned his neck to look around, eyes skimming over the rows of gravemarkers; crosses, headstones, and bevel markers, all in uniform rows, the exact same distance apart from the next. A faint breeze blew in, rustling the almost-bare trees and mowed grass. Bucky ducked his chin down a little bit into the rich red fabric of his cloak, hands tucked under his armpits.
Natasha huffed, digging out a small rock in the loosened soil. “I could be tipsy by now.” She muttered. “But no.”
“You can get tipsy?” Percy asked sardonically, dropping a shovelful of dirt on his other side.
“I can if that lamppost of yours holds up her end of the bargain.” Natasha snipped back.
Percy rolled his eyes. “Lee is not a lamppost, Nat.”
“I’m pretty sure she’s taller than Thor. Thor, Percy.”
He snickered quietly. “Yeah,” Then he muttered something about lame, fake-ass gods and a loser pantheon, all while continuing to dig.
As the minutes ticked by, fog slowly rolled in, clinging to the ground in thick curtains. Bucky cast another look around the cemetery, scanning over the distant fences. Other than the sounds of Percy and Natasha digging, it was almost entirely quiet.
“Gods, this is kind of boring.” Tony whispered, dark eyes reflecting nothing but moonlight. “Graveyards are boring.”
Natasha pointedly dug the sharp tip of her shovel into the dirt, and Tony held his hands up.
“Cemetery.” Percy corrected. “Graveyards are typically attached to churches.”
That got him a few raised eyebrows. He shrugged as much as he could while still moving earth. “Nico.” Was all he offered.
“Ma’am, I’m sorry, but you can’t take your…uh, what is this?” The manager asked, staring at Mrs. O’Leary with a not insignificant amount of fear.
“Her name is Lea, and she’s my cousin.” Betty deadpanned.
The manager stared. “I…kid, seriously—”
“She has a disorder.” Charles jumped in. “Don’t be rude.”
That got them a tired glare. “Kids, I’m going to have to ask you to leave—”
“We’ll sue.” MJ blurted out.
“For what?”
“Discrimination…” Peter said slowly. “Against…uh…our aunt…who is…Enhanced? Yeah. Our Enhanced aunt. There’s laws against that, you know.”
“She’s all of your aunt?” The manager repeated. “I’m sorry, Enhanced? You’re telling me this is a person with an enhancement?”
Mrs. O’Leary nodded.
The manager stuttered out an apology and backed away.
Natasha grunted, hauling out another clump. She hauled herself out of the pit they’d dug—about three feet deep. “Alright, I’m tapping out. Supersoldier, you’re up.” She said, tossing Bucky the shovel. He caught it without blinking and took her place, opposite of Percy.
Bucky digs in silence with his boyfriend. He’s been on worse dates, he’s pretty sure. Definitely done worse work—it’s cold, but it’s not Yakutsk, and the digging isn’t wonderful, but this time he’s digging up a body and not hiding one.
“So,” He says, tossing up a shovelful of soil onto the tarp laid over the grass. “What are we doing for Thanksgiving?”
Percy’s currently rather short temper is no match for Bucky’s little smile. “You want to brave my family get-togethers this year?” He asks, digging the tip of the shovel into the hard earth.
“‘Course,” Bucky grunts, removing a hard clump of rocks. “Tell me about ‘em?”
“Well,” Another shovelful, “My dad’s side—you’ve met some of my cousins. Nico and Hazel like you already, which is a great starting point. Frank and Will like who Hazel and Nico like, so that’s easy. Jason thinks you’re cool purely because I told him you have a first edition copy of the Hobbit—” Getting that back from the Smithsonian was a bitch, by the way, “—and he’s a nerd. Piper is jealous of your hair, so, uh, maybe be careful around her, because she genuinely might try and shave it off in the night to make a wig. Reyna’s a bit tougher, but she respects you, and that’s further than most people get.” Percy says. “Leo tells bad jokes. Don’t laugh at them, please. The Stolls might try and fuck with you, but I’m confident you can handle it. Fight Clarisse if she asks.” He pauses in his digging, dimples flashing as he smiles. “Lea likes you, so that’ll get you further than pretty much anything.”
“Fuck yeah,” Bucky mutters. “What about the other side?”
“Surprisingly, that’s the worse side. Paul’s a great guy, but damn, some of the people in his extended family are awful. He’s got two sisters and a brother—the youngest sister’s cool, the other two suck. His dad’s alright, his mom’s…complicated. His uncle is racist as shit, and last year, we told him if he comes back to our house, we were gonna cut his hands off with a meat cleaver.” Percy shrugs. “His grandma’s awesome, though. I think you’d like her. Everyone else is just alright, or I haven’t really talked to them much.”
“Huh,” Bucky says. They’re about five feet deep, now, getting closer to six. It’s been over two hours, the moon having crawled further up into the sky. “Is it at your place this year?”
“Fuck no, Mom said she wasn’t hosting ever again. Paul supports her completely on that. It’s at his aunt’s, I think? Not sure yet.”
“Am I allowed to terrorize people?”
“Encouraged, meu dengo.” He replied easily.
Bucky laughs quietly, conscious of their surroundings. “Looking forward to it.”
“I don’t think that was a very politically correct thing to do,” Betty whispered as they wandered into the store. “Isn’t that taking advantage of laws surrounding minority groups? Like claiming your pet is a service animal?”
Peter pondered this for a moment. “Well, she is a service dog. Just not mine.”
“That’s not the important part, Peter,” Said Abe. “We could get canceled.”
“I think it’s okay. I’m Enhanced and I said it, so…”
“Can’t argue with that, I guess.”
“Sounds right to me.”
“Cool, because I cannot afford to be canceled again.” Betty said.
“Betty, you sent Elon Musk messages telling him to go to space so he could die there.”
“...And?”
“Hey, wait—why didn’t we just say she was our service animal?”
“All of ours? Our collective service animal?”
“What, like that’s worse than all of our aunt?”
“...Touche.”
The clang of the shovel reverberated through the pit as Percy struck something hard. He leaned down, brushing away dirt with a gloved hand. “Coffin,” He reported.
“Thank God,” Natasha muttered. They’d been there for about two hours already, and, even through the arduous task, Bucky was still feeling the late autumn chill, exacerbated by the foggy night. Together, they got the dirt off of the lid, and Bucky pried it open with a deft hand.
The remains were mostly decomposed—thank God, considering how sensitive Percy’s nose was. Pearly white bones stared back at them, gleaming and unassuming.
“Bastard.” Bucky spat at them.
Percy leaned down, toeing at a femur. “Thin coffin,” He remarked. “It’s already mostly rotted away on the bottom.”
“Shit, let's just get this over with,” Bucky grunted. “Salt?”
Above ground, Tony hummed. “Two minutes.”
“I’m sorry?”
“Justin will be here with the salt and the kerosene in two minutes.”
“Who the fuck is Justin?” Percy asked incredulously. Tony shrugged and held up his phone. “I don’t know, but he’s got good reviews, so…”
The cemetery had never been more silent.
Then, suddenly, Percy screams and launches himself at the opposite side of the pit, towards Tony. His fingers dig into the dirt as he begins to haul himself out. “Do you think this is a joke?” Bucky catches him around the middle, holding him back from jumping their friend. ”I’ll fucking kill you!”
“Someone’s cranky,” Natasha muttered, leaning on a discarded shovel, eyes on the front gate in the distance.
Percy screamed wordlessly and Bucky tightened his arms. “Hey, let’s not antagonize him, please?” He begged overtop Percy’s rage.
They went aisle by aisle. Ned got scared by an animatronic and Cindy carried him for ten minutes until he regained consciousness. While Abe was messing with a ouija board on display, MJ came behind him and blew cold air on his neck. He freaked out and hit his head on the corner of a shelf. They had to go to the checkout counter to get a bandaid.
“Uh…” The teenage cashier looked hesitant. “That’s a lot of blood, guys. I…I think I should call an ambulance.”
“Don’t you dare!” Betty said cheerily. “We can’t afford that!”
“No, no, he’s—Oh, my God, I think he passed out. I’m calling an ambulance.”
“I will send a bomb to your house.” Abe slurred.
MJ waved a hand. “We’ll lay him down under the animatronic display. The jumpscares will keep him conscious ‘till he stops bleeding like a little bitch,” That last part was said quite pointedly.
Abe groaned, slumped over Peter’s back. “Scratch and sniff my ass,”
The sudden glow of headlights hit them. Tony covered his eyes, looking away, and Natasha hissed. Long, rounded shadows cast across the grass from the headstones. A car door opened, then, after a long pause, shut.
“Gate’s unlocked!” Tony called out. Picked, more like, but, whatever. The gate creaked hesitantly, and distant footfalls grew closer. Haloed by the left on headlights, a thin, lanky figure approached, a plastic grocery bag in hand.
Justin. Their savior.
The man—barely, really, he couldn’t be older than twenty—stopped about twenty feet from them. “What the hell, man?” He asked, voice drawn out and slow.
Tony shrugged. From the pit, Percy, who’d gone limp in Bucky’s arms, tried to slam his head into the pile of dirt.
Natasha sighed, slinging her shovel over her shoulder and striding towards the unfortunate college student. She held her hand out expectantly, and, delayed, Justin handed over the bag. Natasha peeked inside, and, apparently satisfied, asked, “How much do we owe you?”
Justin’s eyes were tinted red. “Uh,” He drawled out as he thought. “Nothing, my man. Paid in the app.”
Natasha hummed and went for pocket anyway. Out of a fine, leather wallet, she handed the guy a couple bills. She patted him on the chest. “Tip.” Was all she offered.
He gave a lazy thumbs up. “Thanks, man.” He squinted. “You Kim Possible?”
“Sure am,” Natasha called over her shoulder as she strode back to the pit. “And that’s Merlin and Arthur in the grave.” Tony made a noise in the back of his throat, and she tacked on, “Happy Hogan, as well.”
Justin nodded. “Sick. Thanks for the tip.” He gave them an almost incomprehensible salute before trudging back to his car.
Natasha handed Tony his wallet as she walked past him to hand off the bag to Bucky. “Wh—when did you get that?” He asked.
She just shrugged.
Tony sighed. “Did you at least grab the small bills? They’re easier to use.”
“Yeah. I’m pretty sure private citizens can’t legally hold $100,000 bills, by the way.”
Tony waved her off.
Natasha leaned over the pit. “You guys doing okay?”
Bucky released Percy, who just sighed and leaned into the dirt wall. “Whatever. Give me the bag.”
She shared a look with Bucky, and then identical shrugs, and dropped the bag. Percy dug his nail into the top of the bag— food grade sea salt, it was labeled—and grabbed a giant fistfull. Unceremoniously, he dumped it atop the ribcage. Bucky soon joined him, eventually just dumping the entire bag into the grave.
Then, they grabbed the kerosene.
Bucky took control of that one. He loved Percy with his entire soul, but with the mood he was in, Bucky didn’t particularly want him to be in control of the fire. He soaked the remains entirely, mixing with the salt in small, coagulating puddles at the bottom of the open grave.
Back in the costume aisles, Charles was holding up options.
“Ghost?”
“Lame.”
“Witch?”
“My sister’s doing that.”
“Cher from Clueless?”
“Eh. Yellow isn’t my color.”
“Pirate?”
“I eat way too many grapefruits to have scurvy energy.”
“True. It’s a concerning amount. Uh…Flamin’ Hot Cheeto?”
“What? No. What?”
“Okay, I tried.”
“Alright,” He called up. “I think we’re good!” He turns to Percy and gestures to the top of the pit. “If you please,” Percy sighs and lifts himself up out of the pit. Bucky certainly does not look at his ass as he does it.
Tony hands Bucky a matchbook as soon as he’s on the grass. Bucky strikes one with a special sort of vindictiveness and watches it catch. He drops it into the open grave. For a second, nothing happens, and Bucky’s worried that Tony’s going to have to call some other stoner to go on a Walmart run for them, and Percy’s actually going to kill Tony, which would be a significant downer—especially because Tony’s petty as shit, and would certainly begin to haunt them, which would start this whole issue over again.
The body goes up startlingly fast and sudden—one second there’s just a pit, and the next, a roaring blaze explodes in the open grave. It’s hot, pricklingly so, even from where Bucky’s standing, a few feet away.
They all stand there and watch it burn—Tony thinking about his forks and playlists, Bucky about his arm, Percy about chicken bouillon and naps, Natasha about her stuff, and all of them about glitter and pennies.
Flames lick up the side of the grave, but don’t escape, hissing and spitting and crackling as they consume.
The world around them goes silent, overtaken by the whisper of fire.
Bucky sticks out his hands, warming stiff fingers. Eventually, Tony joins him, taking his hands out of his suit pockets and rubbing them together. The moon above casts everything a desaturated blue, but right there, in that little moment, everything is bathed in gold.
Abe, splayed out on the ground, tilted his head to the side, cheek cold against the tile.
A small child holding a Lightning McQueen costume stood at the end of the aisle, staring down at him.
Abe tossed a hand up in a sluggish wave. “And a skibidi greetings to you, young one.”
The child approached.
“Sally.”
“Yes?”
Charles wordlessly held up a costume bag.
“...I’m going to kiss you on the mouth. Right now. Come here.”
“Costume, secured!” Sally exclaimed after the cashier handed back her change. The cashier refused to make eye contact. It was a different one from the one Abe had threatened. Perhaps, for some reason, the original one had gone on break.
Charles bounced on the balls of his feet as their group coagulated near the doors. Peter and Betty both had scorch marks on their faces. MJ, Ned, and Cindy all had a distinctly haunted look in their eyes as they approached from the direction of the bathrooms.
“Where’s Abe?” Peter asked. “I’m assuming he stopped bleeding eventually. Cindy?”
“What?”
“...You were watching Abe.”
Cindy threw her hands up. “God, can’t I have a moment to myself! This is the shit Linda was talking about, guys. Boundaries.”
“Sorry, Cindy,” They all chorused.
“Thank you.” A pause. “Yeah, I have no idea where Abe is.”
“Well,” Natasha says, watching the dying bonfire. “Back home, anyone?”
Percy yawned.
“I’m hungry,” Bucky shrugged.
“Yeah, I could eat.”
Together, they grabbed a hold of the edge of the tarps surrounding the open, smoldering pit, and lifted, sending six feet of dirt tumbling back into the hole. It smothered the remaining embers, and, dusting off their hands, the four picked up their shovels and left the site.
As Tony held open the gate for them all to pass through, he paused. “Hey, what’s Pete up to?”
They found him holding hands with a small child, leading him down the aisles. “Oh, hey guys.” He said.
“Were there always two of them?” Cindy whispered to Ned.
“Don’t think so,” He whispered back. “But I can’t give a definitive no.”
“What’s with the pet?” MJ asked.
“This is my son, Carl.” Abe said. “He found me in the plastic swords aisle.”
“Oh, cool. I’m your Aunt Sally,” Sally told the small child.
“Jag vill döda ett stort antal människor,” Carl replied.
“He doesn’t speak English.” Abe explained. “Come along, son. We’re going to a Halloween party.”
Mrs. O’Leary chaperoned them back to the tower.
They missed the trick or treaters. By a couple hours.
Pepper and Rhodey, in suits identical to Tony’s, were waiting for them. The common room had been decorated; there was a massive skeleton in the corner, mysterious smoke coated the floor, and the whole place was covered in cobwebs.
Stephen sat with the two at the bar, all three holding a colorful drink and, based on how they were leaning in, were having an absolutely insane gossip session.
The elevator opened, and out stepped Tony, Percy, Bucky, and Natasha—three of whom were covered in dirt, and one pristinely clean. Percy’s eyes were half shut.
Stephen took a sip of his cocktail. “Have fun?” He asked languidly.
Bucky’s hand clapped down firmly on Percy’s collar. “No.” He said, and he wasn’t talking to Strange. Percy took a deep, meditative breath.
Tony shrugged and went to sit next to Stephen. Without even looking at the other man, he swiped his drink and drank half, then sliding it back to him. “What have you guys been up to?”
Stephen’s face now held a distinctly pink tinge as he replied. “Just handed out candy.” Same as last year, he was wearing a cheesy wizard hat—this one, however, was a bright blue with stars, as opposed to last year’s plain black.
Natasha checked her watch as Percy wordlessly pointed to the couch. Bucky huffed, but there was no hiding the slightly pleased look on his face. He sat at the edge, back against the arm of the couch, with one leg stretched across the cushions and the other foot on the floor. As soon as he sat, Percy dropped down next to him, leaned his head on his armored chest, and promptly closed his eyes. Bucky ran a hand through his hair, then draped his discarded cloak over Percy as a makeshift blanket.
Natasha checked her watch again.
The elevator dinged, and Mrs. O’Leary trotted out, followed by Peter and his friends. Abe was in a fireman’s carry over Betty’s shoulder, but was followed by a small child in a Lightning McQueen costume. She deposited Abe on the couch opposite of Bucky and Percy, glancing at them as she did so. “BBC Arthur and Merlin?” She noted.
Bucky nodded.
“Homos.”
“That’s the plan.”
“Who’s the child?
“Carl.”
“Jag har en kniv,” Carl said. Bucky blinked.
Peter adjusts his ascot. “I’m Fred!” He chirps. “Charles is Scooby, MJ is Hot Dog Water, Cindy is Daphne, Betty is Velma, and, well, Abe got voted to be Ronald Reagan, to match Sally, but he refused to get into costume, for some reason.”
Abe, muffled by Betty’s yellow turtleneck, said, “Ma…pa… just swallered a little lego feller…and I aint feelin’ so good…”
Natasha ignored all of that. “What’s Sally, then?”
Sally sighed. “I was going to be Scrappy Doo, because I lost the sudoku tournament we did, but the stuff I ordered is in an FBI warehouse somewhere.” She explained. “But Charles found this for me, which is way better, so,” Sally is wearing a shirt that says ‘If she don’t hawk tua, I won’t talk tuah!’ and pink coveralls tied around her waist. They also say ‘hawk tuah’ on them.
“It’s in an ironic manner,” She says airily as she heads for the candy bowl. “Spirit Halloween had my back. It’s a social commentary.” Charles nodded along solemnly.
“Oh,” Says Tony.
Carl goes into the kitchen and begins to poke around the cabinets.
Natasha checks her watch again, then looks up at the elevator. As if on cue, it dings, and the SWORD team comes spilling out. Every single one of them has a distant, war-torn look in their eyes. One by one, they file out, Lee at the lead. He was dressed in a fireman’s coat and hat, and a massive tupperware was tucker under one arm, balanced against his ribs. Next to him, Bridgette, in pink with matching goggles atop her head, waved.
“Thank God,” Natasha muttered as Lee approached her. He held out the tupperware. It was full of something that looked like water, but smelled like paint thinner. She cracked it open, took a deep whiff, then looked up at Lee. “My thanks, friendly lamp post.”
“...Alright,” Lee said.
Ross, dressed in green, a hat with a recycling symbol on his head, plopped down on the couch next to Abe. “‘Sup,”
“They call me Zac the way I be wondering what the Efron with me,” Abe slurred, holding up a hand and waving about. Ross high-fived him. “Fuck yeah, my man.”
Mal, who seemed to be a lifeguard of some sort in bright orange, went straight to the candy bowl, Dan, in high-vis and a hard hat, followed.
It was only then they realized the elevator was still open. Spencer stood in the back of it, covered head to toe in a toxic green substance. From what could be seen through it, his outfit was more of a coral-pink than Bridgette’s, lined with blue. His hair has been pulled into two, tiny pigtails, now dripping with green.
“The hell happened to him?” Rhodey asked, leaning over Pepper to get a better look. Bridgette turned, saw Spencer, and sighed. “Oh, come here,” She muttered, grabbing him by the arm and dragging him into the kitchen. From the candy bowl, Mal shook her head. “He got Nickelodeon Slimed.”
“...Why?”
Mal just shook her head, haunted.
In the kitchen, Carl is on his tippy toes, trying to reach the stove. “Oh, shit,” Ross says. “Here,” He turns on a burner for the child.
“Tack. Jag vill bränna den här staden i en hedonistisk glans av härlighet.”
“Oh, you want to make…soup?” Ross stares intently. Carl nods. Ross hums. “I can see if there are any cans in the pantry. Come along, creature.”
Back in the living room, Percy lifted his head blearily. He squinted in Spencer’s vague direction, blinked a few times, then waved his hand, almost smacking Bucky in the face. In one smooth wave, the strange slime slid off Spencer as if it had never been there in the first place. It twisted and turned in the air like a serpent before diving headfirst down the kitchen sink. He laid his head back down.
Stephen scrutinized Percy, as he often did, as Pepper looked to the SWORD team. “And what are you guys?”
“Paw Patrol!” Ross exclaimed. “I’m Rocky, Spencey is Liberty, Lee is Marshall, Bridgette is Skye, Mal is Zuma, and Dan is Rubble.” He explained. “We were going to ask Jackson to be Ryder, but Barnes got to him first.” He shook his fist at Bucky, who looked rather amused.
Eventually, they all piled onto the couches, the floor, and, in some cases, eachother. Dan switches with Ross and begins to make soup with Carl. It’s chicken and stars soup. As the rest of them turn on Clue, Dan gives Carl soup in a small plastic cup. “We’re lucky you only needed a spoon,” He says, “Because for some fucking reason, I can’t find a single fork.” He says, bewildered.
“Don’t cuss in front of the kid!” Bridgette calls from the living room.
“Denna soppa gläder mig.” Carl says, taking a sip of his soup. “Olycklig. Jag kommer att sakna dig när du tas.”
“I think he likes the soup, guys.” Dan says.
Percy, still half asleep and burrowed into Bucky, lets out a small huff of laughter at the movie. Bucky’s carding a hand through his hair, nails lightly scratching at his scalp. The demigod is putty in his hands; a warm weight on his chest.
A soft round of laughter at a dramatic scream on screen.
Dan leads Carl into the living room, letting him take his pick of seats. Carl ends up sitting on the other side of Mrs. O’Leary, completely dwarfed by her.
Carl points at the screen. “Den här filmen är humoristisk, men orealistisk. De kommer inte att kunna hitta vad som hände med er alla.”
Percy, for the first time in two hours, sits up a bit. He clicks his tongue against the roof of his mouth and leans over to Carl, swiping a discarded—but clean—napkin over the kid's cheek. “Bit of soup,” He says before laying back down. Carl gives him a wide-eyed look. “Hur pinsamt. Mitt tack för att du förhindrade den indigniteten.” He blinks round eyes. "Din halsduk är en behaglig röd färg. Jag gillar det ganska. Du har också en visuellt slående symmetri i ansiktet. Jag är benägen att skona dig i min nya värld.”
The movie plays on.
A solid five minutes later, Lee speaks up. “Gud, du er en merkelig jævla gutt. Hvor fant de deg i det hele tatt? Faktisk bryr jeg meg ikke.”
Carl’s eyes widen as he stares at her. Lee raises a brow at him. “Ja, jag kunde förstå dig hela tiden. Svenska och norska är väldigt lika språk. Jävla med min skit så slänger jag dig från det här tornet. Förstår du mig?”
“Jag förstår.”
“Bra. Happy Halloween.”
Notes:
hi. im aware its been like three months. my bad.
happy halloween!
plumbing baby. goodbye
Chapter 48: turkey time
Notes:
(See the end of the chapter for notes.)
Chapter Text
Jenny’s fucking turkey was burning. Percy could smell it burning. He liked to close his eyes and pretend it was her.
Bucky closed the car door, coming to stand next to Percy at the edge of the obnoxiously long driveway. Bucky squinted up at the house, hands stuffed in his coat pockets. “Shit,” He muttered.
Percy sighed. “Yep,” He muttered.
“You think with…Tony, and all that, this would be less shocking.”
“Somehow, billionaire philanthropist is less unsettling than suburban upper middle class.”
Bucky whistled lowly as he took in the house’s brick face. Shuttered windows symmetrically line each side of the French double doors, bracketed by white columns that support a balcony directly above the front steps. Sculpted bushes lines the short ascent to the house, set aside from the path by brick curb.
“We can always turn around and go to McDonalds,” Percy said under his breath.
“Christ, what happened to supporting your mom and helping Lucas get to know Paul’s family?” Bucky snarked. “This was your idea, baby.”
“Fuck, it was,” Percy muttered. “Whatever, let’s go. Paul texted—they got here half an hour ago.”
Bucky hefts the bag over his shoulder, taking in the host of other cars in the circular driveway. “Fashionably late, then?”
“Sure,” Percy takes his free hand. “We can go with that.”
Bucky’s first impression is how white everything is. The tile, the walls, the ceiling, and the furniture, save for some natural wood accents, in the same pale, eggshell white. Even the bulbs in the small chandelier hanging over the table in the middle of the foyer is white rather than a warm, yellowed tone. There’s a staircase curling around the back of the room, an open arch leading to a door to the yard straight ahead, two doors to their left, and one to their right.
Percy takes them left, through a godsdamned butler’s pantry, then turns through another door, which opens up into the kitchen. Again, it’s all the same color; white cabinets against white walls. Dishes cover the main island—two covered casserole dishes, one that smells like sweet potatoes and the other like green beans, three pie dishes; pumpkin, apple, and pecan, and a pan of rolls. There’s a massive pot with a lid on, the burner beneath on low, full of mashed potatoes, and another with gravy. In the oven, a massive tinfoiled turkey is still cooking.
