Archive of Our Own ^beta

Chapter Text

Prologue - Future of a Non-Existent Past

It was always hard to tell what the future held. Nobody knows what will happen or why. This is especially the case for anyone decoupled from the timeline altogether. After all, who knows what of the future?

Silver the Hedgehog was the guardian of the timeline. He couldn’t remember when it happened or why, but he was immune to the effects of timeline alterations. Regardless of what happened, regardless if it was good or bad, it wouldn’t directly affect him. While it meant he never had to worry about accidentally erasing his own birth, it also meant the timeline he remembered no longer existed every time he went back to change fate.

Every time he returned to his own time, 200 years in to the future from Sonic’s time, he had to relearn history from scratch. It didn’t matter if it was the apocalypse or if the future was bright.

He studied histories that had become null and void countless times and had intentions to keep doing so until the timeline was stable enough to never warrant the cycle again. Ironically, he didn’t know his own past very well. He didn’t know who his parents were. He didn’t know why he was the only one unaffected by any alterations in the timeline. He didn’t even know if he really came from the future, or if he just lived there long enough that he belonged there.

All he knew was that he just was, and that was all he needed. It wasn’t like knowing any of those things ever came into play with saving the future.

It was an almost never-ending cycle. A bad future had to be prevented at all costs. A good future had to be preserved from any threat.

Adventure after adventure, he always hoped he would find the latter.

After the Eggman Empire takeover was averted, he parted ways with his friends of Sonic’s time. He prepared himself to return where he belonged, using a technique that distorts space-time called ‘Chaos Control’, he was off in a flash of light. As the blinding light faded once again, he looked up and he saw a blue sky.

He breathed a sigh of relief. It was a good future, finally. Well, again, anyway. The last time the sky was that blue when he returned, was just before he left to visit an interstellar amusement park and was acquainted with the Other-Dimensional Princess Blaze. It was since turned into an apocalypse again after the Time-Eater Incident and the Virtual Reality incident and Eggman conquest.

The sky was blue and clear. He could hear chatter of people. As he looked around, they were happy. Humans and mobians were walking side-by-side. As he breathed in, he could smell clean saltwater. He could feel a gentle breeze brush against his quills, and it was pleasant. Not too hot, nor too cold. It was an atmosphere of bliss itself.

As he became more aware of his surroundings, he couldn’t help but feel a familiarity about the locale. The ancient structures carefully preserved. The Emblems scattered throughout the city. The canals between buildings. He heard of such a place.

A name came to mind… Soleanna.

The city of water.

The current monarch was Duchess Adeline IV. She was an almost spitting image of her ancestress of 200 years ago according to historians.

He remembered reading about Soleanna a couple of times during his self-taught history lessons at a partially surviving library. He remembered that it was known as the city of water and was famous for its ‘Festival of the Sun’ in celebration of their God, Solaris.

However, something felt oddly familiar.

In a strange way he could not explain.

A strange déjà vu, but different...

Little did he know how familiar he would find Soleanna. Nor did he know what strange things he was going to encounter. Things he was not ready for. Experiences he never knew before. Memories he never knew he had...

Things were going to get stranger and stranger…

Chapter Text

Chapter 2 - Soleanna

Despite the feeling of déjà vu, there were many sensations Silver felt in that moment that were completely new. He heard music of accordion players busking on the corners. He saw through the clean water of the canals and could find tiny fish swimming around the edges among seaweed and other saltwater plants. He heard the pleasant chiming of the bells of the towers and clocks. Despite being 200 years in the future, it felt like the place barely changed. Were it not for the futuristic devices and fashion sense of the tourists, he could easily believe he simply travelled to a different place, rather than another point in time.

Yes. He remembered reading a bit about it. He was in the ‘Castle Town’. As he looked up, gently shielding his eyes from the sun glare, he could make out the ancient castle up the mountainside.

Despite being an island nation, there were many different biomes accessible through special mirrors that teleport people and objects in an instant known as the Mirrors of Soleanna. There was the ruinous ‘Tropical Jungle’, the mysterious ‘Dusty Desert’, the beautiful ‘Wave Ocean’, the dilapidated ‘Kingdom Valley’, the transport network ‘Radical Train’, the desolate ‘White Acropolis’ and… he couldn’t quite remember the last one. Somewhere hidden and cold and metallic…

He remembered reading that Soleanna was divided into 3 main zones, at least for the public to access anyway. There was the ‘Castle Town’, the place where relics of the past were carefully maintained. It was also closest to the castle, where the current monarch resided. The Castle Town was popular with tourists for its canals, heritage architecture, and it was where the annual ‘Festival of the Sun’ was held. It was a celebration of fireworks, dancing and the lighting of a grand torch in celebration of their sun god, Solaris.

The other two areas were the ‘Forest’, and ‘New City’.

The irony of the New City was that the section was over 250 years old. It was the area that tourists usually came in from via the Radical Train station from the airport. It was also the import and export district.  

Lastly, there was Soleanna Forest. Home to ruins and an old castle first built over 1000 years ago in Kingdom Valley. It was also home to friendly Rocs; giant eagles more than capable of carrying a human off in their talons. The emblem of the country, the giant eagles would carry those that were worthy where they needed to be to help restore or maintain order of the island nation of water.

A lot of what he remembered from it came from self-taught history lessons. The last time the timeline was happy enough to have libraries preserved enough was just before he visited Eggman’s amusement park a while back. However, something felt a little off. Like what he knew about Soleanna came from more than just books. Like he had actually been there before…  

It was a mystery, but one he wasn’t good at solving.

‘Espio was pretty good at investigating, wasn’t he? I wonder how he could figure something like this out.’ He thought, recalling one of his more trusted allies of the past. ‘Maybe I’ll find a lead if I explore the island. I might find some answers if I look around.’

So, he asked the locals around, and explored Soleanna.

With help and advice from both tourists and local royal guards, he was given a map of Soleanna, and he marked the key locations to visit on it before he embarked.

He spent the morning drifting through Wave Ocean, and he nearly found himself lost. The familiar feeling left. If he had been to Soleanna before, he never