Bucky’s nose twitches. “It’s—”
“Burning,” Percy agrees quietly. “And yet, part of it is quite undercooked. Let it happen.”
There’s a loose group of women standing in the kitchen. Based on the mission briefing he was given, Bucky can identify the targets.
Marie Jenson: cousin to Paul Blofis, HR manager. A tad obnoxious. Spoils her kids. Brought the sweet potato casserole. Married to John. Children; Hunter and Mackeyleigh. Undetermined.
Nina Blofis: younger sister to Paul Blofis. Public librarian. Currently looking quite annoyed. Brought the apple pie. Married to Gabriel Blofis, who took her name—this caused a bit of a stir with some of the older family members. Potential ally.
Jenny Price: older sister to Paul Blofis. Registered nurse. Married to Ryan Price. Has two children, Layla and Andrew. Encouraged them both to pet Mrs. O’Leary in her service dog vest last time Percy went to Thanksgiving. Enemy.
Nina is the first to see them. “Oh!” She exclaims, putting her wine glass down and rounding the island to give Percy a short, half-hug. “It’s good to see you, darling!” She exclaims. “How have you been doing?”
He smiles back at her. Though his eyes are hidden behind sunglasses, Bucky is fairly sure they’re crinkling in that way they do when he’s genuine. “Just fine, Nina. Thanks.” She turns to Bucky. “Oh, and you must be James!” She sticks her hand out. “I’m Nina, Paul’s sister.”
I know. I have your employment history, report cards, and a copy of your driver’s license, Bucky does not say. Instead, he shakes her hand. “That’s me,” He says.
Nina gives them both another wide, red-painted grin. As she turns away from them, she gives Percy’s arm a quick squeeze, whispering nice one! to him. Percy, knowing Bucky’s enhanced ears easily picked that up, gives him a lopsided grin.
“Jenny! Marie!” Nina sings. “Percy’s here with his boyfriend!”
As expected, Jenny’s face is a little tight. “Thank you for coming,” She says, perfectly pleasant-sounding to anybody but the two men in the kitchen. “I see you brought drinks?”
Bucky puts the bag on the counter. “Help yourself.” He says, making direct, prolonged eye contact. She shifts and looks away.
Victory number one.
Marie gives them both a small greeting, but seems preoccupied with draining her heftily filled wine glass.
Nina begins putting bottles in the fridge. “Everyone else is out back, I think!” She says over her shoulder. “Sally, Paul, and the rugrats, definitely!”
“Thanks, Nina!” Percy calls, taking Bucky by the hand and tugging him in the direction of the main back doors—because there are multiple back doors, of course.
A long, paved path snakes its way through trimmed bushes and pruned flowers, splitting off into two; one to a heated, in-ground pool, and the other to a shaded gazebo, which shelters a few tables and a crackling firepit.
Estelle and Lucas are in the pool—playing mermaids, Bucky’s pretty sure. They’re joined by a girl a few years older; Carmen, age eleven, daughter of Eliza and Michael Blofis, Paul’s older brother. Sitting at the edge of the pool is a boy; Andrew, age fourteen, son of Jenny and Ryan Price. He’s got headphones on, connected to the handheld console a few inches from his face. In a lounge chair under the shade of a tree is his sister, Layla, age seventeen. She’s got a book and is bundled up in a thick sweater.
Based on his intel, there should be two more children, Hunter and Mackeyleigh. He’ll have to keep an eye out, in case of potential ambush.
There’s a large table set up under the gazebo, fairy lights hanging overhead from tree branches. The small fire pit is set up adjacent to the head of the table. At it, Sally sits with John, Marie’s husband, and Cynthia, Paul’s mother. She’s got a smile on her face, but a guarded look in her eyes. A masterful opponent for the two unsuspecting civilians.
Paul himself is standing by the firepit with Michael, his brother, and Ryan, his brother-in-law. Paul looks about two minutes away from smashing his glass over their heads.
Percy heads to his mother first, dipping down and pressing a kiss to her cheek. “A vodka está no frigorífico,” He says quietly. “Nina won’t snitch.”
Sally laughs. Her eyes crinkle the exact way Percy’s do. “É bom saber. O tio de merda do Paulo ainda não apareceu, mas o irmão dele já perguntou se o Lucas veio de um caso que eu tive.” She says.
Across the table, John’s smile is fixed on his face. “What’s the joke?” He asks. “C’mon, Sally, you know we can’t understand you!” Sally smiles sweetly at him. “Oh, just asking about work.” She dismisses. Percy gives John an almost identical smile, just with sharper teeth.
“And what is it you do, again, dear?” Cynthia asks, swirling her wine around in her glass.
"I work for an IGO." Percy says dismissively. "And Jamie, over here, works in security,” Percy says, holding out an arm for Bucky to come take a hold of. “Have you been introduced?”
“Can’t say I have,” John replies, holding out a hand, which Bucky shakes. “Good to meet you.” John’s got an easy sort of grin, something sly and sharp between his teeth.
Bucky nods at him. “You too.”
“Firm grip, there. Helluva security job, no?”
“Ex-military.” Bucky explains.
“Oh, really?” John seems unduly surprised by that. “I didn’t think—well, someone like you would have been in the military..”
“Excuse me?”
“Gay,” Percy says, taking a sip of his drink. “He means gay.”
“Well, when you phrase it like that, you make me sound like an asshole!” John laughed.
Percy takes another pointed sip.
They end up at the poolside. Estelle and Lucas both haul themselves out and launch themselves at Percy and Bucky, soaking them with hugs. Percy laughs and spins Lucas around while Bucky hauls Estelle up.
"Acho que você está mais pesado! Parece mais alto do que da última vez que te vi!” Percy says to a beaming Lucas.
“I missed you!” Estelle shrieks happily. “Aqui é tão feio!”
Bucky and Percy both laugh. Carefully, Bucky responds, accent a little halting, “Eu sei que é.”
Estelle claps happily. “Good job!”
Another shriek draws his attention back to Percy, who has Lucas by the ankle and is dangling him over the pool. “What do we think, guys?” He asks. “Do I dunk him?”
“No! No! Não!” Lucas giggles. Estelle starts chanting for them to do it, so Bucky similarly grabs her under her armpits and holds her over the water.
“Three… two…” They both start swinging the kids, releasing them on one with a giant splash. Both surface laughing, then quickly get drawn into a game with Carmen. Percy casually nudges Bucky with his elbow, and the water soaking the front of his sweater evaporates.
They run into Paul, as well. He greets them both, smiling as he side-eyes one of his brothers.
“Big plans?” He asks them.
“If you mean fucking shit up like last time I came…no.” Percy says.
Paul laughs.
More introductions follow. Gabriel, Nina’s husband, is alright, but other than that, practically everyone they meet very poorly, or not even at all, hides disdain. It’s a whip-lash inducing mix of things—some at the way Percy and Bucky link hands, some at Percy’s cane or Bucky’s arm, some at Percy’s subtle accent…it just goes on.
They’re bombarded by subtle digs and outright invasive questions, pointed looks and whispers that they can both easily hear. To be frank, it’s Hell.
Percy’s smile is pained. “Last time,” He whispers, “I made it an hour before losing my shit. I’m trying to beat my record.”
Bucky nods. “In that case, I’m going to go inside and try some of those breathing exercises Shannon keeps going on about.” He says seriously. “Or, I’m heading to the car, driving it into the house, and rigging it to blow.”
Percy hums. “Oh, no…the turkey…”
That gets a short huff of laughter. Bucky pecks him on the forehead—oh, yeah, there’s Cynthia giving him a nasty look and Ryan shielding Andrew’s eyes—and heads inside to the kitchen. He debates the vodka Percy stashed in the fridge, but decides to save the hard stuff for later.
“Ballsy move,” Bucky looks over. Layla Price is lounging across the barstool, half her attention on her phone. There’s a half-eaten piece of pie she’s clearly snuck in front of her.
He raises a brow at her.
She waves her fork around, a chunk of apple speared on it. “Showing up, y’know? I mean, Christ, last time Percy came to Thanksgiving, he slammed great uncle Patrick into a wall.” Layla pauses, raising a pierced brow. “You knew about that, I’m assuming?”
Bucky nods.
“Yeah, well, pulling something like that, skipping two years, then showing up with his boy friend…” Layla laughs something sardonic. “Ballsy.”
Bucky can smell faint traces of weed on her. Down the hallway, the door to the porch enters and Jenny sticks her head in. “Layla!” She calls impatiently. “Stop hiding inside! Come out here!”
Layla rubs a hand over her face, bitten nails and clunky rings. She grabs her plate and moves to the other side of the counter, sliding down to the floor, her back propped against the island. She looks up at Bucky. “I’m not here.” She says flatly.
His mouth twitches. Bucky grabs the bottle off the counter and heads for the back door. “It’s just me in here, Jenny!”
There’s a pause, then the door swings shut as Jenny hastily retreats. Bucky rolls his eyes as he rounds the corner and opens the door for himself, bottle tucked under his arm. Back in the kitchen, shaking a can of whipped cream to spray into her mouth, seventeen-year-old Layla snorts. “Ballsy,” She whispers.
The questions continue once he’s back outside. Andrew asks some very concerning questions about the military and if Bucky’s ‘gotten’ to kill people. Cynthia repeatedly, and not at all subtly, despite her apparent efforts, tries to find out if Sally has converted. Bucky’s pretty sure not even Paul’s religious, so, converting to what, exactly, he’s unsure.
Lucas is a bit of a hot topic, as well. Have none of these people heard of adoption? Bucky tells Michael, when he asks (he’s the fifth one), but it doesn’t seem to satisfy him. “They just look similar, is all,” He says, airily.
Which…no, they don’t. Like, remotely. “How so?”
“Oh, you know,” Michael says, waving a hand.
Bucky is, like, 99% sure that he just means they’re both Brazilian. So are 216.4 million other people, but whatever.
Seriously, Sally is also half Hawaiian, too, and Lucas isn’t. The racism isn’t even that accurate.
When it’s finally time for dinner, all of them— twenty two fucking people— gather in the dining room. The candles adorning the long table are lit, the dishes laid out in an appropriately classy manner, and the silverware gleaming in the low, warm lighting. Jenny is snapping pictures left and right, from a multitude of angles, but not a single one of the people in the room, other than Andrew, since his sister is still off hiding somewhere.
(She’s actually in the corner of the room, hiding behind the Jackson-Blofis family and company, but none of them speak up about it.)
The table, long and rectangular, seats sixteen; seven on each of the long sides, and one on the short. On the left, closest to the door, Thomas Blofis seats himself, his wife standing to his right. At the other head, Nina helps old Lillian Blofis, Paul’s grandmother, sit. Only Thomas and Lillian stay seated, though Lillian doesn’t seem to be able to stand on her own, as Jenny insists for them all to join hands for a quick prayer.
Bucky raises an eyebrow at Sally. “Christian?” He mouths. She just shrugs, and, quiet enough that nobody but a supersoldier or demigod would be able to hear it, replies, “When it’s convenient.”
He’s a little puzzled as to what that means until they finish the prayer, during which he respectfully dips his head, regardless of how tempted he is to throw the tureen of peas in front of him at almost every single person in the room.
As a chorus of amen fills the room, Jenny gives Sally and Percy a saccharine smile. “I hope you don’t mine our prayers,” She puts an odd emphasis on our, as if Sally and Percy didn’t participate. “It’s just what we do here.” Again, we.
Percy matches her tone of voice exactly. “And we think it’s real sweet.” He’s got that slightly patronizing tone down to a T.
“Ah, right…you don’t pray, do you, Sally?” John says.
“Sometimes,” She says. Sally Jackson, the amazing woman she is, doesn’t elaborate, maintaining eye contact with John with a peaceful expression on her face.
“Not…well, not like us though, yeah?” Michael asks. “Your turkey would probably be live to sacrifice, or something,” He jokes. Ryan and Jenny both make tittering little laughs.
Percy blinks. “That’s an interesting thing to say out loud.”
The silence that falls around the room as Michael splutters is almost magnificent as the man who caused it, Bucky thinks, ducking his head to hide a smile.
Nina clears her throat. “Anyway!” She chirps. “How about we—”
“What about you, James?” Thomas asks from where he’s sitting. “Do you go to church?”
“I haven’t been inside a synagogue in years.” Bucky replies evenly.
“Ah,” Thomas says. “Jewish?”
Bucky just shrugs.
“Anyway,” Nina repeats, louder. “Let’s dish up the kids and start eating, yeah?” She doesn’t wait for a response, standing aside and ushering the line of kids to the table. Hunter and Mackeyleigh, Andrew and the re-emerged Layla, Carmen, Lucas, and Estelle get their plates filled as they go down the table. Neither Lucas or Estelle even go near the turkey, and Paul winks at them.
Jenny tries to completely skip serving Lucas. Estelle starts complaining on her brothers behalf, and Jenny gives an over-the-top laugh. “Oh, I’m sorry, sweetie! I didn’t see you.” She plops a spoonful of potatoes on his plate.
The kids, sans Layla, trail out of the dining room to the table set up in the kitchen. The breakfast nook, Paul had told him earlier, utterly serious with a distinct humor shining in his eyes. They call it the breakfast nook. I don’t think a nook has seats eight, but, what do I know?
“Oh!” Sally gasps theatrically, her knuckles white on the top of her chair. “I need to take the pie out of the fridge. Paul, darling, a hand?”
He smiles politely at the family. “Excuse us,”
Bucky watches them go, skeptical. “I need to piss.” Percy announces flatly, turning on his heel to follow.
Keeping a straight face is probably the hardest thing Bucky’s ever had to do. “I’ll help.” Eliza gasps so hard she starts choking.
They congregate in the kitchen.
“I swear they’ve gotten worse,” Sally says in hushed Portuguese.
Paul nods. He, like Bucky, has an odd accent and stumbles over his words, but is near-fluent now. “They definitely have.” He agrees. “I think we’ve let them get too bold.” Paul Blofis looked like a very respectable, genial man.
That was only a correct impression most of the time.
“I’ve been asked if Lucas is an affair baby, questioned on my immigration status—” Sally was born in New York, by the way, “My income, how much of my stuff Paul pays for, Percy’s father, and why we’ve taught Estelle our other native languages."
“My disability, my sexuality and whether it was proper to bring James here in front of the children, my father, your parenting, where Lucas came from, and whether or not I’ve been to jail,” Percy reports.
“My marriage, my relationship with Percy and Lucas, Percy’s father, my income, our living situation, Lucas’s origins as well, when we plan on leaving the city, Percy’s father, Lucas’s father, why I’m letting ‘my child’ waste time on non-English languages, Percy’s father, Lucas’s father, work, Percy’s father, Lucas’s father.” Paul rattles off. “They really seem to want to know about Poseidon and Lucas’s parents.”
The three turn to Bucky. “My sexuality—same talk as Percy, honestly, whether I was really in the military, my job history, also Lucas’s and Percy’s fathers, and my arm. So many questions about my fucking arm.” He rolls his eyes. “Also, complete and utter shock when I said my parents were immigrants.”
Percy nods solemnly. “The white kind.”
Paul sighs heavily, leaning back against the counter. He chews on the inside of his cheek, looking at his wife and step-son. “I appreciate you,” He says. “You know that, right?”
Sally smiles at him, patting him on the chest. “I know,” She says. “And we, you.”
“‘Course, man,” Percy says easily. “We like you enough to put up with your shithead family, even.”
Paul huffs out a laugh. “Nina and Gabriel talked to me earlier,” He casts a furtive glance into the dining room. “They’re not coming back, next year. They don’t want their family to grow up around all of this.”
Sally gasps. “Family?”
He grins. “Yeah, Nina said I could tell you, but only if you kept it quiet. She’s not planning on telling pretty much any of them—the baby’s due in early May.”
Sally clapped her hands. “Oh, that’s wonderful! I can make them a baby quilt!” She enthused.
Paul gives her a look so full of adoration that Bucky feels compelled to look away. He wonders, briefly, if that’s how he looks at Percy.
“Layla’s ditching, too,” Percy says. “Going to college and not looking back.”
“So…nine of us, soon to be ten.” Paul says. He’s including Bucky, as well, he realizes, which makes something warm unfurl in his chest. “Definitely seems like enough to me, no?”
Sally’s brows raise. “You don’t want to come back?” She asks.
“Fuck, no,” Paul says, which makes Percy smile, pleasantly surprised by the vulgar display. “I can’t deal with this shit anymore, and I love you an incredible amount for putting up with it on my behalf, but I can’t keep asking you to do this.” Paul shakes his head. “The way they act is deplorable. I wanted Estelle and Lucas to grow up with at least some family on my side, like Nina and Gabriel, but now that they’re done with everyone…” He shrugs. “No point.”
“So…” Bucky asks. “What are you saying?”
Paul’s eyes flicked to the dining room and back. “Unless there are any objections, we’re done. No Christmas, no birthday celebrations, and Gods, no more Thanksgivings with the whole family."
Percy’s grinning something fierce. “And…?” He drags out.
Paul’s fighting a similar smile. “How did you phrase it? Ehm, let’s…fuck shit up?”
Sally and Percy have almost the exact same laugh. “We might have already started that,” Bucky says. “Percy said he had to go pee and I told everyone I was going to go help. Oops.”
Paul snickers into his hand.
They return to the dining room to receive a host of dirty looks.
“Well,” Marie says, “Now that we’ve all finally seated,” She snips, “Let’s eat, shall we?”
The kids taken care of, everyone else sits down; Nina, her husband, Gabriel, Layla, plus Paul, Sally, Percy and Bucky take the long side by the window. The other side boasts Jenny and Ryan, Marie and John, Eliza and Michael, and Cynthia right by Thomas.
Plating up is done with minimal conversation other than hey, pass me that—can I get—do you want—where’s the—did you get enough—
Paul takes the slices of turkey he’s offered. Sally takes half of that. Percy refuses it outright, and Bucky politely follows suit. Beneath the lacy table cloth, Percy squeezes his knee with a small grin.
The turkey is fucking ass, by the way. Bucky can tell the instant it hits everyone—pinched faces and sharp swallows immediately followed by a large sip of wine. Paul had never touched his in the first place. Smart man.
Once dinner commences, it’s probably one of the best things Bucky’s ever gotten to witness.
At first, they started off slow.
“I just don’t see the fuss,” Michael says. “Secure the damn border. I mean, really, not our people, not our problem!
“Uh oh!” Paul says, spearing a green bean. “I think that one was an inside thought!”
“Excuse me?” Michael demands.
Paul takes a noisy sip from his wine glass.
“It’s just a shame!” Marie complains. “Mackayleigh is clearly the best dancer! They’re shoving her aside in the name of fairness— well, guess what? Life isn’t fair!” She huffs.
Sally nods. “I’m sorry everyone is being nice to the other middle schoolers.” She says sympathetically. And, a thing about Sally Jackson—she’s such a kind woman that she can say things that you don’t even realize are mocking until five minutes after.
After listening to Ryan give his entire four-minute monalouge on his stance on female healthcare, Percy propped his chin into his palm. “What gave you the confidence to say that out loud?” He asked, completely genuine.
Nina catches on after that and takes it up a notch.
“When are you having kids? Time is ticking, you know.” Eliza asks her sister-in-law.
“Yeah, I decided to get a hysterectomy.” Nina lies through her teeth. “Got it done last year.”
“But…what about your future children?” Jenny asks, aghast.
Nina, currently pregnant, shrugs. “Don’t need ‘em.”
Their entire side of the table ramps up after that. They just start lying their asses off.
Percy takes a sip of water. “Oh, well, my cousin came over and played makeup with Estelle—he’s a drag queen, so he’s super talented with it—”
Through a mouthful of potatoes, “So, like, I was on my sixth gender-reassignment surgery—”
“What gender are you actually?” Eliza asks weakly. Ignoring her horrific wording, Bucky hums. “You know, I’m actually not sure.”
At some point, Percy just takes the massive plate of rolls and swaps it out for his own plate.
Some of it’s technically true, even.
“So, my autistic nonbinary employee took time off to visit her wife’s family in Colombia, and—yeah, they’re childfree, they both work, one’s a lawyer and the other a doctor—so my other employee—yeah, the genderfluid Thai immigrant—”
“Oh, well, there was this guy, total neonazi, so I just started swinging—”
“So, he’s a billionaire, and he hates it, and he keeps trying to instigate socialist revolutions in the local political offices, but—”
“Well, yeah, I speak Russian. Fluently, yeah, I learned in Russia. I lived there. For how long? Hm…sometimes it feels like as long as I can remember. I work in the American government, now, so—why are you screaming—so I work directly with the head of the branch, and—”
Percy starts dipping the rolls directly in both the cranberry sauce and the gravy, making an odd sludge of cross-contamination in both dishes.
Then they circle back around to lying.
“Oh, yeah, we only hire queer people. Diversity quotas, y’know? If you’re not gay, we’re not allowed to interview you.” Nobody has even noticed the rolls are all but gone amidst the chaos.
“Well, I only let Estelle and Lucas read books with main characters of color. That’s how Percy grew up, and he’s doing wonderful!” Sally tells Ryan.
Paul sticks his fork straight into the thin slice of turkey on his plate, flicking the handle. It stays perfectly upright. “Since I married Sally, I barely even speak English anymore, honestly.”
“Yeah, I mean, of course I was sucking dick when I was in the army. What else would I have been doing?” Bucky says to John without blinking.
Eventually, the other side of the table starts trying to divert the conversation away from them. Layla, who’s been watching the whole thing with an unashamed humor, drags her finger through the dredges of her gravy. She’d slipped out at some point, and when she returned, she stank of weed again. Nobody noticed, save for him and Percy, who rolled his eyes behind his sunglasses. Her return drew the attention of her mother.
“When are you going to get a man in your life?” Jenny loudly asks her daughter, a pointed look on her face as half the table quiets down to listen.
Layla looks slowly at her father, open disdain creeping onto her face, then back to her mother. “When are you?”
Jenny throws her fork down onto her plate, shooting upwards. “Layla Marie!” She reprimands shrilly. “How dare you speak to your father like that?”
Bucky gives the girl a subtle thumbs up across the table—and by that, he means he just does it, because literally everyone else is staring at Jenny and Layla, who lazily looks up at her mother. “Meh, meh, meh.” She mocks.
Her mother turns a brilliant fucsia color. “Layla!” She shrieks.
Layla now opens and closes her hand in the motion of a mouth. “Layyyluhhh,” She mocks again.
Across the table, Nina starts laughing. Marie turns on her, incensed. “We do not encourage this behavior!”
Nina rolls her eyes, red painted lips curling upwards. “We also don’t learn to use Snapchat solely to message fourteen-year-olds, but, hey, you were still the one trying to get Patrick invited again.”
Marie slams her hands on the table. “The only reason he isn’t here is because that fucking psycho—” She flings a hand out towards Percy, who’s got half a roll stuffed into his cheek. “Attacked him!”
Bucky leans back in his chair. “I saw the video, it was hot.” He says shamelessly. “We fucked for, like, an hour, after. In a public park.”
John shrieks. Michael looks disgusted. “You’re both fucking perverts!”
Bucky grins.
“That’s it!” Cynthia screams. “This disgusting talk will not be allowed in my house!”
“Andrew was literally talking about Hitler for twenty minutes.” Layla scoffs, rolling her eyes. “That’s allowed, though?”
“He likes history!” Jenny defends.
“He started a petition to remove AP African American Studies from our school district.” She deadpans.
Paul leans back in his chair far enough to toss a giant chunk of turkey into the fireplace. It catches immediately—food should not be that flammable, Bucky thinks to himself—and fills the room with the smell of char. Paul tosses back the remainder of his wine. “For the Gods.” He deadpans.
Cynthia starts wailing.
Sally wordlessly passes Percy the stuffing dish as he tosses the last roll over the table to Layla, who somehow manages to catch it in her mouth. “I miff Patwik,” Percy swallows. “He was entertaining.”
“You stay away from my father!” Marie screams. “You dirty fucking—” Ooh, that’s…that’s not a good word. Wow. Holy shit. Absolutely not. It’s Bucky’s turn to slam his hands on the table and stand up. “You speak to him like that again and I’ll break your fucking jaw.”
John shoots up next. “Do not speak to my wife like that!” He roars. Bucky, who’s hands are rated E for Everyone, narrows his eyes and him. “Or what?”
John launches himself over the table towards Bucky, managing to grab a fistful of his jacket and sending them both crashing backwards. Eliza screams and Michael lurches towards them, intent on pulling them apart, Bucky laughing all the while.
Sally dabs at her mouth with an embroidered napkin. She folds it, places it over her plate, and stands, pushing her chair in behind her. Sally rounds the table to stand behind Marie, tapping her lightly on the shoulder. Marie whips around to look at her, and Sally smiles. “Cuidado com a língua, cabra,” Up until then, nobody’s noticed the bowl of mashed potatoes Sally’s holding until she turns it and dumps it over Marie’s head. She starts screaming again as Sally places the dish down and calmly returns to her seat. Paul high-fives her as she does.
“What the fuck?” Michael demands. “Holy shit, Paul, control your wife!”
Even in the back of the room, Bucky and John pause, just as Bucky’s got the man lifted by the shirt collar. Paul stares at his brother for a long moment. “Michael,” He says slowly. “Look at me.”
Michael scoffs but does so, his arms crossed as he watches Eliza hesitantly attempt to wipe mashed potatoes off of Marie’s face. Paul walks up to his elder brother and executes a perfect right-hook right across his face. Michael staggers back and hits the wall, blood already welling up from his lip. “Fuck you!” He yells. He lurches forward to Paul, but Nina sticks her foot out, tripping him, and he hits the ground.
Percy laughs so hard stuffing comes out of his nose. Marie throws a fork at Sally, but misses terribly, John is in an armlock by Bucky and is getting salad pelted at him by Layla, Michael’s on his back dramatically yelling, and Eliza tries to enter the fray, only for Nina to get in her face and tell her that her pathetic husband is fine, which prompts Eliza to grab her by the hair, which then results in Nina biting the woman. Ryan enters at that point, to separate the two, but Gabriel meets him halfway with a sharp never lay your hands on my wife!
Jenny starts screaming about calling the police, only to be unable to find her phone. Layla, who stole it and tosses it into the mulled wine pitcher five minutes ago, starts loudly telling her mother about the tattoo she’d gotten last Spring break.
Thomas and Cynthia sit, stunned, the longest. It’s them, Percy, and Grandma Lillian, who’s staring somewhere over the rest of them at the window.
Thomas stares at his step-grandson, who has scooted his chair back so he could rest his dirty converse on the white tablecloth, the now almost-empty stuffing dish balanced on his knees. “Is that blood on your shoes?” He asks numbly.
Percy shrugs. “How would I know?”
Cynthia bursts into noisy sobs. “Paul never should have married that woman,” She manages to make woman sound like a dirty word. “He’s ruined this family, Thomas! Ruined it!” She laments as approximately five different fistfights continue around the dining room.
Thomas is still staring at Percy. “We opened our home to you,” He says, shaking his head. “We accepted you, even though—”
“Even though… what?” Percy interrupts. “Even though my mother didn’t go to some fancy university? Even though she raised me in Hell’s Kitchen? Even though I already existed before she met Paul?” He wipes a stray crumb from the corner of his mouth. “Let me tell you what, Thomas—we didn’t need you to accept us, which, for the record, you absolutely didn’t. Paul’s one of the few good things to come out of this shitstain of a family, and now he has me, and my mother, and Estelle and Lucas, and the rest of my crazy fucking family.”
Gabriel dumps a pitcher of water over Ryan, and Nina starts performing some honest-to-God WWE moves on Eliza. Layla is still screaming at her mother—she seems to have really needed this, quite frankly.
“You’re filth.” Cynthia sobs, hatred burning in her eyes. “Absolute filth.”
Percy licks the gravy off his thumb. “Yep,” He agrees. “Pretty much. And you know what? After all this, while you’re picking up shattered china, cleaning potatoes out of your custom wool carpet, and boxing up the leftovers of your nasty fucking turkey, you’re gonna realize that you, by contrast, are so damn clean that you’ve cleaned out half your family. Shit, two outta four of your kids hate you, your brother’s a fucking pedo, your granddaughter is high off her ass because it’s the only way she can stand to sit at a table with you all, and her brother’s a fourteen-year-old neonazi.” Percy snatches a bottle off the table—non-alcoholic fizzing cider, because Jenny’s pretended to give up drinking on her family YouTube blog—and takes a sip. “Paul's done a good job—a damn good one. He’s a good man, Thomas, and it’s so horrifically sad that you’re so far up your ass that you don’t even see the family he’s made for himself.” He waves a hand behind him. “Paul has found people he’s willing to start a fistfight at Thanksgiving dinner for. That’s how much he cares about us.” Percy says. “And look at you, still sitting your ass down at the head of an empty table.”
Percy tips his head back and takes another swig. He uses the back of his sleeve to wipe his mouth, then puts the empty bottle down on the table with a resolute thunk. “And, for the record, my mother is the best thing to ever happen to this shit-talking, boot-licking, ignorant-ass cumstain of a family that only falls back on a religion they don’t even really follow purely to be xenophobic dumbasses. Newsflash, dickheads, my mother was born, like, fourty-five minutes from here.”
And then, because he’s an asshole, Percy reaches over, plucks the discarded turkey leg bone from a platter, cracks it in half with his teeth, and noisily slurps the marrow from it. Cynthia actually gasps.
Behind him, John finally seems to have given up on trying to attack Bucky, who, up until now, has been, quite frankly, playing with his food. Eliza scrambles away from Nina, who yells at her retreating back, “I haven’t liked you since the day my brother brought you home!”
Well…in for a penny, in for a pound, Percy supposes. He tosses the bone into the fire and, in perfect Latin, says, “Hoc te tam malum terrent. Aliquid, aliquid, daemonia, satana.”
Cynthia starts screaming. “Satana? Did you just say Satan! Thomas, he’s a fucking heathen!” She scrambles up, still shrieking. “Heathen!” Then—holy shit, she says something about the the mark of Cain and flees the dining room. Probably to call the police, or something.
Percy stands up and monetarily lowers his sunglasses so Thomas can see him wink. Percy turns to the riot happening in the rest of the dining room. “Hey, you guys ready to go?”
Bucky gives John one last wet willy before standing, brushing off his slacks. “Sure.”
Paul lets go of his older brother’s beard. “Yep.”
Sally slips the shoe she’d been about to toss at Marie back onto her foot. “Of course. I’ll get the kids.” She’s still smiling. Gods, Bucky is obsessed with Sally Jackson.
Nina and Gabriel, too, stop and look over at them. “Well, if the cool people are leaving, I’m out,” Nina announces. “Gabriel?” He loops her arms through his.
“Can I come, Aunt Nina?” Layla asks suddenly.
Nina holds out a hand. “Of course, darling.” She says kindly. “Shall we?” Layla laughs and runs to take her hand, sounding like a kid for the first time that day.
Mussed hair, wrinkles collars, and missing a shoe, the group rights themselves and stands together. “Later, dad!” Paul calls behind his shoulder. Nina, on the other hand, opts for a “Smell ya later, fuckers!”
The two Blofis children lead their families out into the hallway, only to be halted by a quiet, “Nina, darling? Paul?”
They turn around. Grandma Lillian squints up at them. “Are you leaving?” Her voice is croaky and wobbly.
Nina nods. “Yes, Grandma.”
The woman reaches for her walker. “This turkey smells like shit. I want Taco Bell.”
Nina’s jaw practically hits the floor, but she moves forward nonetheless to help the woman up. Paul starts laughing, a rough bark that turns into full-on belly laughter. He wipes at his eyes, an arm around Sally’s shoulder, Lucas clinging to his leg while Estelle sits comfortably on one of Bucky’s strong shoulders. With the addition of one, still laughing, they head back through the hallways, living room, and entryway, towards the front door.
“Oh, by the way,” Percy calls out into the house, pausing in the doorway. “Lucas is mine. James knocked me up when we were teenagers.” He shuts the door behind him quickly just as the yelling starts.
The dishevelled group stands in a loose circle in the driveway. “Holy shit,” Gabriel whispers. “Oh, my God.”
Nina blinks. “We’re totally getting the cops called on us, aren’t we.” It’s not a question.
Percy shrugs. “I definitely heard Cynthia going for the phone.”
Paul scrubs a hand down his face. “Shit, yeah, I don’t think there’s going back from this.”
Layla shrugs. “I’m eighteen in a week. I had a place to crash lined up, anyway.” It’s silent for a long moment, before she tacks on, “I’m gay, by the way.”
Nina ducks down and presses a kiss to her forehead, leaving a bright red lipstick mark. “I support you as long as your girlfriend isn’t a loser.” Layla snorts.
Bucky wordlessly pats her on the shoulder. “Cool. Stop smoking weed, though. You’re young enough that it’ll fuck you up good.” She rolls her eyes.
Behind his back, Bucky passes Percy the small baggie he’d just stolen from her coat pocket. Percy, barely keeping a straight face, puts it into his.
Paul glances back towards the house. “Shit,” He says again.
It’s Sally who covers her mouth first, a giggle escaping her. Then it’s Paul, who smiles anytime he hears that sound, which quickly turns into a short chuckle as he shakes his head. Nina elbows her brother lightly, a wide-toothed grin growing on her face. Percy has so such reservations, tossing his head back, laughing in that way that makes him snort a little. Hanging off him, Bucky smiles, huffing. The slight movement jostles Estelle, who’s little giggle sound almost exactly like her mothers, which sets off Lucas, too. Gabriel grins, and Grandma Lillian’s laugh sounds like the rumble of heavy clouds while Layla’s is breathy and short.
They end up standing in that driveway laughing until their ribs hurt.
“I told Jenny I got a hysterectomy,” Nina wheezes.
“Michael and Cynthia think I’m a Russian spy,” Bucky whispers, shoulders shaking.
Percy buries his face in Bucky’s shoulder. “Cynthia thinks I’m the host of Satan,”
“I threw a roll at Hunter!” Estelle chirps.
Paul is practically crying. “I bit my brother and watched my sister use Arn Anderson’s Spinebuster on our sister in law,”
“Jesus fucking Christ,” Gabriel’s clutching his stomach. “Fuck, now I want Taco Bell, too.”
Grandma Lillian nods. “Yes! I want a Chalupa. Nina, dear, Paul, love, drive me to get a Chalupa.”
“Yes, grandmother,” They chorus.
At this point, they decide fuck it, and all want Taco Bell. Nina drives Gabriel and Grandma Lillian, Paul drives Sally, Lucas, and Estelle, and Layla hops in the back of the SUV Bucky…acquired. It was from Tony, so it was probably legal. Probably.
On the way, Percy puts his feet up on the dash. Bucky smacks him on the knee. “Heathen.”
For some reason, that sets Percy off laughing again. Bucky rolls his eyes but leaves his hand on his boyfriends knee, giving him a gentle squeeze.
Through the rear-view mirror, Bucky can see how Layla’s face softens as she watches them, and vows to buy her a Baja Blast.
The Taco Bell, surprise, is near-empty. The sole employee lets them push a few tables together, and after they rattle off their orders, they tell her to take her time—they’re in no hurry at all.
Paul leans his head back against the booth. Sally leans against his shoulder, smiling at him. They’ve got a cup full of ice and are passing it around, taking turns icing knuckles and, in Nina’s case, elbows.
“So…” Paul drags out. “Our place next year?”
Notes:
a few serious notes:
1- this chapter is a dig at a lot of things, but christianity as a concept isn't one of them. christianity as a religion can be kind and wonderful, but in practice, far too many people use it to justify countless forms of hatred and prejudice. THATS what this is making fun of. shit like the justification of racism through stuff like the mark of cain (seriously, google some of this shit if you've never heard of it). to any christian readers, know that this wasn't intended as an insult to you, but towards hypocrites that use religious texts as weapons.
1.1- clarification: the mark of cain is specifically used as a prejudice tool against Black people. though percy is not Black, cynthia is racist and stupid.
2- remember the true story of the origin of thanksgiving and the real role Native Americans played. the europeans were colonizers, not their best friends who they had lovely dinners with. if you live on native land, try to find out what tribe and do what you can to be an ally and respect them and their land.
heres a link on being an Indigenous ally: https://urbannativecollective.org/indigenous-ally-toolkit
and one on Native perspectives of thanksgiving: https://americanindian.si.edu/nk360/informational/rethinking-thanksgiving
(also, i am not Native myself! if any of you are, and have any better information you'd like me to provide, i'd be happy to)
yeah, i dont even know if i spelled Makeyleigh in the same way more than once.
paul's learning portuguese, and is planning on hawaiian next, btw. bucky's learning as well :)
solo poly Black Hijabi amputee...autistic nonbinary person in a gay marriage to a colombian immigrant...
properly translating latin is...rough, guys. percy's latin is supposed to say 'this is gonna scare you so bad. something, something, demons, satan.'
can't believe it took me three and a half years to make an mpreg mention
btw layla WILL go and live with nina and gabriel AND get a girlfriend whos not a loser
happy thanksgiving to all those who celebrate!
plumbing baby. goodbye
Chapter 49: christmas 4: die really hard guys
Notes:
i really hope you guys are familiar with the plot of die hard
(See the end of the chapter for more notes.)
Chapter Text
Bucky couldn’t take it anymore.
From his spot in the kitchen, leaning against the counter, he stared over the island to the living room.
Tony was sitting on the edge of the couch, tablet in hand, leaning practically against Stephen, showing him some…something. Bucky wasn’t entirely sure, to be honest. Lots of big words were used. Something sort of kinda related to BARF? Hence the neurosurgeon consultation.
(At least, that was Tony’s excuse. But Bucky saw right through him—SI literally had an entire team of doctors of all sorts, including neuroscientists and surgeons.)
Bucky took a long sip from his mug as Stephen said something that made Tony toss his head back in laughter. Stephen was staring. God, the yearning. Him and Percy weren’t nearly this bad.
(Okay, he and Percy had definitely had shit like that. But they’d been fairly efficient about it—the benefit of both being quite blunt and upfront. They met, they got to know each other, Bucky got over the fact Percy was technically supposed to kill him, Percy got over the fact Bucky was a hundred-year-old Russian assassin. Bucky went missing, Percy lost his shit and went on a rampage to find him. Percy got hurt, Bucky lost his shit and went on a rampage to save him. Blah, blah, blah, they kiss. Easy!)
Speaking of—the elevator doors slide open and Percy, rubbing at his eyes, stumbles out and into the kitchen. Tony doesn’t even notice, because now, he’s staring at Stephen. Percy makes a beeline for Bucky, tripping over one of his own fuzzy socks on the way. Bucky catches him with one arm, the other raised high, holding his mug.
“The fearsome demigod himself,” Bucky quietly teases.
Percy grumbles something, shuffling closer to stand in Bucky’s space, his face pressed into his shoulder, right above the prosthetic joint. It can’t have been very comfortable, but Percy seemed content. Truthfully, Bucky was still getting used to his boyfriend's almost complete apathy about Bucky’s left arm.
Well—apathy wasn’t the right word. Percy cared, obviously, he cared so much it hurt. Whenever he had an appointment to check over or fix the prosthetic, Percy would sit on his right, holding his other hand and would just…talk. It didn’t seem like it on first impressions (or second, third, fourth…) but Percy had an insane talent for just yammering on and on. A byproduct of his ADHD—if you got him started on something he was interested in, Gods help you, because he would only stop when he was well and ready to. He didn’t talk linearly, either—he’d jump around to different topics, going off on side tangents that turned into their own info-dumps, only to circle back around to the main point, like, fifteen minutes later. It should have been annoying—honestly, sometimes it was, when Bucky was trying to keep track of everything, but even then, he could never find it himself to be actually upset— but during his appointments, listening to his boyfriend, watching him talk so expressively with his hands and face…the appointments were a little less awful.
So, yeah, Percy cared about his arm, but it didn’t…well, it didn’t bother him. He was just as likely to take Bucky’s hand, to sleepily demand Bucky hold him, or to have him carry things for him, with his left as he was his right.
He’d asked, once, late one night, after Percy had burrowed into his left side under the covers, Bucky’s arm around him. “I’ve hurt a lot of people with this. Does that bother you?”
“No. ‘m in love with you. Don’ care.” Percy sleepily flung an arm onto the metal of his bicep. “‘Sides, differ’nt prosthetic, anyway, dumbass,” He grumbled. “What’s there to be scared of, the concept ‘f your left side?” Gods, even half-asleep, Percy was such a bitch.
Bucky needed him so bad it was insane.
He pulled his boyfriend in closer. Bucky pressed his nose into the mess of Percy’s hair, inhaling lavender and the ocean breeze, overlaid by the faint scent of Bucky’s own aftershave. They stand like that, both trying to block out to the faint sounds of Tony and Stephen flirting, until Bucky’s coffee goes lukewarm.
Decorating the Tower is a massive undertaking. The public areas and outside are done by a company Tony hires, but the top few floors, the residential, have too high clearance for anybody but the residents to do it. Peter takes great joy in climbing around to hang garlands and lights, and Tony has the worst ten seconds of his life when he hears Bucky give the kid a nail gun.
FRIDAY is playing soft, instrumental holiday music as a backdrop to overlay the process. Mrs. O’Leary dragged the tree from the elevator into the living room. Somehow, not a single stray pine needle is found to be cleaned up.
She’s a miraculous creature.
…Whatever she is.
Of all her missions, this may be the most critical, yet. Natasha stares down at the mess in her hands, hair pulled back in a braid to keep it from obstructing her vision. If she fucks this up, it’s over. The whole thing. There’ll be no coming back from this.
Complete the mission, a voice in the back of her head whispers.
Like all tasks, Natasha leaps into it with grace.
She will not fail.
She cannot.
“Hey, Nat, how’s it going?” Tony asks, poking his head through the doorway.
Natasha doesn’t look up from the Christmas lights she’s untangling. “Fine.” She says robotically.
He’s silent for a moment as he watches her. Her fingers itch for the dagger sheathed beneath the bulk of her sweater. You can’t cut the lights, Natalia, she tells herself. The package must remain intact.
“...You sure you don’t want help?” Tony checks.
“No.” Natasha says shortly. “I will succeed.”
“Right,” Tony agrees. He doesn’t leave.
“Why don’t you go flirt with Stephen, or something,” Natasha snaps, threading the string through a particularly complicated knot. “Leave me be.”
Tony’s spluttering of denials is almost as infuriating as the target in front of her.
She will not use her knife. She won’t.
Bucky’s laying face-down on the bed, arms splayed out and face buried into the pillow. Their bedroom is warmer than the rest of the tower, but gooseflesh still prickles his arms under his sleeves. A part of him wants to move under the covers, but the rest of him simply can’t find the will.
The front door opens, and the familiar sounds of Percy kicking off his shoes echo from the entryway. Footsteps, then a small bang and a muffled curse.
Bucky tilts his head to the side so he’s audible. “I keep offering to move that table,” He reminds.
Percy huffs as he enters the room, tossing his coat over the back of the desk chair. Bucky’s totally going to pick that up and hang it in the closet later, and they both know it. “I’ll just walk into something else,” He grumbles. It’s an ADHD thing, according to Percy, rather than a blindness thing—he can sense the table perfectly well, but that doesn’t do him much good with a lack of object permanence—his words, not Bucky’s.
His boyfriend climbs up on the bed and flops down atop Bucky, draping himself over his back. Bucky lets out a small oof, just to be dramatic. Percy weighs practically nothing to him, and they both know it. With his nose buried in the nape of Bucky’s neck, and his chest pressed against his back, they occupy almost the exact same space in the bed, Percy’s unnaturally high body heat seeping down into Bucky.
“Tony’s pissing me off,” Bucky grumbles into the pillow.
“If you say him and Stephen,” Percy’s lips ghost across his collar as he speaks. “I am going to scream.”
Bucky’s frustration takes a momentary step aside for amusement. “Would certainly be the most effortless way I’ve made you scream in bed.”
Percy bites him.
Bucky reaches blindly back to smack him. “Yeah, biting is usually involved, too.”
“I will explode you with my mind.”
Bucky huffs a small laugh that Percy feels through his ribs, then sobers. “Seriously, though, I need you to start hiding my guns. I fear the anger that is coursing through my body with an exponentially increasing frequency will completely override BARF and all my therapy, and I will simply snap and kill Tony. Or Stephen. Or both of them, together. Maybe arrange their corpses in something artful.”
Percy groans and rolls off of Bucky, splaying on his back next to him. “A bold assumption I’m not tempted to let you kill them.”
Bucky sighs heavily. “They’re so oblivious.”
“We weren’t that bad.” Percy laments.
“Not at all!” Bucky agrees vehemently. “We were much more direct.”
“And quicker! It’s been, like, two years, at least, of just pining!”
“Yeah! That…has it really been that long?”
“I mean, I think.”
Bucky turned his head to face him, cheek squished against the pillow. “You came to the tower, what, like…”
“Summer of 2016.”
“And it’s now…”
“...Spring of 2018?”
“But we’ve spent…three Christmases together?”
“...and I spent another at the Tower before you got here.”
“...”
“...”
“I—”
“Well—”
Bucky frowned. “Does last Christmas count?”
“It…yeah? I mean…”
“It was in Westblooms, though.”
“I thought we agreed not to talk about that—wait. Jamie, baby, do you—do you think that things in Vermont just don’t count? That—that still happened. It was just in Vermont.”
Bucky squinted.
Percy looked increasingly stressed with every moment of silence.
Bucky squinted more.
“Babe…”
Suddenly, Bucky gasped and scrambled up. “Oh, my Gods!”
Percy jolted, bracing himself upright on his elbows. “What? What?” He shrieked.
Bucky grabbed him by the shoulders. “Fucking Tinsel!” He yelled, shaking his boyfriend. Percy, flopping in Bucky’s hold, looked incredibly confused. “What the fuck?”
“Tinsel!” Bucky practically yelled in his face. “The fucking elf that Vermont-ed us!”
The realization dawns on Percy’s face. “Right! After Westblooms they magicked me into the living room!” His eyes narrow at Bucky. “I barely met them last year because—”
“Yeah, yeah, I grabbed you and took you upstairs to fu—”
“Okay!” Percy says loudly. “I think we all remember that!”
Bucky, grin rakish, dips down and pressed a kiss to Percy’s lips. “Damn right you do.” He said against him. He pulled back, taking in the rosy flush to Percy’s cheeks as he got back on track. “Hear me out,” Bucky said to his boyfriend, who was already raising a skeptical brow. “We find Tinsel and get them to do whatever they did to me to Tony.”
Percy opened his mouth then closed it. He tipped his head to the side in the way he did when he was thinking, a small furrow in his brow. “We…we solved our problems and escaped through murder. I don’t think they’ll do that.”
“They might,” Bucky defended.
“Jamie, we jumped to murder, like, incredibly fast.” Percy winced. “I think it was almost immediately after Tony called us and told us Hammer had bought the preserve, we decided to kill him.” A beat. “Well, a few hours after—”
“Because we got freaky in front of the fireplace.” Bucky nodded along.
Percy sighed. “Yeah, because we got freaky in front of the fireplace.”
“Jorked it.” A beat. “Ross taught me that.”
“James Buchanan Barnes, if you ever refer to our sex life as jorking it , it’ll die out faster than Justin Hammer.”
“Noted.” Bucky leaned in a little. “So…Tinsel?”
“I just think—” Percy broke off, his entire face contorting. His eyes went distant in the way they did when he was paying attention to something far away. “Fuck it. Tinsel.”
Bucky raised a brow.
“Tony just tripped, Stephen caught him, and now they’re both having breakdowns in different rooms. Tinsel.”
Bucky cheered. “Tinsel!”
Their second problem: they had no idea how to contact Tinsel.
Bucky, Percy, plus Nat and Peter, who had overheard and immediately decided to get involved, stood in a loose circle in Percy’s apartment in Hell’s Kitchen. Peter was only half-paying attention, craning his neck to look around the building.
“Is this, like, a super-secret safe house? Do you keep bodies here?” Peter asks, squinting at a photo frame. “Is this you?”
Percy gave him a deadpan look. “No, maybe, and how would I know? It’s my childhood apartment, from before my mom and I moved next to you guys.”
Bucky takes a quick peek at what Peter’s looking at—it is, indeed, Percy, standing with Blackjack and Mrs. O'Leary—then goes straight for his favorite armchair. The murder armchair. He likes to lean back and imagine he can hear Gabe Ugliano screaming. Percy takes a seat on the arm, his legs across Bucky’s lap. He’s probably imagining the same thing. It’s beautiful, the things that couples bond over.
“So,” Natasha says, looking at the giant fern. “How do we go about this? Magic of some sort?”
“I could try getting Hazel and some of my other family to look into it,” Percy offers. “But whatever the fuck Tinsel was up to had nothing to do with Greek magic, as far as I could tell.”
Bucky leans back. “What if I stand around and look super lonely again?”
Natasha nods along. “Or, I could spend the next three weeks manipulating and gaslighting Strange until he does all the legwork for us.” She looks away from the fern for a second. “He wouldn’t realize until it was too late, of course.”
Percy hums. “We’ll keep that as Plan B.”
Peter, meanwhile, is half out of the window, his hands bracing himself on the sil. “Hey, look!” He chirps. “It’s snowing!”
Bucky reaches out and tugs Peter back into the building with one hand. “And you can’t thermoregulate.” He reminds. Peter, pouting slightly, keeps one fingertip stuck to the windowsill. “It’s the first snow of the year!” He defends. “We should go out and make snowmen!”
“Tinsel first, snowmen second.” Bucky says firmly.
Peter deflates.
“So…Strange, Percy’s cousins, and Bucky being pathetic.” Natasha recaps. “Those are our options.”
“That seems like a lot of work,” Peter inches back out the window, sticking his tongue out to catch snowflakes. “Wha’ if we jus’ ask nishely?” He asks, garbled. “Mx. Tinsel! Can ‘ou come do Chrissmas mayic again?”
Natasha puts her head in her hands. “Peter—”
A sudden chill swept through the room, but it originated from seemingly the middle of the living room, not the open window. There was a loud crack, a flurry of snow and…glitter? For the second time in Bucky’s life, a person appeared onto the coffee table.
“Well, at least you’re not holding a knife, this time. Love softens you like that, I guess!” Tinsel enthused in all their holiday glory.
Bucky didn’t have the heart or the patience to explain that he actually did have a weapon on him.
It was Percy.
His boyfriend could do this cool thing called ‘dehydrate you with his mind until you die’. It was very effective.
Also, all Bucky’s knives were under the custody of Mrs. O’Leary, to keep him from killing Tony and/or Stephen.
“Hi, Tinsel,” Bucky sighed. Lord, he forgot how fucking bright they were, from the cherry-red outfit to the blinding white hair. Their hair was in twin braids, as opposed to the sole one last year, but still done up with the same scarlet ribbon.
Tinsel bounced on their toes, skipping forward to stand directly in front of Percy. They leaned in, faces a few inches apart, and reached up to lightly poke at his cheek. (Bucky knew Percy. That subtle twitch of his lips was him pushing down the automatic instinct to bite Tinsel.) “He’s so cute! Oh, you guys are adorable!” They chirped. “Hi! I’m Tinsel!”
Percy waved politely.
Natasha and Peter exchanged looks, shrugged, then chorused, “Hi, Tinsel.”
Tinsel spun a little, the sound of jingle bells emanating from them. “Hello! Hi! How are we feeling this Christmas?”
“Merry and joyous!” Peter all but screamed, pumping a fist in the air.
Tinsel spun towards him, pointing at him with both fingers. “I like you!”
“I am very whimsical!” Peter yelled again.
“Listen,” Bucky said, steering the conversation back on track. “We need a favor.”
Eyes draped by white lashes fixed on him. “I’m listening,”
Stephen Strange leaned his head back into the airplane seat, eyes shut as another little drop of the plane made his stomach lurch.
A voice came from the seat next to him. “You don’t like flying, do you?”
He looked over to see a woman, elegant braids piled into a bun atop her head, glasses hung on the collar of her shirt, raising a dark brown at him.
Stephen exhales slightly, casting a glance to the window to her left as his grip on the armrests tightens, watching the airport grow closer as they descend. “No, no,” He says. “Where’d you get that idea?”
The woman smiles a little. “Well,” She says, a soft accent curling around her words. “Do you want to know the secret of successful air travel?” She leans in a little, conspiratory. “After you get where you’re going, you take off your shoes and socks. Then, you walk around on the rug barefoot, and make fists with your toes.” She whispers.
Stephen blinks. “Fists with your toes.” He repeats.
She laughs a little, a warm, rich sound. “I know, I know. It sounds crazy. Trust me, I’ve been doing it for nine years. Works better than a shower and a hot cup of coffee.”
They touch down on the tarmac with a lurch that makes his stomach jump into his throat. The woman, too, jolts a little, but is far less affected than him. “Rough landing. Think they’ll need to check if a doctor’s on board?” She jokes.
Stephen rubs a hand over his face, other hand still on the armrest. “I sure hope not,” He says. “Because then I’ll have to do my job.”
She looks at him, surprised. “You’re a doctor?”
He nods. “Neurosurgeon.”
She whistles lowly.
“You?”
“I work for the U.N.” She holds out a hand. “Willa Hanover.”
He shakes it. Her grip is firm, her hands strong. “Stephen Strange.”
Across the city, the cork of a bottle explodes across a large office, its trajectory halted by a Christmas tree standing proud in the center of the office. The cork hits a branch, then rolls harmlessly across the carpeted floor.
Standing on the desk, Nick Fury holds up the bottle triumphantly. Around him, a crown of business casual cheers.
“Ladies and Gentlemen,” Fury says. “I congratulate each and every one of you for making this one of the greatest days in the history of the SHIELD corporation.”
Behind him, Tony Stark-Strange flicks through a stack of fresh prints, still warm to the touch. Eyes glued downwards as he reads, he walks down the hallway. A pair of dress shoes fall into step with him as he makes his way to his office.
“What about dinner?” The man asks, leaning in to get a better look at Tony’s face.
Tony doesn’t do him the service of meeting his eyes, flipping over a paper to scan the back. “Hammer, it’s Christmas Eve. Families…stockings…chestnuts…Rudolph and Frosty…those things ring a bell?” He turns into his office, past the nameplate T. Stark, PhD dropping the pages on his secretary’s desk. Without looking at his coworker, he strides further in, opening the door nestled a bit behind his secretary’s desk that leads to his office proper. Of course, he’s followed.
Hammer grins, leaning against Tony’s desk. “I was thinking more of roaring fireplaces…mulled wine and a nice brie…”
Tony ignores him with a subtle roll of his eyes. He turns to his secretary, who’s poked his head in. “It’s 6:40, you’re making me feel like Ebeneezer Scrooge. Go on, join the party, have some charcuterie.”
His secretary is oddly still for a moment. For a second, Tony considers kicking Hammer out, however abrupt it may be, but then the other man seems to snap out of it. “Thanks, Dr. Stark,” He says, standing and brushing off his sweater.
Hammer, still encroaching on both their space, is still grinning at Tony, all slicked back hair and starched collar. “How about tomorrow night?”
Tony just sternly points to the open door. Hammer sighs, but follows his secretary out. He rounds the office to stand behind his desk, taking a seat and dialing the phone.
“Stark-Strange residence. This is Peter speaking.”
Tony smiles, all previous traces of his hard exterior melting away. “Hey, Pete.”
“Dad!” Peter chirps. “When are you gonna be home?”
“Soon enough. You better be in bed when I get there, though. Don’t think I don’t know about your and Ned’s all-nighter.” He says.
Peter’s sigh is audible over the line. “Mean.” He complains. “Is Pops coming home with you?”
The nail of his pointer digs slightly into the meat of his thumb. “We’ll see,” He says. “Don’t blow up the house.”
“Yessir!” Peter snickers before hanging up. Tony looks down at his phone, checking to see if he’s missed any calls. Maybe there wasn’t time before the flight, he tells himself. He’s made up the spare room, just in case.
Stephen, bundled into a coat, stands in the overlarge baggage claim exit, his eyes landing on the young man standing near one of the doors. He’s in an ill-fitting suit, drumming his fingers in an odd beat on a large sign, SHIELD printed neatly on the top, Stephen Strange written boldly and a tad messily below it.
He stops in front of the young man. “I’m Stephen Strange,” He introduces.
The kid grins. “Ross. I’m your limo driver. Hey, nice bag.” He turns on his heel and starts walking out of the terminal, swinging the sign a little as he walks. Stephen starts after him, tugging his scarf on with one hand, struggling with his bag with the other.
“Ross, don’t you take this stuff?” He asks, more curious than demanding.
Ross halts and looks over at him, sheepish. “Do I? I’m sorry. You’re gonna have to help me, man. This is my first time driving a limo,” He says as he reaches over for the bag.
Stephen waves him off. “That’s okay. This is my first time riding one.”
In the limo, Ross looks over at Strange as he peels out from the wide three-lane that wraps the front terminal. “So…” He drawls. “I know where I’m taking you—duh—but where to after that? You got a hotel, or you staying with a friend?” One pierced brow waggles slightly. “Is this a special friend situation?”
Stephen rolls his eyes. “I’m married,” He says plainly.
“They live here?” Ross asks.
“For the past six months, yeah,” Stephen says.
“And you still live in Philly?”
Stephen sighs. “You’re nosey, you know that, Ross?”
His driver shrugs as he merges onto the highway. “I’m getting my psych degree. I like figuring people out. Part of the job, man.”
“You wanna be a psychiatrist?” Stephen asks.
Ross shrugs. “I’m thinkin’ ‘bout it.” He says. “Dr. Ross sounds pretty sick.” A beat. “So…you divorced, or what?”
Stephen gives up. “He got a good job offer.”
“One that meant moving here? Why didn’t you come?”
His mouth twists. “I’ve been working at the same hospital since I was an intern. I couldn’t just up and leave.”
Ross squints at him without turning. “You didn’t think this whole New York thing was gonna last?”
“I—” Stephen sighs. “No. He’s brilliant. Anything he puts his mind to will last. It was just…a difference of opinion.”
“Sounds to me like you’re both too stubborn for your own good.” Ross says lightly.
For the second time that day, Stephen leans his head back into the seat. “Probably.”
“Listen, man,” Ross says, bouncing on his toes, standing by the trunk, craning his neck up to look at the building towering over them. “So, you head up to that party; your guy sees you, you run into each other's arms, music comes up, you live happily ever after. That the goal?”
Even as he’s shaking his head, Stephen replies, “It’s corny, but I could live with it.”
“And…if it doesn’t?”
“Guess I find a hotel.”
Ross gives him a scrutinizing look, and, for the first time, Stephen really sees the sharp intelligence in his dark eyes, hidden behind heavy eyeliner and a lackadaisical attitude. “Tell you what,” Ross says. “I’ll pull into the parking garage and wait. You two make up, you give me a call and I’ll leave your bags inside at the desk. If not, I’ll get you to a hotel.”
Stephen smiles at him. “You’re alright, Ross. Thank you,”
Ross gives him a wink. “Just remember that when you sign the tip,” He jerks a thumb towards the highrise, lit by blinding spotlights. “They’re footing the bill, so don’t be afraid to be generous.”
The lobby is deserted save for a single security guard standing behind the desk. Stephen strides in, casting a quick glance around. The ceilings are high, at least thirty feet, a Christmas tree a bit over half that size centered in front of a massive fireplace with a few leather couches scattered around it.
“Hey, I’m looking for Tony Stark-Strange,”
The guard nods to a small console on the desk. “Just type it in there,”
Stephen raises a brow but does as he's told, only to for the console to emit a small beep, the words NO SUCH EMPLOYEE LISTED appeared across the screen. Stephen frowns for a second, then exhales roughly. He tries again, this time ‘Stark, Tony’ and a small model of the building appears on the screen, a room on the 30th floor highlighted.
He’s directed to the elevator and told to ‘get off where he hears all the noise’.
Stephen is greeted by the sight of a massive party in full swing. Music— Ode to Joy, it sounds like—is playing over what must be a massively expensive speaker system. It seems like every available surface is covered in some sort of tinsel or lights, twinkling and shining under the overhead lights.
He looks around, craning his neck to try and get a glimpse of Tony. Making his way through the crowd, Stephen glances at every face, flushed cheeks and wide grins, tipsy stumbling and laughing.
Abruptly, he bumps into somebody. Stephen stumbles back a little, but rights himself. “Shit,” He mutters. “Sorry,”
The man he bumped into, around his height but definitely broader, stares back. His eyes are a pale, icy blue, almost startlingly so. “It’s fine,” The man says after a beat. “Are you looking for somebody?”
Stephen adjusts the collar of his coat. “Tony Stark?”
The man nods, still a second off. He must not be holding his drink well. “Third office on the left, down the hallway back there,” The man says, pointing off to the side to a hall partially hidden by yet another Christmas tree.
“Thanks,” Stephen steps around him and makes directly for the hallway.
Though he doesn’t see it, Bucky Barnes swivels to watch him, eyes wide. “Shit,” He breathes, running a metal hand through dark brown hair. He knew Tinsel said it would feel weird—he knew firsthand it would, after Westblooms—but snapping out of the magic felt like getting a massive bucket of water poured over his head. Bucky glanced down at his watch.
He needs to find Percy.
Percy finds him, actually. His boyfriend is dressed slightly more casual than Bucky’s suit, but not by much. He’s wearing nice slacks and a button-up with a sweater overtop and a tie, glasses perched on his nose. He also looks incredibly stressed.
Bucky catches him by the arm as he rounds a corner. “Perce?” He asks, just for a second absolutely terrified that Percy hasn’t yet snapped out of it as well. To his relief, though, Percy’s hand overlaps his. “Hey,” He breathes. “Jamie, we have a problem.”
“If it’s Stephen,” Bucky says. “I saw him, like, five minutes ago.”
Percy shakes his head. “James, I think we fucked up.”
Bucky’s brows shoot up.
“We should have been more specific. Christmas movie. Should have said Hallmark movie, or something.” Percy says, chewing on the inside of his cheek.
“What?” Bucky asks, confused.
Percy tilts his head to the side a little, face distant and clouded. “Is there a company logo or anything around here?”
Confused, Bucky obliges, looking around the plaza. From the corner they’re standing in, he can see a large engraved metal sign hung over the fireplace. “Nakatomi Plaza,” He reads aloud. Bucky turns back to Percy to see his boyfriend with his face buried in his hands. “What?” He asks.
“Do you remember that movie I made you watch last Christmas Eve?” Percy asks, strangled.
Bucky pauses, thinking. “The one we didn’t finish?”
“We did finish it,” Percy corrects. “It was just…muted.”
“Right,” Bucky says. “Because you accidentally laid back on the remote when I was—”
“Yep,” Percy says. “So that was your fault.” He sobers. “James, we were watching fucking Die Hard. We’re in Die Hard.”
It takes a minute for Bucky to remember—machine gun bursts and shattered glass, C-4 and hostages. Right. Die Hard. “Why the fuck are in that one? Why not, like, Hot Frosty?”
“Do not bring up Hot Frosty to me. And, well…Tinsel chose the movie last time, right? Would Tinsel choose Die Hard?”
“I don’t think so,” Bucky said immediately. “Not their style.” He regards Percy curiously. “Were you thinking about Die Hard when they did the spell?”
A pause. Percy ducked his head a bit. His ears were red. “Maybe. Were you?”
…Bucky refused to be ashamed. He thought about the noises Percy made a lot. “Yep.”
They both stood in silence for a moment. “Shit.” They said in unison.
“So, terrorists are gonna attack the building.” Bucky said. “That happened, like, right after John McClain showed up, right?”
“Uh…like half an hour after? 45 minutes?” Percy offered. Bucky checked his watch. “Fuck. It’s been twenty.”
“We need to find Peter and Nat.” Percy said. “Tinsel said snapping them out of it should be way easier than last time.”
Bucky nodded. “I’ll find Nat, you poke around and learn what you can.”
While Bucky began to navigate the crowd in search of Natasha, Percy did what he did best—be nosy. He found Stephen almost immediately and began tailing him.
“Excuse me,” Stephen says. “I’m looking for—”
“Tony Stark?” Fury says. He holds out his hand, and Gods, is it weird to see the man acting so… normal. It’s not really Fury, just like how last year it wasn’t really Rumlow, but still. “Nick Fury. I’ve spent half my life on airplanes, I can recognize the look of somebody who just got off one.”
Stephen smiles a bit, despite himself, as Fury tells him, “I’m assuming you’ve already dropped by his office? I think he went down to one of the copier rooms. He’ll return in a moment, if you want to go back.”
Stephen nods. “Thanks, I’ll do that.” He casts an appreciative glance around. “Nice place you’ve got here.”
Fury takes a sip of his drink. “It will be if we ever get it finished. There are still several floors under construction.”
Percy slips around them and into Tony’s office, stopping to listen briefly to the person inside. He opens the door and enters just as Fury leads Stephen into the hallway, quickly sitting at his desk just as they round the corner into Tony’s office.
“Ah,” Fury says, stopping right by the door. “This is Mr. Percy Jackson, Tony’s assistant.”
Percy rises smoothly from his desk as if he’d been here the whole time, holding out a hand as a plan quickly formulates in his mind. “You must be Stephen!” He exclaims, smiling, all dimples and crinkled eyes. “I’ve heard so much about you!”
Stephen shakes his hand on autopilot, looking a bit shocked. “Have you?”
He nods. “All goods things, promise.” He says lightly. “He’ll be really happy to see you.” Percy casts a preformative glance to the other door to his right that leads into the office proper, where fucking Hammer is sitting at Tony’s desk. “Tony’ll be back in a minute, but I’m sure he won’t mind you making yourself comfortable in there.” He makes a small face. “Though it looks like someone is trying to beat you to it.”
Stephen’s eyes narrow slightly, and, internally, Percy grins.
The following conversation with Justin Hammer is awkward and awful, Fury’s obvious disapproval and Stephen’s suspiciously protective icy demeanor.
Tony enters not a few minutes later. He stops briefly in front of Percy’s desk, not yet noticing the ajar door. “I thought I told you to head on out to the party,” He says.
Percy waved him off, rolling his eyes a bit. “Party got a bit too loud,” He dismisses. “Besides,” He says, leaning in. “You have a visitor.” Tony’s heart rate jumps slightly and Percy grins wolfishly. “Hammer’s in there, too. I think your darling Stephen is about to punch him.”
The moment Percy utters the name Stephen, Tony is practically throwing the door in. He stops still in the doorway, hand falling limp to his side.
“Tony,” Stephen breathes, lips parting slightly.
“Stephen,” Tony replies softly. There’s a brief moment of hesitation, then Tony is placing the papers in his hands on a nearby table to free his hands, stepping towards Stephen and pulling him into a short embrace.
It’s impossible to miss the way Stephen practically melts into his arms.
Percy quietly raps his knuckles on the doorframe. “Mr. Fury? Someone was looking for you,” He lies. Fury, the smallest calculating smile on his face as he watches Stephen and Tony, nods and straightens. “Excuse me,” He says to the pair. Then, “Hammer,”
Hammer scampers out after him, his eyes repeatedly flicking back to Tony.
Mission accomplished. Percy softly closes the door, the barest click as to not interrupt the little moment the two are having. Time to find James.
Inside Tony’s office, in the private bathroom off to the side, Stephen leans against the counter after freshening up. Tony sits on the counter, watching him.
“You know,” Stephen says, removing his tie. “I think Hammer’s got his eye on you.”
Tony rolls his eyes. “If IQ points were TNT, Justin Hammer couldn’t blow his nose.”
Despite himself, Stephen smiles. He’d missed that snark.
“So,” Tony says. “Where are you staying? This all happened so fast I didn’t even ask you on the phone.”
“Well,” Stephen says, “My old Attending retired out here a couple years ago. She offered up her spare room.”
“Oh,” Tony says, studying the floor tiles. “Where does she live?”
“Pomona,” Stephen replies.
“Pomona? You’ll be in the car the whole time...Look, let's make this easy. I have a spare bedroom. It's not huge, but Pete would love to have you at the house.”
Stephen glances up at him. “He would?” A small smile is tugging at the corner of his mouth.
Tony fixes a surprisingly open look on him. “I would, too.” He seems to steel himself. “I’ve missed you.”
Something flashes over Stephen’s face as he turns to face Tony fully, leaning against the doorframe. “I guess you didn’t miss my last name, though. Since when did you start going by just Dr. Stark?”
A sigh escapes Tony, his shoulders dropping a bit. “Stephen—”
“We’re married, Tony, you—”
“We’re not having this conversation again, we had it last July—”
“We never finished this conversation in July.” Stephen says firmly.
“I had an opportunity, Stephen. I had to take it.”
“Yeah, right, no matter the consequences,” Stephen tacks on bitterly. “No matter what it did to our marriage.”
That all-too-familiar stubborn look graces Tony’s face. “Stephen, do you have any idea how perfect this job is for me? I’m finally doing what I’ve always wanted.”
Stephen scrubs a hand down his face. “Fuck, Tony, I know, and I’m damn proud of you. Alright? I just…I wish you’d have thought about what I wanted.”
His husband looks to the side, his jaw working. “You didn’t make it very easy.” He says flatly.
The door opens, interrupting Stephen’s response. A woman, dressed in nice slacks and a tie, stands in the doorway. She briefly eyes the two of them, blue eyes flicking back and forth between them before fixing on Tony. “Fury wants you to say something,” She says, jabbing her thumb behind her and towards the distant source of the noise. The woman looks back at Stephen, something analytical in her gaze. She doesn’t wait for a response, turning on her heel, bright red hair flicking over her shoulder as she leaves.
Tony stands, biting the inside of his cheek. “Be back in a few minutes.”
Stephen watches him leave, shutting the door behind him. He closes his eyes and lets his head hit the doorframe with a dull thunk. “Great job,” He mutters to himself. “Very mature.”
Natasha presses herself back around the corner as Tony exits the office, pausing to run a harried hand through his hair as he straightens his tie. Even in this odd parallel not-quite-real world, it’s fascinating to watch how easily he can switch demeanors, stressed and a little bit lovesick to confident and easy-going as he walks away from her down the hall.
The second he’s out of sight, Natasha checks her phone. She’d been tracked down and quickly brought back to reality only minutes ago, and had immediately set off on her mission following a text from Percy, who had been on the search for any other allies. Last time, Tinsel had brought the entire SWORD team and even some of Peter’s friends into it, though this time, maybe not having a bunch of teenagers would be for the better.
[Percy: fuck fuck fuck they’re fighting ]
[Percy: interrupt them please one of you ]
She stared at the old messages for a moment, waiting. A moment later, a soft ping and a new one.
[Bucky: nat you need to convince stephen to not take his shoes off ]
[Bucky: say literally whatever ]
Natasha squints at the screen, sighs, and walks back into Tony’s office. Stephen is still standing in the en suite, not in her line of sight. Natasha, soundless even in her heels, steps inside and quickly scans the room. She grabs the first thing she sees—a vase full of flowers, and executes a perfect three-pointer with it.
It smashes into the wall, glass shattering across the floor, and Stephen swears loudly, practically bursting out of the en suite, but she’s already gone.
[Natasha: Done. If anyone asks, a drunk couple looking for somewhere private stumbled in and knocked it over. ]
The three meet up in an empty conference room.
“We’ve got, like, ten minutes, tops.” Percy opens with. “I found Spencer and Bridgette. They’re accountants, now.”
“Gross.” Bucky says.
Percy frowns at him. “Rude.”
“Math nerd.”
Percy looks affronted.
Bucky dismissively turns to Natasha. “It’s his darkest secret. He skipped like two years of math in school. Started taking calc as an underclassmen.”
Natasha looked at Percy consideringly. Huh. You learn something new about someone every day. “Well, are we bringing them in or not?”
Bucky sighed. “I think we’re gonna have to. John McClane was a cop. Stephen is an unarmed surgeon. I don’t even think he’s a wizard this time.”
“And we don’t have time to remind him that he is,” Percy finished. “Let alone explain the plot of Die Hard, because there is no way in Hell this man has watched it.”
“Finding the SWORD members will be faster and easier,” Natasha concluded. “Tinsel put way less magic on them, this time around.”
Percy is sent to start hunting his employees down, and he does so with vicious efficiency. At one point, when he finds Mal, he just grabs her by the shoulder and very intently says “Party City.” She gasps like she’s been dramatically resuscitated on live television.
Percy, Mal, Bridgette, Spencer, and Dan return to the conference room five minutes later to see Bucky and Natasha have drawn the shades and locked the door to cover up the massive blueprint they’ve drawn onto the whiteboard at the far side of the room.
Natasha turns to briefly greet them, pauses, and looks back. “No Ross or Lee?”
“Can’t find ‘em.” Dan says.
Bucky caps his Expo marker. “Ross, I get. But Lee? She’s, like, a foot taller than everyone here. Have you tried just looking up?”
“Yes,” Mal and Dan chorus. “First thing we did.”
Natasha sighs. “Right, well, we’ll have to keep an eye out. You’re all up to speed?’
Mal nods. “Die Hard. No John McClane, just wimpy surgeon Stephen. Useless gay people.”
The redhead purses her lips slightly. “Sure,” She allows after a second. “That’s a way to put it.”
Bucky checks his watch. “First things first,” He orders. “We need to block off this floor. The party’s contained here, everywhere else should be empty. First thing the terrorists go for is the hostages—it’s up to us to stop that from happening.”
“Wait, so,” Dan interjects. “We’re just killing these guys, or…?”
“Not…immediately.” Percy says. “Once we fulfill the plot, the movie’s over. Tony and Stephen will snap out of it. If they don’t reconcile and confess their love in the movie, then all we’ve done is made it awkward for them in real life.”
“And if that happens, and, somehow, Gods forbid everything gets worse, I’m blowing up the Hub with all of us in it.” Bucky says solemnly.
Percy nods in agreement. “We need to give them time. Nice, happy, calm time together. Not hostage time.” He explains, Natasha shaking her head behind him. “No hostage time.”
“So…” Bridgette draws out. “Fulfill the plot of Die Hard in an appropriate amount of Die Hard time while simultaneously circumventing the plot of Die Hard by preventing the hostage situation that is, like, 80% of the plot of Die Hard?”
“Yeah.”
“Pretty much.”
“Sounds right.”
The SWORD members look at them in silence for a moment. “Okay.” Spencer finally says, speaking for the first time.
They split up.
Natasha pickpockets fake-Fury and spends no longer than thirty seconds getting into his phone. Then, she tracks down the Head of Security—it’s Happy, she notes with glee—and steals his keys from right under his nose. From there, she manages to engage the electronic locks on the doors to the stairwell. After that, she wanders between floors until she finds a janitor’s closet.
The out of order signs seem to just call her.
She goes around merrily slapping them on every non-elevator access door she can find, locking them as she goes.
Bucky follows her and begins crushing doorknobs and barricading doorways. Unless the terrorists want to waste their C-4, the two highly doubt they’ll be able to get through any of them.
Percy, on the other hand, heads to the lobby with Bridgette.
Down in the garage, a semi truck turns down the ramp into the parking garage beneath the plaza. It backs up to the loading dock, parking. A large group of men, standing ready, exit from the back as soon as it opens, many with duffel bags slung over their shoulders.
In the lead, in a tailored suit and double-breasted coat, Hans Gruber strides towards the service entrance of the building, his men behind him.
Elsewhere, a young man with glasses sits behind a computer, humming to himself as he works. By his hand, the security grates close over the garage entrances and the elevators lock out below the twenty-ninth floor.
On said twenty-ninth floor, a different young man with glasses frowns at his own computer. He pulls out his phone, sending a quick text.
[Dan: It’s starting. Elevators are locked out below 29, basement levels sealed off ]
Dan cracks his knuckles and gets to work.
Down in the lobby, the men flood in through the hallways leading to the sublevels. Confident, they stride into the lobby to surround the front desk, only to be greeted by the face of a young woman sitting there, smiling at them.
Hans stops cold, dark eyes fixed on her. His face takes on a calculating look as he slowly, casually, reaches into his coat pocket, fingers wrapping around a pistol.
Bridgette, beneath the desk, digs her nails into the meat of her palm. “Eddie sends his regards.” She says politely. “And his apologies that he could not make it.”
She has the pleasure of watching complete and utter confusion flit across Hans’s face. “Did he?” The man asks. Bridgette swallows dryly, but it’s not out of fear. Listen…she’s in a wonderful relationship with the love of her life, but…
“He did, Mr. Gruber.” She says, propping her chin up in her hand. “He also has this for you,” She says, sliding the small device across the desk.
Hans’s eyes don’t leave hers, nor his hand leave his coat pocket, as he leans in to pick it up. He inspects it briefly, then nods shortly. He hands it off to another man, who quickly attaches it to the electronic lock on the side of the main door, which flashes red as the locks engage. “And…where is Eddie?” Lord, that man’s voice has no business being that rich.
Bridgette shrugs delicately. “He doesn’t tell me personal things.” She casts a careless look behind her, at the elevators. “Oh,” She says, putting a little airy aloofness into her voice, “But he did also want me to tell you that more people than expected left early, whatever that means. But Fury is still here.”
He’s still watching her. Bridgette is not God’s strongest soldier.
She smiles at him. “But what do I know? I’m just a secretary.” Bridgette winks.
Seemingly mollified for now, Hans nods slowly and turns to Theo. Wordlessly, the two head out of her view, down the hallway.
Bridgette exhales, deflating slightly.
“Really?” A voice hisses out.
She looks down at Percy, crouching under the desk. “Okay,” She defends. “He…well…Lee doesn’t mind!” She rushes out, face pink. “I mean, seriously, his voice, Jackson.”
He’s squinting at her from behind his glasses. They’re a good look on him, though they do literally nothing, she thinks. Barnes definitely likes them. She keeps that tidbit in the back of her mind for future blackmail. “He really that hot?” He asks.
Bridgette nods before he’s even finished. “Yes.”
He just sighs. “Sure.”
Down in the basement, a tall blonde man slides down an access stairwell, stopping to crouch by the fuse box. Pacific Bell Employees Only, reads the sign posted on the exterior.
He drops his bag and pulls out a thick pair of gloves and an electric saw.
A large metal case sits to his left as he forces the fuse box open and begins pulling wires, attaching a few with metal jumpers before cutting a small red one, hidden in the back of the box.
In Tony’s office, Stephen pulls the number Ross gave him out of his wallet. He dials it on the phone attached to the wall, leaning against the doorframe.
“Hey, man!” Ross chirps once he picks up. “How’s it going with your guy?”
Stephen’s mouth twists. “Vote’s not in yet.”
Karl joins his brother beneath the tower, though he has a protective mask and a large saw, which he immediately hefts, beginning to cut through the large pipes amidst his brother’s protests, who is now furiously working on splicing the last few wires, sweat dripping down his nose.
Finn barely manages to attach the final cable as Karl disables the telephone junction box, looking up and glaring at his brother.
Upstairs, Stephen’s connection to Ross is abruptly ended. He frowns at the receiver. “Ross?”
Hans stands at attention in the elevator as, behind him, the sounds of guns being loaded echoes throughout the small space. He, himself, once again curls his fingers around the handle of his pistol, but doesn’t yet take it out.
A great shudder stops the elevator in its tracks. The overhead lights flicker out for a moment before returning.
[Dan: GO GO GO GO ]
[Dan: GET THEM OUT ]
Natasha and Bucky exchange wide-eyed looks before rushing out, one to Tony’s office and the other to the party.
Bucky wastes no time sprinting down the halls at top speeds—the benefit of Tinsel’s magic is that the few people that do see him pay him little mind, even as he easily tops the speed of an Olympic sprinter while in a suit. He barrels into Tony’s office, taking a short half-second to compose himself before entering the ensuite. “Excuse me?” He calls out.
Stephen looks up at him, hanging up the phone. Based on the slight furrow in his brow, it must have already been disconnected. There’s glass shattered all over the floor—Natasha’s doing, he assumes.
Plastering a smile on his face, Bucky tears his eyes away from the mess. “Hi, sorry. Unfortunately, I’m going to have to ask you to briefly vacate this office while it gets cleaned—we had a…bit of an incident earlier with a pair that indulged a tad too much with the champagne.” He looks pointedly down at the glass. “Safety hazard. You can enjoy the festivities for a bit while we take care of it.”
Predictably, Stephen, not particularly sociable, looks a bit uncomfortable. “I’m not a Nakatomi employee,” He says. “I don’t think…”
“You’re a guest,” Bucky says. “Please, have fun. The entire department is here.” He says that like it’s enticing, when, to Stephen, he knows it’s the exact opposite. He watched the man and lets the ‘realization’ dawn obviously on his face. “Not a fan of parties?”
Stephen shrugs slightly. “Not particularly,” He admits.
Bucky bites his lip, all hesitant and unsure. “I’m sorry, but I really can’t have you stay here. It’s policy—too much potential for injury and lawsuits.” He explains haplessly. He lowers his voice a little. “If you really want to stay out of it, go out to the elevators—the middle one is down for maintenance, but the other two are fine." More like there's a squad of armed terrorists stuck in it, but, whatever. "Take it a floor up. There’s a big lounge right down the center hall—can’t miss it.” When Stephen says nothing, Bucky adds on, “You’re Stephen, right? Tony’s husband? I’ll tell him you’re up there. He’ll meet you. Truthfully, I think his patience is wearing a bit thin, too.”
That seems to do the trick. Stephen’s shoulders relax a bit and he nods. “I’ll do that. Thank you.”
Bucky nods. “Just doing my job.”
Out on the main floor, Natasha pushes her way through the crowd, towards the thick throng of people that have naturally congregated around Tony. “Dr. Stark!” She calls, thinking quickly. At present, she has no clue how Bucky is convincing Stephen to go up to the lounge, so she’ll need to get creative. For all she knows, the poor man might be having his unconscious body dragged up a stairwell by an ex-assassin. Tony turns to her. “Ms. Rushman,” He greets. “Enjoying the party?”
“I’d be enjoying it a bit more if I hadn’t been fielding calls from Reed Industries for the past ten minutes,” Natasha lies smoothly. “Do you have a minute? I’ve got Dr. Richards on hold in my office—just a second of your time,” She says, almost desperate.
“Of course,” Tony says immediately. “Lead the way.”
She catches the left elevator closing just as her and Tony turn the corner. The lights on the middle panel are completely out—they probably don’t have a lot of time before Gruber gets impatient. They go to the one on the right, but at the last minute, Natasha pushes the button and steps back out. As the doors close, she calls out, “My office right there, just past the lounge! Can’t miss it!”
[Bucky: dropped stephen off. ]
[Bucky: in the stairwell ]
[Nat: Sent Tony up ]
[Dan: ten seconds ]
Natasha takes that as her cue to duck out of sight, hurrying to get as far away from the elevators as possible. True to his word, ten seconds later, she hears the soft ding of the middle elevator.
[Dan: all doors are locked. left and right elevators are down, middle one is skipping the thirtieth floor. elevator won’t register it ]
And, just like that, Tony and Stephen were stuck together.
In the security room, ignoring Dan’s furious typing, Mal hums as she messes with the building’s intercom system. Crouched beneath the desk, pliers hanging from her mouth, she snips a small wire and twists it, connecting it to another, leading up to a small power bank that her phone is plugged into.
Mal leans into the mic. “Apologies,” She says as robotically as she can, watching the light labeled 31 blink back at her. “The plaza is experiencing a sudden power outage. We have been forced to use our emergency generators. For the time being and our safety, all doors will remain sealed and the elevators are out of service. We apologize for this inconvenience. Rest assured, this will be fixed by the end of the night. Please enjoy the party in the meantime.”
She flicks off the mic, then turns to Dan, who’s still intently hunched over his computer. Nerd.
The middle elevator slides open. Almost silently, unnoticed, nine men, shoulder to shoulder, step out, guns raised at the ready. The music overhead abruptly cuts off as the gunshots begin, fired upwards into the ceiling.
The screaming begins almost immediately. The men fan out and ruthlessly drag everyone they find out from the offices and hallways, corralling them all into the main plaza.
“Shit,” Natasha hisses, pressed behind a door. Fortunately for her, while these men do seem to know what they’re doing, their situational awareness seems to be lacking. She slips out from her hiding spot and dashes to the stair access door at the end of the hall, which quietly unlocks just as she reaches it. The second it’s closed behind her, she breathes a sigh of relief.
[Nat: Thanks, Dan. Heading up to the 32nd.]
She resists the urge for a brief pitstop on the 31st to eavesdrop on Tony and Stephen, instead heading up to first of the half-constructed floors. The walls are bare drywall, a myriad of exposed supports, scaffolding, and tarps filling up the space in lieu of cubicles and offices.
“Ladies and Gentlemen,” Hans says, stepping out in front of the crowd, voice comparatively calm and gentle to the muffled screams and sobs laid out before him, all backdropped by the artificial waterfall that cascaded down the wall by Fury’s office. He idly flipped through a few pages of a small, leather-bound book in his hands, almost the exact same shade of scarlet as his silk tie. “Due to the Nakatomi corporation’s legacy of greed around the globe, they’re about to be taught a lesson in the real use of power.” He says. “You will be witnesses.” He closes the book with a soft snap. “Now, where is Mr. Fury?”
Hans scans the crowd, eyes raking over each and every person. “Nicholas Joseph Fury,” He says cooly, beginning to slowly descend the steps from the elevators. “Born Huntsville Alabama, July 4th, 1937. Interned at Manzanar, 1942-1943.” He begins to circle the crowd, stopping to make eye contact with people that catch his eye. “University of California on scholarship, 1955. Law degree, Stanford, 1962. MBA, Harvard, 1970. President, Nakatomi Trading—”
“Enough.” Fury stands from the crowd.
Hans turns to face him. “And Vice Chairman, Nakatomi Investment Group.” He finishes.
“That’s me.” Fury says, stone-faced.
Hans smiles at him. “How do you do? It’s a pleasure to meet you.” Fury is grabbed the the collar of his suit but one of the men, Karl, and goes willingly as he is dragged, a myriad of fearful gasps erupting from behind him.
Meanwhile, Natasha, crouched on a high, unfinished pillar, peeks out from behind a tarp. Slowly, she taps the small, outdated comm Dan had scrounged up, and, by the sounds of it, had just got working. “Hey, guys,” She whispers. “Three guys just brought a missile up here.”
“...Fun.” Mal whispers back. “Can I have it?”
“I don’t know,” Percy replies dryly with a soft grunt. “Have you been good this year?”
“I’m wonderful every year.” She replied indignantly.
There’s a small heave over the line. “Debatable.”
“Mean. What are you doing?”
“Elevators are down, and they have the stairwells,” Percy says.
Natasha’s lips curl up into a smile. “Jackson, are you climbing up the elevator shaft?”
“Maybe.” He breathes. Then, “Climbed, past tense. I’m heading for Fury’s office.”
“I’m obsessed with you.” Bucky’s voice joins the conference.
“...Is Hans in there?” Bridgette asks.
“Seems like it.” Percy replies. He pauses for a long minute. “Bridgette, do you want me to get close enough for you to hear him?”
A soft, almost ashamed sigh. “Yes.”
Percy huffs out a small laugh. “I’ll do my best.”
Natasha settles in to watch the missile get wheeled in on its little cart. She wonders, briefly, if they brought the cart with them.
Hans runs his fingertip lightly over the model of Nakatomi Plaza that sits on display in the middle of Fury’s office. “And when Alexander saw the breadth of his domain, he wept, for there were no more worlds left to conquer,” He drawls, a soft chuckle leaving him as he glanced at Fury. “The benefits of a classical education.” He wandered, next, to a model of Nakatomi’s next project in Indonesia.
As Fury gave a tight reply about developing a region, not exploiting it, Percy rolled his eyes. “Classical education,” He muttered. “I spent half mine in jail and I bet I can speak Latin better than this clown.”
Hans holds out a friendly arm to Fury. “We could discuss industrialization or men's fashions all day, but I'm afraid my associate, Mr. Theo, has some questions for you—sort of fill-in-the blanks questions, actually…” He says, leading Fury towards the desk where Theo, his computer open in front of him, sits. Glowing green, across the screen, spells out;
NAKATOMI CORPORATION.
BOARD WORKSTATION.
ENTER CENTRAL COMPUTER CODE KEY _ _ _ _.
Hans seats himself opposite of Theo, while Fury stands at the foot of the table. “I don’t have that code.” He says sternly. “You broke in here to access our computer? Any information you could get, once they wake up in the morning in Tokyo, they’ll change it. You won’t be able to blackmail our executives or threaten—”
“Sit down!” Hans barks, a sudden contrast to his calm demeanor. Fury does, and, abruptly, Hans is once soft-spoken. “Mr. Fury, I am not interested in your computer. I'm interested in the 640 million dollars in negotiable bearer bonds you have in your vault.”
Fury’s lips part in subtle surprise.
Hans smiles. “Yes...I know about them. The code key is a necessary step in accessing the vault.”
“You want money? What kind of terrorists are you?” Fury asks.
Amused, Hans replies, “Who said we were terrorists?”
Behind them, Percy creeps along the outer wall, ducked behind the variety of furniture as he inches closer. “Oh, shit, guys,” He whispers. “I think they’re about to shoot him.”
Hans is calmly detaching the silencer from his gun. “Now,” He says. “The code, please.”
Fury shakes his head. “It's useless to you! There's seven safeguards in our vault, and the code key is only one of them. You'll never get it open,” He warns.
Hans lifts the gun. “Then,” He says. “There’s no reason not to tell it to us.”
Across the table, Theo lazily spins his chair to Karl. “I told you…” He trails off. Karl rolls his eyes. “It’s not over yet.” Hans gives them both a stern look. In the back of the room, Finn, Karl’s brother, sits, annoyed. Hans’s eyes are fixated on Fury. “This is too nice a suit to ruin, Mr. Fury. I’m going to count to three. There will not be a four. Give me the code.” He cocks the gun.
“One,” He says calmly, taking aim. “Two,”
Fury shakes his head once more. “I don't know it, I’m telling you.” He insists. “Get on a jet to Tokyo and ask the chairman! You're just going to have to kill me.”
“Oh, no.” Percy whispers flatly. It’s definitely Dan that giggles softly.
Hans deliberates on this for no more than a second. “Okay.” He pulls the trigger, and Fury’s blood paints the glass pane behind him crimson. As Fury falls to the floor, Hans stands. “We’ll do it the hard way. Finn, see if you can dispose of that. Karl, you better go check on Heinrich’s work up on the machine floor.”
“Nooooo,” Percy whispers. “Guys, I think he’s dead.”
“Oh my fucking God they fucking killed him,” Dan whispers back.
Karl leaves, leaving his brother behind to drag Fury’s body out of the room. Hans, standing over him, turns to Theo. “Now,” He says. “You can break the code?”
Theo slings his coat over his shoulder. “You didn’t bring me along for my charming personality.”
Over the comms, Dan hisses out something unintelligible but very unkind.
“Ooooh,” Mal sings softly. “Dan’s got competition.”
There’s a dull thud that Percy assumes is him smacking her.
“Thirty minutes to break through each lock, two and a half hours in total. The seventh is out of my hands.” Theo says. “The electromagnetic seal? The circuits can’t be cut locally.”
Hans smiles. “Trust me.” Is all he says.
Bucky casually strides into open half-constructed space, hands in his coat pockets. He cranes his neck up to the shadowed ceiling. “Nat,” He calls out. “TBH, IDK where you are, but I’m pulling the fire alarm.” The little red lever has been calling his name since he Awoke in his stupid building.
He pulls it. It makes a funny little noise.
Bucky turns to a knife in his face. “Did you just use texting acronyms verbally? Out loud? In front of me.” Natasha asks.
“Maybe, LOL.”
“I’ll fucking kill you right here, Barnes. We both know I’ll do it. Hans Gruber and I will be in Cancun before they even find your body.”
“Percy,” He reminds her.
Natasha sighs and holsters her knife. “Goddamnit.”
Bucky smiles pleasantly at her.
“Hey, Hans just asked what floor the alarm got pulled on. Totally snitched on you two.” Bridgette says over the comms.
Natasha sighs. “Really?”
Bucky shakes his head. “This is embarrassing. Stand up, Bridgette.”
She just sighs over the line. “You’re gonna have a couple guys with rifles coming up there in a second.”
“Kill them?” Bucky asks. Natasha nods eagerly. “Christ, you two perked up like Lea when she gets to chase birds.” A beat. “Yes, you can kill them.” Bucky and Natasha high-five.
Heavy footsteps echo down the hallway. In the blink of an eye, both ex-assassins are once again perched up in the rafters, obscured by shadows and tarped scaffolding. They watch from above as two men enter, one fair and blonde and the other with dark, curly hair.
“The fire has been called off, my friend,” The latter, James, calls out, his heavy rifle ready in his hands, slowly advancing into the room. “No one is coming to help you,” He flicks the lights on as he continues, eyes taking in every corner. “You might as well come out and join the others.”
Bucky narrows his eyes. There can only be one James, here.
James rounds a large stack of crates. “I promise I won’t hurt you.”
Above him, the two make eye contact. Slowly, Natasha nods, and, without a sound, the two drop down from the rafters, landing in identical crouches. Natasha leaps at James, the tip of her knife pointed at his throat. Bucky stands behind her, reaching out and wrapping his hand around the barrel of the gun. It creaks lowly in his grip, but doesn’t yet warp—he doesn’t want to ruin it. He wants it, obviously.
“Poor Christmas spirit,” Natasha critics. “Drop the weapon.”
Then, Natasha fucking jumps the guy, landing on his back and wrapping her lights around his torso while she throttles him. It’s almost laughably easy how quickly they take him out. Bucky wrenches the gun from his arms as he’s weakly trying to pry her off and slams him to the ground, and Natasha is on him, slitting his throat with one sure movement.
“Oh, wow,” Bucky says, standing over the man. “He’s bleeding glitter. How festive.”
Natasha ooohs softly. “Nice touch from Tinsel.”
The soft sound of a gun cocking echoes wildly. “Hands up.”
Bucky looks at Natasha from the corner of his eye. “Oh, we are never hearing the end of this,” He whispers as he slowly raises his hands. She closes her eyes, a pained look on her face. “Percy can’t hear about this, do you understand me?” She hisses.
“Turn around.”
They do as they’re told.
The other man, Finn, is standing in the doorway, an assault rifle aimed at the ready.
The three stare at each other for a long minute.
“Oh, hey, guys.” Lee says.
“Lee?” They both yelp.
“What’s up? I didn’t know you guys were here.” She asks casually, lowering her weapon.
“What the fuck are you doing?” Natasha exclaims.
Lee shrugs, adjusting the strap of her duffel bag. “Well…snapped out of it and realized what I was doing when I saw you escaping from the plaza,” She explains. “But, I figured at this point, I was already in too deep. They let me use power tools, you know?”
“Oh, that’s cool.” Bucky nods. “The work’s good, then?”
“Hans Gruber offers dental and eye care,” Lee replies with a shrug. “Besides, not like I was up to much else.”
“So you just…went with being a terrorist?” Bucky double-checks.
That gets him a raised brow over the rim of her glasses. “Do you really want to go there?”
“Nope.” He says. “Just clarifying.”
Lee nods approvingly.
Natasha taps her comm. “I found Lee,”
The line explodes with chatter, overlapping voices and surprised demands, plus Dan, who Bucky’s pretty sure is just screaming nonsensically. “Quiet!” Percy snaps. He’s pulled out the Dad Voice. It’s very effective—stern but not quite mean. “Lee?”
“She’s a terrorist.” Bucky explains, pulling a spare comm from his coat pocket and tossing it to her. She puts it in with one hand, the other still holding her rifle. “I committed to the bit.” Lee says by way of introduction. “Me and my brother. It’s family bonding, I think.”
“Aww,” Mal coos.
Theo grins as the vault beeps with a final keystroke. The screen lights up green;
DO YOU WANT TO PROCEED?
“You bet your ass I want to proceed,” He leans in, pressing the button. As he waits for it to go through, he turns to the drill and readies it. A pause, then another small beep;
TOO BAD.
Theo does nothing but stare for a solid second. He enters the password once more, only to get a similar result, this time with a;
LOSER.
He tries again. And a fourth, and a fifth, time. The screen responds in kind.
UGLY LOSER.
BAD OUTFIT.
His eyes narrow and he pulls his computer towards himself. “Well,” Theo murmurs under his breath. “Looks like I’ve got company.”
“Hey, Percy?” Bucky asks.
“What’s up?”
“Where are you right now?”
“Fury’s office,” Percy says. “Comfy chair.”
“And what are you wearing, right now?” Natasha asks lowly in a poor imitation of Bucky’s voice. He turns to her and makes a face. Lee gasps gleefully—a motion she manages without her expression changing in the slightest. God, Bucky’s Hydra trainers would have loved her. So effortlessly stoic and unfeeling. Envy-inspiring, really. “Are you going to do the thing?”
“The thing!” Mal cheers. Then, softly to Dan, “What thing?”
“We can hear you, Mal,” Natasha says. “Percy?”
The sound of Percy spinning in Fury’s chair. “I don’t really give a fuck, to be honest.”
For the second time that night, Natasha and Bucky high-five.
They set the cargo in the only working elevator. Lee stands silently behind them, absently playing with the lighter she lifted from her ex-coworker’s pockets. As soon as the elevator doors slide shut, Natasha flicks the emergency shut-off switch, bringing the car to a shuddering halt. Bucky easily pries the doors open and hefts himself up onto the floor, Natasha and Lee following suit. Once all three of them are level, he reaches down and flicks the switch again, then taking his arm out from the doors and allowing them to close.
Then, they settle in and wait for the screams.
The hostages are forced back, out of view of the elevator, as Hans slowly strides towards it. James, propped up in an office chair and very clearly dead, says nothing, because he is very clearly dead.
Hans straightens James’s sweatshirt, face cold. “Now we have a machine gun. Ho-Ho-Ho.” He reads aloud, lip curling. James’s Santa hat flops lifelessly over his equally lifeless eyes. Hans pulls his radio out and hands it off to Marco. “Try for Finn. He was with James. If he doesn’t respond, we must assume he has received…similar treatment.”
He stares at James, calculating. This is not the work of a security guard. We, the morbid note reads. This is a team.
Behind him, Marcos shakes his head. “Nothing from Finn.”
Hans sighs. “Call Karl down. Tell him his brother is gone.”
“Are we skipping the whole cop thing?” Mal asks, swiveling in her chair. Dan, very intensely engaged with his new mortal enemy, doesn’t reply.
“I’m kinda bored,” Bridgette says with a sigh, similarly messing around at her reception desk down in the lobby.
“We are,” Percy replies. He, too, is rapidly spinning in Fury’s chair. “If you’re bored, though…” He trails off and smiles.
Bridgette stays where she is, but Dan patches her through to the security cameras so she can ‘play God’, in her words. They need someone with eyes while Dan is busy getting in an online fistfight, anyway.
Mal and Percy meet up in the South stairwell. Dan still has a firm control over the electronic locks, so they have no issue bypassing the doors. Lee, Natasha, and Bucky begin tracking down more of Hans’s men, he and Mal go on a hunt of a more specific kind.
“About fifteen pounds of C-4!” Mal enthuses, bouncing on the balls of her feet.
Percy squints for a moment, but fake-Fury’s death has put him in a good mood, so he just shrugs. “Yeah, alright.”
They drop by the North stairwell to grab Spencer, who’s been quietly playing Tetris for the past hour. They can hear the sound of gunshots through the ceiling above—Natasha, Bucky, and Lee have clearly found some success.
They head through a service entrance, shimmying through a few tight corridors and into the guts of the building. Percy holds out a hand, stopping the other two. “We’ve got two men,” He says softly. “One of them has the bag.”
Mal giggles.
Spencer is chewing intently on his nails. Without acknowledging it, Percy gently pushes Spencer’s hand away from his mouth. Mal takes his palm, uncurls his fingers, and, from somewhere, produces a glob of silly putty and deposits it in his open hand.
He looks at her in silent shock.
“Emergency slime,” Mal whispers.
Spencer fiddles with the putty. He doesn’t ask questions.
With a silent gesture for them to stay put, Percy creeps forward and around the corner. The two men are crouched beneath a large pipe, open bag between them. They’re speaking to each other, softly, loud enough for Percy to easily hear, but, unfortunately, not in a language he speaks. German, maybe?
One of them has an open can of some sort of energy drink to the left of his planted knee, the opposite of Percy. With a sharp grin and an even sharper flick of his fingers, the can tips over and clatters noisily. Both men whip around, and, taking advantage of their momentary distraction, he steps out from his hiding spot and lunges forward. A swift kick knocks the first gun out of their reach, sliding across the concrete floor.
The two whip around. The first lunges for Percy, slamming into him brutally, while the other scrambles for his gun. A swift uppercut and a right hook makes the unarmed one stagger back, and a sharp whip of battery-acid green liquid knocks the other off his feet. Percy steps on the muzzle of the gun and grins down at the two men as, behind him, churning and writhing in the air like a serpent, the now liberated energy drink mimics the movement of his fingers. “Hasn’t anyone ever told you these things will kill you?” He asks.
From behind him, Spencer steps out. Spencer now has a fucking machine gun. “Those can damage your heart,” The now incensed med student says.
Slowly, Percy backs away. Mal is watching with wide eyes, though her attention is clearly divided between that and the C-4 bag, which she’s eyeing like a dog with a steak.
Percy slowly reaches out and snags the bag, then hastily retreats until he’s shoulder to shoulder to Mal. Spencer is yelling, now. Loudly. Percy didn’t even know he could reach that volume.
“Should we…go?” Mal whispers.
Percy shrugs.
Spencer definitely kills those two guys, though.
“Two down,” Percy says through the comms. “I’d be a little nicer to Spencer for a while, by the way.”
Lee raises a brow. “Well,” She comments idly. “Natasha and Bucky are taking care of two more.” Behind her, Bucky repeatedly slams a man against the wall, steadily making a dent in the drywall. Natasha, on the other hand, has another man by neck and is giving him an absolutely foul wet willy. He’s screaming. She’s laughing.
“We’re making good time.” She concludes.
“I’m going to do something drastic,” Dan cuts in. “I want to build a bomb. I want to kill this man. I want his head stuffed and displayed on my wall.”
“Oh?” Bridgette asks.
“Dan’s new boyfriend,” Lee dismisses as Nat executes a wonderful roundhouse kick. The man goes careening out the window, and Lee pokes her head out the adjacent window to watch him fall. “I can do that for you, if you get me the head, by the way.” There’s a dull thud and a sickening crack as the man hits the pavement below. “Also, I think the cops will be coming soon.”
Natasha just shrugs sheepishly.
Bucky looks over. “Oh, is that what we’re doing now?” With one hand, he punches the man out the window.
Lee watches this one fall as well. “Well,” She says. “I suppose it is, now.”
All three of them jump at the sound of sudden knocking. The corner window, thankfully unshattered, shakes slightly with the force of the knock. Natasha squints at the night sky outside, and absolutely does not yelp a little when something moves directly outside of it.
“It’s kinda cold out here!” Peter yells, muffled through the glass. “Can you let me in?”
Bucky stares for a second, but then rushes forward and swiftly removes the shards of glass around one of the…’opened’ windows. Peter crawls in with a grateful grin, landing neatly on the floor. “Hey, guys!”
“How’d you…” Natasha trails off, curious.
Peter brushes a light dusting of snow from his hair. He’s shivering a little, and Lee wordlessly takes off her coat and drapes it over him. It goes down to the middle of his shins, and he squished his face into the lined collar. “Well, I was just kinda sitting at home, and I was thinking, man, I can’t wait for my two parents to come home, and, like, two? In this economy? That was foreign enough to me that I just kinda snapped out of it, honestly. Why are you looking at me like that?”
Bucky pulled Peter into a hug while Natasha called in. “The boy has been acquired.”
Outside, even from this height, the roar of police sirens rings through the night. The four creep closer to the edge, watching a flood of red and blue light draw closer. “Looks like somebody found the bodies,” Bridgette hums.
Peter’s eyes zero in on the radio in Lee’s hand—the one she’d had from her terrorist gig. He makes grabby hands, and she hands it over without complaint.
In Tony’s office, which has since been commandeered by Hans, Karl, Franco, and Alexander argue restlessly.
“All of you relax,” Hans snaps overtop them. “This is a matter of inconvenient timing, that is all. Police action was inevitable,” He says. “...and, as it happens, necessary. So, let them fumble about outside and stay calm. This is simply the beginning.”
On his desk, the radio crackles. He snatches it up. “I thought I told all of you I want radio silence until further—”
“Iiiiiiiiiii—” A truly astounding reproduction of the opening riff of Mariah Carey’s hit song All I Want for Christmas is You crackles over the radio. “Don’t want a lot fooooor Christmas,”
Hans’s grip tightens painfully on the radio. “Who is this?” He demands.
“ There is just oooooone thing I need,” Overtop the clearly young singer, another voice, this one belonging to a man. “James, Heinrich, Marco, Uli, and Kristoff.” The man says lowly. “Karl, Franco, Alexander, Fitz, and you.”
“Halfway there,” A third voice, this one belonging to a woman. Then, the transmission cuts out.
Before Hans can speak, another voice, similarly female, but slightly higher, perhaps younger. “We also got your Christmas gift!” She chirps happily. “I’d say give our thanks to Heinrich for delivering it, but…” She trails off, and ends the transmission.
Hans, a frozen fury alight in his eyes, looks up at Karl, Franco, and Alexander. “Find them,” He snarls. “See if they’re lying, and find Heinrich’s bag.” He orders.
Karl is white-knuckling his weapon. “And my brother?” He asks, jaw tight. Finn’s name hadn’t been mentioned at all.
“Do what you need to,” Hans dismisses. “And stay off the radios!”
Franco and Alexander return only minutes later. “He wasn’t lying,” Franco says gravely. “Marco and Heinrich are lying on the street below. And Heinrich’s bag is missing.” The detonators.
Swiftly, Hans picks up the radio and punches in a few numbers. “Theo,” He calls.
“Yo!” Theo yells over the deafening whirring of the drill.
“We may have some problems. How’s our schedule?” Hans asks.
“Somebody is fucking with me, Hans! They have a tech guy! I’m two down, four to go, but I can’t do shit if this guy keeps getting in my way!” Theo hollers.
“Give the radio to Fitz.” Hans orders. After a moment, “Fitz, find whoever is attempting to stop Theo. Kill them.”
“Got it.”
In the lobby, Bridgette watches as the police pull up, bathing her entire word in blue and red. The second one of them, a tall man with graying hair, sees her, his eyes widen.
Bridgette stands and makes her way to the locked doors, staring at the assembled force.
She reaches for Eddie’s radio. “Hans?” She asks softly. “I…don’t know what I’m supposed to do here. Eddie didn’t tell me this part.”
There’s a brief pause. She’s still not entirely sure if Hans trusts her, like, at all, but she doesn’t particularly care. “Do what you must. Do not unlock the doors, no matter what they do, be it negotiation or threats.”
“Yessir,” She says airily. Bridgette looks around for a moment before locating a loose piece of printer paper and a marker. She gets to work, leaning over the front desk, before returning to the windows. One man, the captain, by the looks of him, is gesturing desperately at the front door. Doing her best to look confused, Bridgette shakes her head. Then, she puts the piece of paper up against the window.
“Sorry, we’re closed?” The glass is thick, but she can hear the captain’s outraged voice quite clearly.
Bridgette shrugs glibly.
Then, eyes wide, she turns around and rushes back to the front desk. “Oooh,” She enthused, grabbing her radio. “I’m gonna push the button! Hans, I’m pushing the button!”
He sighs over the radio.
Bridgette pushes the button. A large metal gate slowly makes its way down over the entrances, both front and side, of the lobby. Bridgette claps her hands together happily. Wonderful button!
“Also,” She says. “I’m pretty sure they’re sending in a SWAT team.”
Down in the garage, Ross turns down the music, looking up at the ceiling. “What the fuck was that noise?”
Fritz sweeps the hallway, his gun drawn, shoulders in. As he turns the corner, he reaches out cautiously for the lightswitch, illuminating the half-constructed office space. He takes a step forward, only to be plunged back into darkness.
He flicks the switch back on, lights turning back on. Faulty wiring, he dismisses.
About three steps later, the lights turn back off. Fritz narrows his eyes. He turns them off, waits a long second, then proceeds.
The lights turn off.
Peter creeps along the ceilings, half his attention on the hostages he can hear down the hall. Hans is in Tony’s office—rude—but his view of the back corner of the plaza is blocked by a truly impressively sized fern. Peter lands silently, ducking behind a cushy chair that is sat by the cold fireplace.
Alexander, the only gunman left with the hostages, does a casual sweep every few minutes, but his attention lies elsewhere, directed towards the elevators and stairwells on the opposite side of the grand plaza—coincidentally, closer to Hans, as well.
“Psst,” Peter hisses. Fearfully, the woman closest to him whips around, eyes wide. Quickly, Peter puts a finger to his lips. Seeing that he is just a little guy, the woman calms, but only slightly. He smiles at her. “You wanna get out of here?”
She glances once at Alexander, his back momentarily turned, then nods frantically.
Peter holds out an arm. “You scared of heights?” He whispers.
Fritz roughly slams the lightswitch, knocking his fist against it. That usually works with electronics issues, doesn’t it?
To his relief, the light stays on. He advances, gun at the ready. Now harshly lit, he can see around the half-build pillars and walls, loose insulation fluttering at the powerful commercial AC overhead.
The lights turn off.
“I hate you, I hate you, I hate you,” Dan whispers into his computer.
Two floors away, hidden in the back room of Fury’s office, Theo leans in to his screens. “I can’t wait to see you in Hell,” He tells the anonymous code flowing across his screen.
The vault beeps, it’s screen lighting up once more. The drill stills. FUGLY BITCH.
Theo screams.
Peter gently lowers the young couple down onto the floor of the office. This floor, by contrast, is almost dead without the constant hum or fear, or in the case of the ones his friends are occupying, unadulterated malice.
“I think there’s coffee in the break room over there,” Peter adds helpfully. The half-dozen rescued—well, maybe not rescued, as Peter has definitely kept them in the building instead of returning them to their families—hostages stare at him, baffled.
“I’m…just gonna—” Peter jabs his thumb behind him before scampering out of the room and back into his precious ventilation shafts. The moved, yeah, moved, hostages say nothing as they watch him retreat.
Fitz turns the light on.
The light turns off.
Fitz turns the light on.
The light turns off.
Fitz shoots the light switch.
The lights stay off.
Dan keeps up a running commentary of evil curses under his breath—not as in swearing, but as in actual ancient curses. Barren fields, infertile animals, polluted water, no rain, etcetera.
Theo shoves the drill back to work.
Alexander whips around, eyes narrowed, the soft whistle of wind echoing from somewhere in the large plaza. The hostages whimper fearfully as he sweeps his weapon in their direction.
…For some reason, he feels like the crowd is smaller than he last thought.
Fritz doesn’t even see Percy coming.
He jumps out from around a corner, grabs the man by the back of his, admittedly very beautiful and luscious hair, and slams his face into the wall. While the man is dazed, Percy grabs him by the throat and crushes his windpipe.
The man is dead before he hits the floor.
“Loser needed the lights,” Percy laughs into the comms.
Natasha carefully peeks around the corner. “Dan, how bad do you want your enemy dead?”
“Not until I defeat him,” Dan murmurs tonelessly. “Not until he’s sobbing at my feet.”
That complicates things, but only a little.
Franco, standing guard at the doors to the security room, looks, quite frankly, bored. Since Hans had sworn them off any channels but the private, he’s just been standing there, listening to Theo’s angry murmuring and the shrill sounds of the drill.
Natasha briefly considers just shooting him where he stands, but that might distract Theo, which will in turn anger Dan, which will then affect Natasha’s Flappy Bird access.
Instead, she briefly considers her options. She could lure him away somehow…
Natasha lifts her hands and, after a great moment of consideration, executes a perfect California Condor call. (Thank you, Lee.) Franco looks around, confused. Natasha does it again, warbling. This time Franco does take a hesitant step forward, looking to the windows down the hall. Natasha presses herself against the far wall, waiting for the precise moment for him to pass.
The second Franco enters her field of vision, Natasha jumps him. She darts out and grabs his rifle, yanking it back and out of his hands. The strap twists around his arms as she kicks out his knee, bringing him down. A foot planted between his shoulder blades, she yanks back with the rifle and twists the strap, leaving Franco gasping for air desperately. Natasha keeps him pinned with her weight as he scrabbles for his throat, holding tight until, slowly, he stops moving.
“One down,” She says into her comm.
Bucky…was bored. Just a little. Natasha has just finished terrorizing one of the last men, while Peter was currently menacing the second to last, sneaking hostages out one by one. Dan was still at nerd-war, Mal was playing with her C-4 (YIKES), Lee was roaming around with Spencer, Percy had just spent the last ten minutes fucking with a guy with a ‘lightswitch war’(?) and Bridgette was antagonizing the local police force—soon to be the FBI, probably—while simultaneously flirting with Hans Gruber over the radio.
(Lee definitely found it amusing, too. They refused to elaborate their reasons.)
Bucky, temporarily commandeering a wonderful spinny chair, tapped his comm. “Hey, did we ever find Ross?” He asked.
“...No,”
“Nope.”
“Don’t think so.”
“Huh,” Bucky mused. “Maybe we should be worried about that.”
“Meh,”
The SWORD team is full of such odd creatures. Ross likes to walk around shirtless to intimidate Dan, who plays online math games against middle schoolers to ‘humble them’, Lee keeps bugs in her pockets, Mal works part-time at a Party City, Bridgette ninjas baked goods into peoples’ homes, and Percy is scared of sparkling water.
He missed Percy.
Lee and Spencer stood back, staring upwards at the ceiling. Spencer’s arm was outstretched, fingertips barely falling short.
“I’m gonna get on my tiptoes,” Lee said decisively. “Brace yourself.”
He did as he was told, and when she rocked upwards, Spencer, who was standing balanced on her shoulders, pressed his palm to the ceiling. “Yes!”
Footsteps echoed down the hallway—heavy, booted steps. Spencer looked down and Lee looked up, exchanging panicked looks. Spencer scrambled down, practically falling off her shoulders. Lee caught him by the middle and deposited him on the floor, both of them quickly looking for a corner to hide in. Spencer dove behind a filing cabinet while she ducked into a cubicle, folding herself under desk a across the small walkway down the middle of the office.
To the left, the footsteps grew louder.
Across the walkway, Spencer made a few panicked gestures. Lee just shrugged and pressed herself further against the cubicle wall, drawing her stupidly long legs up to her chest.
A shadow stretches down the hallway, stopping in front of the open office space. Slowly, the person advances towards their hiding spots.
A pair of heavy boots pass right in front of Lee, who bites the inside of her cheek.
Then, Spencer sneezes.
The man whips around, easily pinpointing his location and hefting his gun. He fires off a shot that strikes a precious few inches from Spencer’s head. “Out!” The man roars.
Spencer stumbles to his feet and into view, eyes wide, hands raised.
“Are you one of them?” The man screams, the muzzle of his rifle pressed between Spencer’s eyes. “Where is he?” There’s a ragged, frantic look in his eyes. “What have you done with him?”
Spencer blinks, eyes wide. “Who?”
The gun is pressed harder into his freckled skin. “My brother,” Karl snarls. “The least you can do is tell me where you put his body.” His voice is shaking, not just with rage, Lee realizes.
…Oh. Ohhhh noooooo.
Spencer made desperate eye contact with Lee over Karl’s shoulder. Wincing, Lee slowly unfolded herself from under the desk. “Uh,” She said awkwardly.
Karl jerks backwards, spinning to see her. She stands there for a second, unsure, before he drops the gun completely, kicking it to the side in his haste. Karl all but tackles her, arms tight around her middle as his face is buried in her shoulder. She makes eye contact with Spencer for a second, and he gestures frantically towards Karl. Jerkily, Lee hugs him back. “Uh,” She says again. “There, there?”
In the back, Spencer smacks his palm to his forehead.
“I thought—” Karl exhales shakily. “I am glad you’re okay, brother.”
“Sister,” Lee blurts out.
Spencer stares at her, completely and utterly flabbergasted. “Now? Really?” He mouths.
Well, Lee’s on a roll. “Sort of? Sibling, maybe. Or brother works, sometimes, I guess. I’m…nonbinary.” She finishes. “Just mix it up?”
Karl draws back for a second. Then, he bursts into tears. “I am so proud of you!” He hugs her again. “Thank you for telling me, Finn.” A beat. “Is it still Finn?”
“Yeah,” Lee says softly. “Yeah, Finn is fine, Karl.” Abruptly, she finds her mouth dry, and she silently leans into his hold. “I’m…fine.”
Spencer is staring at her. It almost looks like sorrow in his eyes. Quietly, he points out into the hallway, and leaves.
Fuck. Lee hated emotions.
“It’s just Alexander, left,” Spencer’s voice comes over the comms.
“Karl dead?” Percy asks, swinging his legs idly.
“Uh, no, but he’s otherwise occupied. Don’t—don’t worry about him, actually.”
Huh. Alright.
“There’s like, nine hostages left. Alexander looks like he’s about to shit himself.” Peter reports. “I think he’s trying to decide whether or not to tell Hans.”
“Speaking of,” Bridgette says. “The police have an ATV and are trying to breach the front doors. Also, I have breached the candy counter. Lee, there’s a chocolate bar in my purse for you.”
“Thank you,” Lee’s voice is uncharacteristically soft.
“Dan, how’s it going?” Percy asks.
Never before has Percy heard this tone from his employee. “Victory,” Dan whispers. “Victory.”
“...Alright,” Mal says.
“Where are you all?” Percy asks.
“Top floor,” Nat reports.
“Heading towards you, Percy.” Bucky chimes in—he must be on the 33rd, then.
“Security office,” Dan. 33rd, as well, then.
“Outside the main plaza, in the vents.” 30th, for Peter.
“Offices,” Lee, slightly muffled. 34th.
“Lobby!” Bridgette.
“Thirty fifth floor.” Mal says.
“Same,” Reports Spencer. “So…Ross?”
“Fuck, I’d forgotten about that,” Natasha mutters. “I’m bored. Peter, I’m in the vents a few floors above you. Can I come down and kill Alexander?”
“I don’t see why not.”
The lines go silent. A few minutes later, a muffled bang Percy’s pretty sure only he and Bucky can hear. Natasha works fast.
Speaking of Bucky, the man strides into Fury’s office a few minutes later. He takes a moment to appreciatively look around, taking in all the scale models of Nakatomi projects and opulent furnishings. Then, he takes in Percy, who’s sitting atop Fury’s desk. “Hey,” Bucky says, grinning.
“Hi,” Percy says, similarly smiling. He spreads his knees a little wider so Bucky can stand between them, which the other man does almost immediately. Bucky’s hand cups his jaw, and he leans in and presses a sound kiss to his lips. “I like the glasses,” He says.
Percy grins up at him. “You know,” He says. “Before I lost the rest of my vision, I actually used to wear some. Will made me— to protect my eyes, or whatever.” He drops his voice to an absurd Southern drawl. Bucky laughs. “And you just stopped caring?” He asks, a little incredulous. Percy just shrugs. Bucky sighs and drops his forehead to Percy’s. “Listen to your doctor, dumbass.”
“You just like they way I look in them,” Percy accuses, joking.
“Maybe.” Bucky is not joking.
Meanwhile, on the floor above, Natasha, Peter, Mal (with her suspicious little backpack on), Dan (hunched over, still typing), Bridgette, and Spencer stand in a loose circle. Lee stumbles in a second later, one of the terrorists…hanging off her back? He’s crying a little.
“This is my brother, Karl.” She announces firmly.
Dan, for the first time that entire evening, looks up. “Hi, Karl.” He immediately returns to his work.
Lee points to Bridgette, who waves. “This is my wife, Bridgette.”
Karl weeps loudly. “It is so lovely to meet you!” He sobs.
“So,” Natasha says, eyes not leaving the trio. “Hans is the only one left, no?”
“Yep,” Mal says. “So…what should we do?”
“All the hostages are gone,” Peter says. “I figure it’s just a matter of time until he notices. I think he’s just plotting in Tony’s office.”
Natasha hums for a second. “You know what would be really funny?”
The entire group (including Karl) looks at her expectantly.
“I’m pretty sure Percy and Bucky are with each other right now…”
A chorus of evil giggles.
Hans Gruber has been having a rough day. His men have been dropping like flies, and now, as he stands in front of the large glass wall of the office, the plaza is fucking empty.
Alexander, who was supposed to be keeping watch of the hostages, is gone. As are the hostages.
Hans takes a slow, measured breath. He picks up the radio. “Alexander? Karl? Franco? Fritz? Theo?”
No response.
Hans steps out of the office. Then, a soft crackle. It’s garbled and staticky, but it almost sounds like Karl. “Fury’s office”
“Karl,” Hans says. “Have you found them?”
When he is not answered, Hans’s fingers wrap around his gun. He keeps a tight grip as he walks down the completely deserted hallways. He takes a slow breath before throwing the door open, gun at the ready.
“Was zur Hölle?” Hans can’t help it. He yells. There’s a man sitting on Fury’s desk—where Hans shot the man himself not a few hours ago—with another crowded over him, kissing the breath right out of him. Based on the way they’re dressed—the seated one in slacks, sweater, and a tie, the standing in a suit, they’re Nakatomi employees. “This is a hostage situation!” Hans roars. “What are you doing?”
The suited one seems to take a long second to finish sticking his tongue down the others throat before pulling away and shooting Hans a dirty look. “We’re kinda busy.”
The other, glasses crooked on his nose, peeks over the other’s shoulder. “You seem mad,” He notes. Then, he gasps. “Are you homophobic? Oh, my Gods, James, the terrorist is homophobic.”
The newly named James narrows his eyes at Hans. “Not cool,” He says, shaking his head solemnly. “Not cool at all.”
Hans just stands there, gaping. He thinks about shooting them. Would that be a hate crime? He’s a terrorist, not a bigot. But he wants to shoot them so bad. Not because they’re gay, but because they’re pissing him the fuck off.
He’s not sure how long he’s frozen. Certainly long enough for the two to resume making out.
Certainly long enough for him to be completely shocked when someone taps him on the shoulder. It’s a woman, brilliant red hair and blue eyes. She smiles at him, all teeth. “Yippie-kay-yay, motherfucker.” She says.
It’s the last thing Hans ever hears.
They ride in the elevator together. Light music plays above them, filling in the very few existing gaps. Karl is still hugging Lee. Lee is holding hands with Bridgette, who’s behind Mal and Dan, who are next to Spencer, who’s behind Nat, who’s next to Percy and Bucky, who are also holding hands. Peter is on the ceiling above them.
They arrive, for the first time in hours, on the 31st floor.
The doors slide open and they all pile out from the car, stumbling onto the floor. “Aw, shit, Dan,” Bridgette grunts. “That was my spleen.”
Mal went down cradling her backpack. Bucky catches Percy and simply doesn’t let go. Percy seems to have no issues with this.
Two, identical, horrified screams. “PETER?”
Peter looks up. “Oh, hey…Dad. Pops.” He grins at them.
Tony and Stephen look fucking awful, actually. Both their clothes are rumpled, but not in the fun way. Their faces are pale and drawn, eyes bloodshot red. They look like they’ve just had a three hour nervous breakdown. But…
“They’re holding hands!” Nat screams. Tony and Stephen, are, in fact, gripping each other tightly.
Everyone, even Karl, begins cheering. Tony looks close to tears. “What the fuck is happening?”
Mal, muffled into her backpack, replies, “We locked you in here so we could take care of the hostage situation while you two kiss.”
“A stress free environment.” Peter says, nodding solemnly. “For reconciliation.”
Tony, still numb, pulls Peter in and grips him to his chest tightly. Stephen joins in, the two almost completely enveloping the boy. “Where’s your coat?” Stephen asks him on instinct. The one Peter’s wearing is obviously not his—Stephen pinpoints it to the fascinatingly tall blonde in the corner, to whom he nods gratefully. “Left it at home!” Peter chirps. “This was more important.”
“So, did you guys kiss, or what?” Dan demands.
Tony looks to his secretary, who is holding hands with the head of their international acquisitions department. “What the fuck, Jackson?” He asks tearfully. “What the fuck?”
“Did you kiss?” Percy insists. “Would you say your relationship is better than it was…six hours ago?”
“Who fucking cares?” Stephen bellows unexpectedly. Everyone, sans Tony and Peter, jolt. “Fuck, yes, we talked! We thought we were going to die!”
Mal squints at them. “Why?” She asks.
Tony stares at the young person, gobsmacked. “Did…did you really fucking think we couldn’t hear the fucking gunshots and explosions over the last couple hours?”
“...Oh,” Percy says. “Our bad.”
“Shit,” Bucky whispers.
Natasha winces.
“Wait, explosions?” Lee speaks for the first time.
Mal just gives an awkward thumbs up. “Speaking of! We should leave!” She says loudly. “In the next two minutes and fifteen seconds!”
“Mal, why is your backpack beeping?” Percy asks calmly.
“Two minutes and five seconds!” She says, smile fixed determinedly.
They book it into the elevator. They’d barely fit before, so now Percy is sitting on Bucky’s shoulders, Spencer and Bridgette on Lee’s, and Karl is supporting a gleeful Mal.
The elevator ride is silent.
They reach the lobby to find the doors busted open, the hostages outside in the courtyard, wrapped in shock blankets. The cops—oh, shit, the FBI, too—all swivel to see the eleven people standing on the front steps of the highrise.
The yelling starts almost immediately.
Loudest from Dan. “FUCK!” He roars. “Theo!”
Their heads all snap to the left as the armored grate covering the sublevel garage ramp opens. A massive truck rumbles down below and comes careering out of the entrance. Dan stands there, fury emanating from him. “YOU!” He screams at the driver.
For just a second, Theo stares out the window, and the truck screeches to a halt. “YOU!” He screams back. All previous plans seemingly abandoned, Theo throws the door open and jumps out of the truck.
There’s a sudden screech of tires.
A limousine hits him. Theo gets hit by a fucking limo.
Ross rolls down the window, flicking up his shades. It’s the middle of the night, so Ross just looks like an asshole. “Hey, Stephen.” He says casually.
“Hi, Ross,” Stephen says faintly.
Ross looks to Tony, who’s under Stephen’s arm. “Shit worked out with the hubby?”
“Yep,”
Ross nods.
Behind them, there’s an earsplitting boom, and glass rains down on them like snow. There’s a great plume of fire, and a devastating creak.
The entire Nakatomi tower crumbles right in front of them.
Well, in front of the FBI, police force, and hostages. Behind them, because the SWORD team and company like to look forward. They’re optimists like that.
Also, Mal’s backpack is missing.
The police chief is staring at them.
A long beat. “Merry Christmas,” Percy offers.
They wake up in a pile on the floor of the Tower common room.
Bucky blinks, rubbing his eyes. Percy and maybe Nat(?) are splayed across his back. He doesn’t attempt to get up, instead staring up at Stephen and Tony, who are looking down at them. Bucky’s not quite sure what the expression on their faces is.
“They’re still holding hands!” Ross bursts out.
“I hate you so much,” Tony whispers. “I hate all of you so fucking much.”
“Kiss!” Mal screams.
Stephen looks like he’s lost a piece of himself. He looks to his side at Tony, who seems to be considering building Ultron 2.0. Then, he pulls Tony in, cups his cheek, and kisses him.
Everyone starts screaming.
Bucky, smiling, lays face down on the floor. He makes no effort to move in the slightest. His work is done. He can rest now.
Natasha and Percy seem to have the same idea, but they're way ahead of him. He’s pretty sure Natasha is snoring. Percy is drooling.
Whatever. Bucky’s slept in worse places. As the yelling dies down, and Tony drags Stephen off somewhere (fucking finally) Mal draws her hood over her head and sighs dreamily, probably still thinking of bombs or something, as she drifts off. Dan and Spencer are back to back. Bridgette worms her way next to Ross, who sleeps spread-eagle, Peter on his other side. Lee sleeps on her back like Dracula, arms crossed over her chest.
Also, Karl is still here. Bucky’s not quite sure how that happened.
Notes:
57 fucking pages
bucky: i've killed so many people with this arm
percy, holding his hand: iVe kiLLeD sO mANy pEOplE wITh tHis aRM. bitchbucky and percy trying to puzzle out the timeline was literally me when i started writing this. it's been four years. what the fuck.
jorked it
‘dehydrate you with his mind until you die’ lmao
and yes, i watched hot frosty. unsure of my feelings, tbh. the knight before christmas for sure remains superior, though
percy being an undercover math talent...hilarious to me, tbh. like i know it varies by school and area, but in a lot of places, especially in nyc, a class specifically for pre-algebra is 8th grade math. percy was in 6th grade
bridgette is based on my friend, who, when we finished watching die hard, told me that she had no idea what the main plot was because she kept getting distracted by hans gruber
and yes, lee knew about bridgette's whole thing and thought it was fucking hilariousand for those who don't know, die hard is set in the late 80s, so fury being born in '43 isn't insane
peter: i love my two dads
peter:
peter, eyes narrowed: thats a lot of parental support...almost too much, one might sayspencer and lee do just stack sometimes. just for improved height. lee likes for him to see new things
karl: oh my god my brother hasn't been murdered and left to rot in some storage closet
lee: oh boy what a time for me to come out!lee normally being very chill but freaking tf out whenever she has to deal with family...telling
do i bring back percy in his little glasses yes or no
and do we keep karl, yes or no (different from evil child halloween carl)IRONSTRANGE!! FINALLY
merry christmas and happy holidays! i hope you're all having a wonderful end of the year.
plumbing baby. goodbye
Chapter 50: The Voices or whatever
Notes:
(See the end of the chapter for notes.)
Chapter Text
ethically sourced sluts:
vintage bi: how we doing?
antique gay: bad
antique gay: we doing bad
vintage bi: you need anything?
antique gay: i took my meds already
antique gay: so now im just kinda sitting on the floor with a blanket on
vintage bi: a classic
vintage bi: sorry you’re feeling shitty about The Voices or whatever
antique gay: appreciate it
our family tree is a wreath
pied piper: yeah i just dont think black tar heroin can solve this one
mcshizzle: are we 100% certain on that one though
framk: …well, no
mcshizzle: well there we go
horse girl: hmm
furby slayer: imagine having your whole memory wiped and then you gotta remember that you’re gay
furby slayer: the winter soldier having flashbacks to gay sex and not knowing why
furby slayer: oh gods i need to talk to james so bad
furby slayer: excuse me
blonde superman: sobbing what the fuck
pied piper: OHMY GOFD
centenarian, 30 ton hell puppy, toph from avatar = blended family
pb&j: hello the light of my life
Jamie <3: hi
pb&j: i have a very important question
pb&j: do you have a minute?
Jamie <3: always one for you
pb&j: gay
pb&j: so when you first started getting your memories back
pb&j: like the very beginning
pb&j: did you or did you not randomly get memories of you getting freaky with a man
pb&j: and then just have to take a breather in the middle of an assassination or whatever to figure out what the fuck that was about
Jamie <3:
Jamie <3:
ethically sourced sluts:
vintage bi: was that you?
antique gay: laughing my ass off?
antique gay: yes
antique gay: god i love my boyfriend
centenarian, 30 ton hell puppy, toph from avatar = blended family
jamie <3: i feel as if i shouldnt answer that
pb&j: THAT MEANS THE ANSWER IS YES
ross (NOT the one from friends) @rossBOOMni
‘you’re so funny’ thanks im not allowed to serve in the military
bridgette! @lavendarmenaced
Ross…
robert <3:
supreme overlord jackson: every single one of you are rewriting your reports. Every. Single. One.
[supreme overlord jackson is offline]
class traitor: waht the FUCK ross
certified monster fucker: what??? me??????
class traitor: i KNOW you wrote some stupid shit
certified monster fucker: oh like you didnt
egg: ok, so you BOTH did stupid shit
local milf: mal there is no way they did and you didn’t.
local milf: unbelievable
local milf: all three of you
thor understudy : kjære…
thor understudy: i read your report
local milf:
local milf: your betrayal should consume me with rage, but i just google translated that 🥺
skibidi ohio: i thought my report was good 🙁
thor understudy: yours just probably needed a bit of refinement. inexperience, not stupidity.
egg: WHO THE FUCK IS THAT
class traitor: …spencer????
skibidi ohio: hello!
certified monster fucker: oh god
certified monster fucker: how long have you been here
skibidi ohio: a while!
class traitor: dear god
class traitor: and…your name is skibidi ohio
skibidi ohio: mhmm
class traitor: i need a moment
class traitor: well…i know what i did, what did YOU guys do
certified monster fucker:
certified monster fucker: nuthin
class traitor: tell me or ill just get into the system and read the whole thing myself
certified monster fucker: i loathe you
class traitor: mehehe
certified monster fucker: [One Attatchment: It’s a screenshot of the PDF of Ross’s quarterly team report: ‘I have only one complaint about my colleagues. Last week, when I was speaking about my personal life, Mal Tanuk made some very hurtful comments. I would like her drawn and quartered, please and thank you.’ ]
egg: BRUH????
egg: WHAT THE FUCK DID I DO
certified monster fucker: you know.
egg:
egg: oh my god are you fucking kidding me
local milf: what happened?
egg: ross was showing me his new unhealthy situationship and said ‘i could change him’ or whatever
certified monster fucker: and then you said…
egg:
egg: ‘why? did he shit himself?’
class traitor: SOBBING
local milf: oh my god
egg: i thought it was hilarious
egg: same with this
egg: [One Attachment: Mal’s report:
‘I would like to submit a form about workplace hazards. I’m certain Spencer and Lee’s
crypt
lab is haunted, due to the consistent and unexplained chill that assaults me whenever I venture down there. I do not appreciate this. I would like to get HR involved for permission to do a seance.’
]
thor understudy: it’s not haunted you stupid piece of shit
skibidi ohio: it’s cold to keep lee’s morgue in good shape!
thor understudy: yeah dumbass
egg: whateva
egg: you’ll see the truth someday
egg: now someone else embarrass themselves
class traitor: a captain is always willing to go down with his ship
class traitor: [One Attachment: Dan’s report:
‘I would like it to be enforced that Ross Bunmi eat lunch somewhere else. For the past two weeks, daily, he's taken his lunch break while standing over my desk. Normally, this would not be a problem. However, every single day since this has begun, his lunch has been a slab of chicken and a tupperware full of ‘purple’. I am not sure what this is, but it bothers me immensely. It’s just a tupperware full of some purple of unknown consistency. It’s lowering my work ethic.’ ]
certified monster fucker: purble
class traitor: IM GOING TO KILL YOU WITH A GUN
egg: …bridgette?
local milf: …yes?
egg: send the report.
local milf:
local milf:
local milf: class traitor: [One Attachment: Bridgette’s report:
‘Though I am an ally, as a lesbian, I do find it a bit off-putting when I see Commander Jackson and the Sergeant. Where is the woman? It is odd to me to see romance that is not woman-centric. It doesn’t sit right with me.’
Then, a ten-step plan to move past this issue is laid out. ]
egg:
certified monster fucker:
class traitor:
local milf: listen…
trusted with scalpels
doc mcstuffins: do i need to send mine???
doogie howser, i guess: no
doogie howser, i guess: just stay silent
doogie howser, i guess: they get worked up enough with each other that they just forget about us
doc mcstuffins: thank god
doogie howser, i guess: pretty much
doogie howser, i guess: because there’s no way in hell im sending mine
doc mcstuffins: does it
doc mcstuffins: does it perhaps have the
doogie howser, i guess: the time i had to hold bridgette back from attacking you after you pronounced dulce de leche as ‘doosh da loosh’? yes, yes it does.
doc mcstuffins: 😞
drinking groundwater is good for the soul
teletublees: they’re fixing them
pj masks: …
teletublees: yes, mine is still the same, and, yes, all the drama and gossip you’ve missed is in there
teletublees: i know who you are
pj masks: thank you
teletublees: yep
scientists hate this local new yorker @jbarnes
in a top/top trad husband relationship. every day my partner and i both get home at six, throw our briefcases on the couch, pour ourselves each a drink, light a cigarette, and silently brood about our relationship with our fathers. we have not eaten dinner in two years.
You Know Who I Am @TonyStark
where do you even come up with half this shit?
You Know Who I Am @TonyStark
i know this isn’t true, he made you both galinhada literally two days ago
You Know Who I Am @TonyStark
and he gave me a bowl to taste-test. it fucked hard
scientists hate this local new yorker @jbarnes
im so funny. all of you adore me
james @jimmyjammy
i have something inappropriate to ask
scientists hate this local new yorker @jbarnes
go ahead, fellow james
james @jimmyjammy
in a top-top trad husband dynamic…who…y'know
scientists hate this local new yorker @jbarnes
well, we’ve already established that i was lying on the internet…so…i guess we’ll never know, actually
james @jimmyjammy
woah…top ten questions scientists still can't answer
james @jimmyjammy
…i have another inappropriate question
scientists hate this local new yorker @jbarnes
yes?
james @jimmyjammy
i think you know what it is, sergeant barnes
scientists hate this local new yorker @jbarnes
i see
scientists hate this local new yorker @jbarnes
the answer is missionary so we can continue our argument from before
james @jimmyjammy
i'm so obsessed with you
centenarian, 30 ton hell puppy, toph from avatar = blended family
pb&j: doggystyle so you can watch the powerpoint presentation i made outlining why you’re wrong
james <3: im crazy in love with you
Notes:
dare i say...denimbeans consistently active era once more??
got paid five dollars to put skibidi ohio in here btw (spencer is from right outside of columbus)
btw when ross, genius prodigy psychologist and profiler says 'i could fix him' he means it. he's putting this man through operant conditioning. he's changing him down to his core sense of self
mal wants to do a seance so bad guys, she already bought ghost-hunting gear
i have no comment on the entire bucky on twitter bit. i feel as if i've made myself pretty clear on that one
and yes it is canon here that the winter soldier would sometimes get a random memory of him having gay sex and would just have to stop and be like ???????
plumbing baby. goodbye
Chapter 51: S.T.A.R.K.
Notes:
(See the end of the chapter for notes.)
Chapter Text
mal(practice) @mothmanass
big fan of whatever barnes and his bf have going on
annlis @anli
would you care to elaborate
mal(practice) @mothmanass
boy would i!
scientists hate this local new yorker @jbarnes
Stop
mal(practice) @mothmanass
i will not
mal(practice) @mothmanass
so barnes had gotten a loving tap on the head (slight concussion)
scientists hate this local new yorker @jbarnes
mal i will kill you with a gun
mal(practice) @mothmanass
and he was gonna go talk to his boyfriend
mal(practice) @mothmanass
and so he was calling for him trying to find him
mal(practice) @mothmanass
but because of his concussion
mal(practice) @mothmanass
he was like, SCREAMING
scientists hate this local new yorker @jbarnes
mal…
mal(practice) @mothmanass
and his boyfriend pokes his head out of the room he was in and goes ‘you must be talking to me like that with your left mind because it sure as FUCK aint the right one you’re yelling at me with’
scientists hate this local new yorker @jbarnes
STOP I FELT SO BAD
bearbi @bearbi3
IM MPISSING MYSLEF WHATY
Ferris wheel fighter @ihatecarnivals
NATIVE NEWYAWKER RIGHT THERE!!! REPPING US WELL
mal(practice) @mothmanass
and THEN my friend (medical degree) was like ‘he has a concussion i dont think he knows hes yelling’
mal(practice) @mothmanass
and then the BOYFRIEND felt really bad
scientists hate this local new yorker @jbarnes
:(
james @jimmyjammy
…did everything turn out ok?
scientists hate this local new yorker @jbarnes
yes we each came home to surprise one another with flowers and ice cream because we both felt bad :/ so we were just standing opposite ends of the hallway like dumbasses
ross (NOT the one from friends) @rossBOOMni
mal(practice) @mothmanass
thank you ross
SSEA
the 𝓰𝓲𝓷𝓰𝓮𝓻: hey tony :)
Tony Stank: yes nat :)
the 𝓰𝓲𝓷𝓰𝓮𝓻: when were you gonna tell us about stark :)
gitc: do we not know about that miss black widow?
percenary: nat it says stark on the side of the big tower (or so im told)! hope this helps ❤️
the 𝓰𝓲𝓷𝓰𝓮𝓻: i despise you
percenary: liar
the 𝓰𝓲𝓷𝓰𝓮𝓻:
percenary: xoxo
mindinna: wait so what do you mean??
Tony Stank: the education program?
the 𝓰𝓲𝓷𝓰𝓮𝓻: YES
Tony Stank: oh
Tony Stank: hehe
Tony Stank: its actually called S.T.A.R.K.
Tony Stank: (percy do the thing)
percenary: hope this helps ❤️
the 𝓰𝓲𝓷𝓰𝓮𝓻: crashing out, killing all of you, going back to russia
skrunkly raccoon: i also do not know what you’re talking about
the 𝓰𝓲𝓷𝓰𝓮𝓻: tell them what it stands for tony
Tony Stank: it's a free program that parents can enroll their kids in for tutoring or daycare
the 𝓰𝓲𝓷𝓰𝓮𝓻: TELL THEM WHAT IT STANDS FOR
Tony Stank: science technology arithmetic reading and karate :)
Tony Stank: the necessities for an education
skrunkly raccoon: YOU ARE TEACHING CHILDREN KARATE???????
skrunkly raccoon: you said DAYCARE
skrunkly raccoon: YOU ARE TEACHING TODDLERS KARATE
Tony Stank: not me personally
baby avenger: i was SO born in the wrong era…could have learned karate from tony stark…
Tony Stank: i would like to clarify i do not personally do karate
Tony Stank: karate and a 200 pound suit dont really mix well, i fear
Tony Stank: did teach a kid to build a bomb though
the 𝓰𝓲𝓷𝓰𝓮𝓻: oh my god you are such a threat to national security
baby avenger: sobbing how am i going to learn karate now
percenary: @skrunklyraccoon
baby avenger: MR BARNES DO YOU KNOW KARATE
skrunkly raccoon: yes
[gitc has changed skrunkly raccoon’s username to ‘Mr. Miyagi’]
baby avenger: HOLD ON IM COMING TO FIND YOU
Mr. Miyagi: im scared now
Tony Stank: probably for the best
our family tree is a wreath
furby slayer: im so angry right now
pied piper: how unusual
sparky: babe please do not make this worse i value my plumbing
pied piper: you’re not with him??
sparky: he has range
horse girl: what’s wrong percy?
furby slayer: so recently
furby slayer: one of those fucking kids peter calls his friends introduced james to ‘booktok’
pied piper: OH NO
my chemical ron weasley: NOOOOO
mcshizzle: NOT who i expected to react to that ngl
furby slayer: and now
furby slayer: whenever jamie has a book there’s a 50/50 chance it’s what he typically reads, or its the most unholy thing ever created
furby slayer: might be some wonderful poetry or a straight couple having the worst sex ive ever heard of
furby slayer: and now he’s got WADE involved and they have a book club
pied piper: you have my sympathies but why is this your problem
horse girl:
horse girl: percy does bucky still like reading aloud
furby slayer: YES
sparky: oh my god
furby slayer: AND I NEVER KNOW WHAT I’M IN FOR
furby slayer: WORSE THAN PHINEAS AND THE GORGON BLOOD
framk: please do not compare those two
framk: at least the scales were tipped in your favor with the gorgons blood
RARA: If it bothers you, just tell him to stop.
furby slayer: I CANT
furby slayer: THATS THE WORST PART
furby slayer: HE THINKS THEYRE SO FUCKING FUNNY AND HE LAUGHS SO HARD WHEN HE READS THEM
sparky: …
furby slayer: I LOVE HIS LAUGH SO MUCH HE IS THE LIGHT OF MY LIFE
furby slayer: BUT I CAN'T WITH THIS ENEMIES TO LOVERS BULLSHIT
furby slayer: LIKE WHAT DO YOU MEAN???’ ohhhh hes so mean to me….but so hot :(‘ STAND UP
furby slayer: WHERE IS YOUR RAGE??? WHERE IS YOUR ANGER??? IF YOU HATE SOMEONE AND THINK THEY'RE HOT YOU DO NOT HATE THEM ENOUGH
furby slayer: I CAN'T SEE AND I KNOW ALL MY ENEMIES ARE HIDEOUS BECAUSE I FEEL IT IN MY BONES
furby slayer: AMATEUR HATING
pied piper: oh my god you are literally so insane
pied piper: correct though! someone does something i dislike and they instantly shrivel before me into an ugly hag!
sparky: jesus christ
furby slayer: not in these fucking books he isnt
areyoushuriaboutthat: how is your paranoia doing old man
Bucky: i always responds appropriately to happenings and situations (toaster went off and i punched a hole in the dishwasher)
areyoushuriaboutthat: nice
Bucky: tony thought so too
Bucky: hows wakanda?
areyoushuriaboutthat: fine
areyoushuriaboutthat: thinking about breaching containment
Bucky: oh?
areyoushuriaboutthat: idk maybe ill come terrorize you or something 😼
Bucky: as long as you give me a heads up im ok with it
Bucky: i say this only because i imagine you are less dense than a dishwasher
areyoushuriaboutthat: unfortunately at the moment, yeah, but im working on it
Bucky: fascinating
Bucky: percy and i have a spare room
Bucky: hes cool with you taking it
Bucky: as long as you pass the dog vibe check
areyoushuriaboutthat: putting aside my vague terror of that man because theres a DOG??
Bucky: yes
Bucky: big
Bucky: [Attachment:
A picture of Lea sitting in a chair at the kitchen counter, a pastel blue handkerchief around her neck
]
areyoushuriaboutthat: oh my god….big…amazing…
Bucky: she can drive
areyoushuriaboutthat: im enthralled.
Notes:
percy is full of so much rage i love him so much
peter taught him to do the 'hope this helps ❤️ ' btw and he thinks its hilariousthe S.T.A.R.K. idea is from social-justice-waterbender on tumblr(? bootlegged on pintrest, naturally)
bucky barnes would be into booktok. specifically the insanely shitty 'dark romance' or supernatural ones. he's sitting there giggling snickering having the time of his life. but little does he know...he IS the assassin mafia boss to percy's sweet innocent baker or whatever. marvel comics hire me.
shuri :)
plumbing baby. goodbye
Chapter 52: gorilla
Notes:
(See the end of the chapter for notes.)
Chapter Text
bucky’s victims and also percy’s bimbos
president lincoln: one hundred men vs one gorilla
moonmoon: many such cases
president lincoln: what
president lincoln: why do you always do this
president lincoln: now i dont want to finish the scenario
moonmoon: hehe
murphy’s law: its ok abe im listening
president lincoln: thank you charles
president lincoln: 100 men vs. 1 gorilla. Physical fight. Who would win?
avril lavigne: i dont like you learned to capitalize for this question
The News(™): also this is a dumb question
The News(™): the answer is so fucking obvious
nedleedle: yeah im sorry but this isnt a debate
moonmoon: the scales are clearly tipped
nedleedle: yeah in favor of the gorilla
The News(™): for the people obviously
The News(™): what.
avril lavigne: oh my god what
avril lavigne: clearly gorilla
murphy’s law: no??? theres a hundred people???
president lincoln: gorilla strong though
The News(™): you know who else is strong?? Peter
The News(™): and i watched him roll down a flight of stairs after slipping on a french fry today
The News(™): i would not bet on him against a hundred people
tungsten dioxide whats this: ouch
The News(™): sorry peter
moonmoon: yeah but like
moonmoon: bucky is also strong
moonmoon: i think he could beat a hundred people
president lincoln: interesting…
president lincoln: so you think the level of the gorilla’s training matters?
tungsten dioxide whats this: hey can we stop comparing me to a gorilla
Scary Captain: this is the stupidest argument ever.
Scary Captain: gorilla.
murphy’s law: oh my god mj no
Scary Captain: don’t argue with me on this. gorilla.
The News(™): im so sorry mj but i absolutely will argue about this
The News(™): you know what
The News(™): @terminator
moonmoon: no fucking way betty
The News(™): @terminator
avril lavigne: jesus christ
The News(™): @terminator
The News(™): @terminator
terminator: Oh my god what
The News(™): do you think 100 men could beat a gorilla
terminator: …
terminator: you know what?
terminator: one second.
terminator: ill get back to you with an official opinion
chappel roan fans here to attack people
[bucky has changed the group name to ‘100 men v 1 gorilla?]
Tony: unbelievable.
natasha: what the fuck
natasha: 100 men obviously
mj: i just felt a physical pain in my chest.
dan: is this just in the woods somewhere?
webs: abe says yes
mal: is the gorilla armed?
webs: abe says nobody is
mal: oh shit
mal: gorilla obviously
bridgette: im not too sure
spencer: gorilla, maybe? they’re very tough and strong
ross: do the people have planning time?
webs: im just going to give the phone to abe, so just know whatever comes next is not from me
webs: the humans get five minutes in a sealed chamber. they can’t see where they’ll be dropped. the gorilla knows the land decently well
Tony: wait, were the humans randomly drafted? did they know this was going to happen? did they sign up for this??
webs: random sample of people. they get a piece of paper that tells them what’s about to happen, and then the five minutes begins
Tony: i’d like to say humans, but the answer may be gorilla
Tony: 100 strangers trying to plan a cohesive attack in five minutes? they’ll crumble
natasha: okay but the gorilla would get tired eventually
Tony: it’ll only really take one good hit to take a person out though
Tony: i think a gorilla has 100 good hits in it
lee: i would not get near the gorilla
dan: really?? i did not expect this from you
mal: didnt you used to fight polar bears for fun
lee: no, they are endangered.
lee: wolves were fair game though
ned: wolves are okay but you wouldn’t even approach a gorilla??? you’re like twice the height of one
bridgette: babe what
lee: what if the gorilla threw its poop at me
mal: I DIDNT EVEN THINK ABOUT THAT
wade: i would throw mine back!
lee: you conjure a beautiful world
Tony: oh my god i forgot you were here
bucky’s victims and also percy’s bimbos
terminator: official opinion: there is none
terminator: they’re talking about the logistics of defensive pooping now
moonmoon: oh :/
YES we have very strong opinions about colors and NO we dont all know each other
“blue”: do NOT check that groupchat you got put in a while ago
“red” oh i left that thing ages ago
“blue” thank god
Bblimm @blooo
mr sergeant barnes do you like men
scientists hate this local new yorker @jbarnes
man is a hopeless creature. I don't like much of anyone
scientists hate this local new yorker @jbarnes
oh if you meant sexually then yes
scientists hate this local new yorker @jbarnes
how am i still answering this question?
You Know Who I Am @TonyStark
jesus christ edgelord alert
spidey @spidey-official
what??? happened???
scientists hate this local new yorker @jbarnes
percy wont go to barnes and noble to look for quan millz books with me
You Know Who I Am @TonyStark
giving you freedom was a mistake!
robert <3
mal: if i had a penis i would use it to sniff our various treasures such as. metal coins in the sand. rare and elusive truffles. Etc
supreme overlord jackson: DO YOUR JOB
our family tree is a wreath
pied piper: PERCY JACKSON
pied piper: WHO TAUGHT YOU HOW TO DO THAT
furby slayer: huh
pied piper: YOU RETWEETED SOMETHING???
furby slayer: oh yeah
furby slayer: when lee gets overstimulated in the labs i give her my phone and she reads tweets out loud to me in a little voice
mcshizzle: no way you’re ipad baby parenting your employees
furby slayer: say that to lee’s face i dare you
framk: you got a stepstool for him to do that?
pied piper: GOT HIS ASS LMAO
mcshizzle: eat shit!!
sparky: wait what did he retweet
furby slayer: i was just speaking my truth
pied piper: [Image Attatchment:
kelp face @localcryptid retweeted:
IDGAF who shot JFK #MoveOn ]
framk: no fucking way
furby slayer: what about that statement confuses you
my chemical ron weasley: jesus christ
my chemical ron weasley: oh also btw if you guys hear will screaming dont worry about it
horse girl: hm
pied piper: what did bro do!!!🔥🔥
my chemical ron weasley: he’s training a few campers as field medics
my chemical ron weasley: there was an accident at a the forge and a camper got a chest wound
my chemical ron weasley: trainee blurted out that she was gonna be breathing ‘mad crisp’
my chemical ron weasley: and thats how we all found out together that her lung had been punctured
my chemical ron weasley: shes totally fine but jesus christ
pied piper: IM CRYINF
nick fury @12yearoldterrorist
area 51 has penis walking around
You Know Who I Am @TonyStark
YOU
Notes:
had to weigh in on the gorilla debate im sorry
im firmly on the side of the gorilla for one reason: have you ever seen a group of FIVE men try and plan something?? its awful. 100 unfamiliar men in five minutes? they're not getting ANYTHING done
any other circumstance the humans would win but...100 random men? absolutely noti also had to but quan millz books in here im sorry for that too
we've just already established bucky is on booktok...he IS on his way to pick up a copy of 'this hoe got roaches in her crib'mal's truffle statement is totally stolen from a tumblr post but i cannot find it for the life of me holy shit i swear i didnt come up with something like that
lee sitting in a spinny chair in percy's office: IDGAF who shot JFK #MoveOn
percy: hah...i like that one! share it with the people, squiretaking suggestions and interpretations as to what the little voice sounds like btw
plumbing baby. goodbye
Chapter 53: not funny!! didnt laugh!! guards, use the drone strike
Notes:
(See the end of the chapter for notes.)
Chapter Text
scientists hate this local new yorker @jbarnes
call my mans thighs misinformation the way i'm spreading them
scientists hate this local new yorker @jbarnes
manspreading because, you guessed it, i'm spreading my man
scientists hate this local new yorker @jbarnes
my mans thighs called excel because i am spreading them on the sheets
You Know Who I Am @TonyStark
Please shut the fuck up
Black Widow, Baby @NatashaR
have i ever told you how much i hate you? because it's a lot.
scientists hate this local new yorker @jbarnes
what did i do??
Black Widow, Baby @NatashaR
are you fucking kidding me?
SHIELD breakroom coffee maker survivors
nasha: percy
packson: hello
nasha: can you please check twitter
packson: cannot
packson: so many buttons nasha
nasha: that is literally the worst shortening of natasha ive ever heard why are you both like this
packson: both ?
nasha: youd understand if you were on twitter
nasha: god i cant suffer through this alone
nasha: where are you
nasha: im reading this to you
packson: yeah alright
packson: im in the pool
nasha: im not getting in
packson: well im not getting out
packson: its salt water :)
nasha: i will sit by the poolside and read loud
packson: deal
robert <3
class traitor: lee where are you
thor understudy: mcdonalds
class traitor: you hate mcdonalds?
thor understudy: dislike clown
thor understudy: but brother has never had big mac
thor understudy: big part of american culture according to my research
egg: research?
thor understudy: spencer
skibidi ohio: me!
monster fucker: wait wait wait
monster fucker: brother?
thor understudy: karl
monster fucker:
egg:
class traitor:
egg: wait
thor understudy: yeah?
monster fucker: huh
thor understudy: my brother that i have always had
class traitor: ???
thor understudy: my brother that i have always had that you have all met
skibidi ohio: wh
skibidi ohio: hm
thor understudy: my brother karl
egg: where has he been
thor understudy: i dont know what you mean
egg: i
thor understudy: jackson
monster fucker: he’s not gonna respond unless you @ him
supreme overlord jackson: yes?
monster fucker: okay.
thor understudy: can i take an extra hour off for lunch
supreme overlord jackson: yes
class traitor: FAVORITISM?????
class traitor: you always interrogate us about our workload!!
supreme overlord jackson: your hobbies include forgetting tasks and procrastinating responsibilities
supreme overlord jackson: lee’s hobbies are bugs and lab
supreme overlord jackson: enjoy your time with your brother, lee
thor understudy: :)
SSEA
the 𝓰𝓲𝓷𝓰𝓮𝓻: percy just leapt out of the pool and started running into the stairwell
the 𝓰𝓲𝓷𝓰𝓮𝓻: i think he hopped over the rails for speed
Tony Stank: what the fuck?
gitc: why??
Mr. Miyagi: percy????
baby avenger:
I SEE HIM
baby avenger:
IM SUITED UP AND IM FOLLOWING HIM
baby avenger: HE'S SO FAST
Tony Stank: he’s outside??
mindiana jones: what the hell
Mr. Miyagi: im getting worried now
Mr. Miyagi: peter if he starts veering towards hells kitchen and you see daredevil running towards him you have my full permission to do everything in your power to tranq him
baby avenger: YESSIR 🫡
the 𝓰𝓲𝓷𝓰𝓮𝓻: you're dating such a fascinating creature, bucky
Mr. Miyagi: part of me wants to argue but i really cant
Mr. Miyagi: ive genuinely never seen this behavior from him
Tony Stank: i feel like reinforcements are in need
Mr. Miyagi: hmmm
Mr. Miyagi: one second
[Mr. Miyagi has added Clarisse La Rue to the chat ]
Mr. Miyagi: any explanations?
Clarisse La Rue: calm the fuck down and let me backread
baby avenger: [Video attachment: Percy has made it into the middle of a deserted park. Riptide is in his hand, and he, unflinchingly, is running at a large, half-bull half-man creature that stands in the center of the sand pit ]
Clarisse La Rue: oh
Clarisse La Rue: he’s just chasing down the minotaur again, don’t worry about it.
the 𝓰𝓲𝓷𝓰𝓮𝓻: im sorry?
Clarisse La Rue: he hates that fucking thing, always stays ready to clock it
Clarisse La Rue: it chased him down on his way to camp when he was twelve, and he murdered it with his bare hands on top of the hill. like half the camp was watching
Clarisse La Rue: i know he can’t read so you better not tell him this, but it was pretty fucking sick. he was such a rageful preteen
Mr. Miyagi: my boyfriend can fucking read clarisse
Clarisse La Rue: he’s been telling me he can’t since he was four feet tall
Clarisse La Rue: not buying into your clickbait
baby avenger: he’s biting the minotaur
Clarisse La Rue: not surprised
Clarisse La Rue: again, his hatred for this thing is legendary
Clarisse La Rue: first monster he killed when he knew he was a demigod, first monster he killed in the battle of manhattan, first monster he killed after he lost his vision
Clarisse La Rue: i swear he can just sniff it out at this point
[Clarisse La Rue has left the chat ]
the 𝓰𝓲𝓷𝓰𝓮𝓻: huh.
the 𝓰𝓲𝓷𝓰𝓮𝓻: so he was pretty much always like that, then?
Tony Stank: i refuse to believe percy was ever four feet tall
Mr. Miyagi: what, cause you still are?
Tony Stank: sending a drone strike to your location
Mr. Miyagi: WAIT NO
the 𝓰𝓲𝓷𝓰𝓮𝓻: he actually just did it i saw him press the button
the 𝓰𝓲𝓷𝓰𝓮𝓻: now barnes is running too wow
the 𝓰𝓲𝓷𝓰𝓮𝓻: damn tony i didn't know height jokes bothered you like that
Tony Stank: oh they don't
Tony Stank: im the smartest man in america who gives a shit if im not six feet tall
Tony Stank: i just wanted to try out my new drone strike button
the 𝓰𝓲𝓷𝓰𝓮𝓻: wow
Tony Stank: plus its super convenient because my boyfriend is like half a foot taller so he can state judgmentally at people over my head
the 𝓰𝓲𝓷𝓰𝓮𝓻: you know, theres a name for your kind
Tony Stank: WOAH???
our family tree is a wreath
pied piper: percy your boyfriend is thirst tweeting about you again
mcshizzle: you follow him??
pied piper: you dont?? quality stuff right here
pied piper: never thought war hero james buchanan barnes would be a shitposter but ill take it
furby slayer: yeah i know natasha read them to me while throwing stuff in the pool for me to bring back to her
horse girl: oh
furby slayer: we have fun
pied piper: ok the black widow stole my thunder but its the BLACK WIDOW so ill let it slide
pied piper: anyway i just wanted to ask you your thoughts on his work
furby slayer: he’s an annoying slut and i love him
RARA: Lovely.
sparky: true love right there
sparky: brings a tear to my eye
pied piper: i dont see why you wont learn to use twitter so you can return his energy
furby slayer: i keep telling people, way too many buttons
sparky: ive seen you drive
furby slayer: i havent
mcshizzle: HA
furby slayer: 🥰
pied piper: but then how does he know your feelings about him
furby slayer: well usually he gets reminded when i blow him
[furby slayer has deleted a message]
pied piper: WHAT
pied piper: WHAT THE FUCK
pied piper: I SAW THAT
horse girl: piper?
framk: sorry what are you talking about
framk: i was yelling at the senate
furby slayer: so proud
furby slayer: no clue what pipers talking about though
pied piper: PERSEUS JACKSON I HATE YOU
furby slayer: 🙁
sparky: thats a bit harsh, babe
RARA: Uncalled for.
pied piper: ADFHFDHTEBRW!!! FYUCK YOUDGBRQBGV
furby slayer: odd
Notes:
credit for bucky's thirst tweets goes to tumblr user bulletproofheartmp3
RETURN OF KARL
you guys said you wanted to keep him so here he isalso ironstrange canon, also from the christmas special
percy is the ultimate gaslighter im not sorry
yeah nat oficially doesnt know about demigods or monsters rn in the file official timeline…just ignore it
i saw the tags of this fic while i was updating it... 'attempt at humor'. i was really nervous when i first posted this because id never written anything like it, but now im confident and secure in the fact that im literally the funniest bitch alive (hubris) so should i take it out orrr
plumbing baby. goodbye
Chapter 54: hotdog
Notes:
(See the end of the chapter for notes.)
Chapter Text
SSEA
Mr. Miyagi: i have news
baby avenger: omg are you about to come out
Mr. Miyagi: wh
Mr. Miyagi: peter
baby avenger: sorry automatic response
gitc: dont worry bro, we’re gonna find your meds 🙏just keep holding on
baby avenger: you’re the worst!!
gitc: 😛
Tony Stank: i hate children
percenary: you have like 5
Tony Stank: so?
Tony Stank: that doesn't always stop people #howardstark #followinginhisfootsteps
Mr. Miyagi: oh my god??
the 𝓰𝓲𝓷𝓰𝓮𝓻: tony…
percenary: real tbh
Mr. Miyagi: PERCY
percenary: what??
percenary: my uncle literally turned his own daughter into a tree idk what you want from me
Mr. Miyagi: sigh
percenary: i love our daughter though so dont worry
the 𝓰𝓲𝓷𝓰𝓮𝓻: your daughter is a 200 lb mastiff that chews holes in tires when left unattended
percenary: just some of her many positive traits
mindiana jones: bucky, what did you have to share?
Mr. Miyagi: thank you, mj, the only one here i respect
percenary: hello???
Mr. Miyagi: i don’t respect you, im in love with you. mutually exclusive
Tony Stank: uhm
the 𝓰𝓲𝓷𝓰𝓮𝓻: oh…thats not…
percenary: no thats fair actually 😞
Mr. Miyagi: like im obsessed with you to a dangerous degree but also ive seen you explode watermelons in fear. so
Mr. Miyagi: so anyway
Mr. Miyagi: shuri wants to come visit
Tony Stank: is that the genius shithead from wakanda
Mr. Miyagi: yes
Tony Stank: ok yeah she’s cool enough to come to the tower
Tony Stank: she has a room if she wants to stay here
the 𝓰𝓲𝓷𝓰𝓮𝓻: there’s a coolness standard?
Tony Stank: absolutely there is
Tony Stank: barnes barely made it, by the way
Tony Stank: his only bonus at the time was killing nazis
the 𝓰𝓲𝓷𝓰𝓮𝓻: at the time?
the 𝓰𝓲𝓷𝓰𝓮𝓻: so his coolness factor has increased since he arrived?
Tony Stank: yes, he’s dating percy now
baby avenger: percy is very cool
mindiana jones: i can't argue there
Tony Stank: i meant more the fact that when they started dating Barnes was no longer sad, gay, AND single
Tony Stank: you can only be two of those things
percenary: fascinating
Bucky and areyoushuriaboutthat
Bucky: tony said you can stay at the tower if you want
areyoushuriaboutthat: CAN I BE FRIENDS WITH HIS AI
Bucky: you can certainly try
Bucky: she’s very friendly
areyoushuriaboutthat: YES!!!
areyoushuriaboutthat:
areyoushuriaboutthat: is your boyfriend going to be there
Bucky: is my boyfriend going to be at the place he lives? Yes
areyoushuriaboutthat: nnnhnfndbsbg
Bucky: he will not bite you
areyoushuriaboutthat: he seems like a biter
Bucky: no he definitely is a biter
Bucky: he just won't bite YOU
areyoushuriaboutthat: hmmm
Bucky: i have bite marks because i let him chew on me like a rawhide toy
Bucky: you will be fine
areyoushuriaboutthat: freak 🫵
Bucky: yes!
areyoushuriaboutthat: ugh whatever i'll see you like tomorrow
Bucky: hehehe yess
Bucky: you’ll love new york
areyoushuriaboutthat: do you think it’s cooler than wakanda
Bucky:
Bucky: okay well
Bucky: wakanda is undeniably amazing
Bucky: and it means a lot to me
Bucky: but my life is in new york right now, you know?
Bucky: and i like hot dogs
areyoushuriaboutthat: yeah you do.
Bucky: OKAY
Van Keppels
Leopold: my boss just mentioned that he appreciates how much i stay out of the office drama and shenanigans. i have no idea what he was talking about
Karles: Then I suppose you are doing a fantastic job!
Karles: I found a beetle on the sidewalk. Would you like to see it?
Leopold: call me.
Avengers Watch @avengerswatchofficial
Bucky Barnes spotted at Delmar’s Deli in Queens!
[Image Attachment: Bucky is standing in a deli on his phone. He’s wearing a white shirt that says I’M THE CHEETAH THAT IS THREATENING TO GO CRAZY]
annlis @anli
Ohhhh he looks hot
james @jimmyjammy
gnawing at the bars of my enclosure
mimi @wheresmybeans
hes so cutie but WHAT is that shirt
bearbi @bearbi3
@spidey-official @jbarnes @TonyStark @NatashaR ????
Black Widow, Baby @NatashaR
It’s part of a matching set.
Black Widow, Baby @NatashaR
[Image Attachment: Though his face isn’t visible, it’s clearly Bucky’s mysterious boyfriend, wearing a sweater over a white shirt that says I’M THE DOG THEY PUT WITH CHEETAHS TO KEEP THEM FROM GOING CRAZY IN CAPTIVITY]
iron man <3 @starkswife
oh my god.
You Know Who I Am @TonyStark
I have crazy garlic fingers from peeling and chopping garlic cloves yesterday. This phenomenon is always fascinating to me because it reminds me that I, too, am made of meat, and therefore I am susceptible to being seasoned.
scientists hate this local new yorker @jbarnes
so how are those meds working?
You Know Who I Am @TonyStark
Pretty good, i’d say
scientists hate this local new yorker @jbarnes
wonderful
SSEA
percenary: so, the WSC building is trying to do a phone ban while in session
percenary: and i usually attend the meetings where they announce this sort of stuff, but since i was busy, the whole team went instead
Tony Stank: oh my god
Tony Stank: what did they do??
percenary: [Video Attachment: The SWORD team is sitting in the back of a large conference room. There’s a projector with a slideshow, detailing the limits and rules of the proposed cellphone ban.
Mal raises a hand. “Will I be permitted to send smoke signals instead?”
The man presenting—his nametag reads Jake— blinks. “Uh, I don’t think open flames are permitted on WSC grounds. So…no.”
Mal sighs heavily.
A few seats down, Bridgette raises her hand. “What about carrier pigeons?”
“Uhm, is it a service animal?”
“...No.”
“Non-service animals aren’t allowed on WSC grounds either.” Jake tells her.
Spencer raises his hand. “What if I know somebody who has a service animal of suspicious intelligence? Could this hypothetical legally registered service animal carry messages for me?”
Jake splutters. “I—I suppose? Well—we can’t have an animal loose in the building, they’re required to stay with their handlers—”
Ross cuts him off. “Let’s say I am caught with my cellphone during a session, and so am required to surrender my cellphone at the start of the following session. If I go home and replace every single component in the phone with a replacement, is it still the same phone? How does the WSC plan to address this Grecian philosophical dilemma?”
Jake is stunned silent. “Well, we—” He looks at the slide, then as Ross. “We wouldn’t confiscate your phone, uh, that’s—that’s a security breach, and also seizure of personal property. Nowhere on the slide does it say that we’d, uh, do that—” He looks at the slide again.
Next to her, a furrow in his brow, Lee raises a hand. “Would I be permitted to use a Cobra PX650 Pro Business 2W 6-Pack FRS 2-Way Radio with Charging Port to send messages in morse code while we are in session?”
Jake swallowed. “I—That’s not a cell phone? So, well, it’s—” He stops for a second and stares at the slide blankly. “I…”
Dan looks up from his phone. “Would banning cell phones cause Verizon’s stock price to drop? Would you recommend diverting from the company before the ban goes into effect?”
Jake stares at Dan. Dan does not stare back, because he is playing on his phone. Jake slowly folds up his slideshow pointer and puts it in the pocket of his coat. He turns off the projector and walks out of the conference room, shutting the door and turning off the lights behind him. The entire assembled group of WSC members and employees sits, stunned. SWORD gets up and files out of the room, illuminated only by the glow of Dan’s Flappy Bird game.
“Thank God,” Ross is heard saying to Mal as they leave. “I have an eyebrow threading booked in an hour. I was hoping this wouldn’t go too long.”]
the 𝓰𝓲𝓷𝓰𝓮𝓻: now where was this energy during SHIELD
Tony Stank: every day i wake up and remember these people are at the highest level of national security clearance and start crying
trusted with scalpels
doc mcstuffins: idk if i'm actually a guy but we have a autopsy due at 9 am tomorrow so tbh i can't really worry about that right now
doogie howser, i guess: SPENCER????
Notes:
percy and bucky are both losers. friendly reminder
tony does have a spreadsheet that keeps track of how cool everyone is, and there ARE rigid standards, as well as a list of things that can add and subtract from your score. last time he let losers into the tower, the og avengers happened and he's not gonna let that slide again\
karl and lee :)
OKAY SO FUNNY STORY the SWORD team is...sort of all based off people i know in real life, and the person i based spencer off of just came out and is transitioning. so because its pride month and im a #ally spencer is now also not cisgender. enjoy this subplot
credits: tony's tweet about the garlic is a mimic of a post by tumblr user darrellenjoyer and the cell phone bit is based off a reddit post i saw about student responses to a high school cell phone ban
plumbing baby. goodbye
Pages Navigation
Desire (falling_bones) on Chapter 4 Mon 27 Mar 2023 11:15PM UTC
Comment Actions
Duchess_of_Alsace_and_Lorraine on Chapter 4 Wed 05 Jul 2023 10:15AM UTC
Comment Actions
denimbeans on Chapter 4 Wed 05 Jul 2023 03:44PM UTC
Comment Actions
Duchess_of_Alsace_and_Lorraine on Chapter 4 Wed 05 Jul 2023 03:55PM UTC
Comment Actions
denimbeans on Chapter 4 Tue 11 Jul 2023 08:03PM UTC
Comment Actions
HowToUsername on Chapter 4 Thu 11 Jul 2024 03:57AM UTC
Comment Actions
emelie_unfortunately on Chapter 4 Wed 22 Jan 2025 01:06PM UTC
Comment Actions
emelie_unfortunately on Chapter 4 Mon 27 Jan 2025 04:42AM UTC
Comment Actions
whydontyoucomeonover on Chapter 5 Mon 19 Jul 2021 07:09PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:28PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 07:56PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:07PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 08:15PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:21PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 08:24PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:30PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 08:33PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:35PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 08:39PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:01PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 09:03PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:04PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 09:09PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:21PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 09:25PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 10:35PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 10:44PM UTC
Comment Actions
denimbeans on Chapter 5 Tue 20 Jul 2021 01:56AM UTC
Comment Actions
SnufflesThePig on Chapter 5 Tue 20 Jul 2021 02:07AM UTC
Comment Actions
denimbeans on Chapter 5 Tue 20 Jul 2021 02:17AM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 08:18PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:24PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 08:30PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:34PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 08:38PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:03PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 09:05PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:23PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 09:26PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 10:33PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 10:35PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 10:37PM UTC
Comment Actions
SnufflesThePig on Chapter 5 Mon 19 Jul 2021 11:26PM UTC
Comment Actions
denimbeans on Chapter 5 Tue 20 Jul 2021 02:03AM UTC
Comment Actions
(28 more comments in this thread)
FatJanUmber on Chapter 5 Mon 19 Jul 2021 07:59PM UTC
Comment Actions
Account_457 on Chapter 5 Mon 19 Jul 2021 08:07PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:15PM UTC
Comment Actions
Goldentigerlily (Guest) on Chapter 5 Mon 19 Jul 2021 08:08PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 08:16PM UTC
Comment Actions
purple_wren on Chapter 5 Thu 18 Jul 2024 12:19PM UTC
Comment Actions
estnillin on Chapter 5 Mon 19 Jul 2021 08:38PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:03PM UTC
Comment Actions
estnillin on Chapter 5 Mon 19 Jul 2021 09:09PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:21PM UTC
Comment Actions
estnillin on Chapter 5 Mon 19 Jul 2021 09:22PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:23PM UTC
Comment Actions
estnillin on Chapter 5 Mon 19 Jul 2021 09:31PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 10:32PM UTC
Comment Actions
estnillin on Chapter 5 Tue 20 Jul 2021 08:48AM UTC
Comment Actions
denimbeans on Chapter 5 Tue 20 Jul 2021 02:25PM UTC
Comment Actions
estnillin on Chapter 5 Tue 20 Jul 2021 02:26PM UTC
Comment Actions
damdelion on Chapter 5 Mon 19 Jul 2021 08:40PM UTC
Comment Actions
denimbeans on Chapter 5 Mon 19 Jul 2021 09:01PM UTC
Comment Actions
damdelion on Chapter 5 Mon 19 Jul 2021 10:37PM UTC
Comment Actions
cartelage on Chapter 5 Mon 19 Jul 2021 10:10PM UTC
Comment Actions
Black_Victor_Cachat on Chapter 5 Mon 19 Jul 2021 10:44PM UTC
Comment Actions
fallingthroughspacex on Chapter 5 Tue 20 Jul 2021 01:39AM UTC
Comment Actions
battysorciere on Chapter 5 Tue 20 Jul 2021 11:04AM UTC
Comment Actions
mad4thedoctor on Chapter 5 Tue 20 Jul 2021 11:58AM UTC
Comment Actions
denimbeans on Chapter 5 Tue 20 Jul 2021 02:30PM UTC
Comment Actions
mad4thedoctor on Chapter 5 Tue 20 Jul 2021 03:18PM UTC
Last Edited Tue 20 Jul 2021 03:49PM UTC
Comment Actions
denimbeans on Chapter 5 Tue 20 Jul 2021 05:46PM UTC
Comment Actions
Percy_Jackson1104 on Chapter 5 Tue 20 Jul 2021 05:08PM UTC
Comment Actions
denimbeans on Chapter 5 Tue 20 Jul 2021 05:38PM UTC
Comment Actions
Percy_Jackson1104 on Chapter 5 Tue 20 Jul 2021 05:57PM UTC
Comment Actions
Cavae_Draco_Lilium on Chapter 5 Sat 24 Jul 2021 08:23PM UTC
Comment Actions
Darling_No on Chapter 5 Sun 25 Jul 2021 06:49PM UTC
Comment Actions
Pages Navigation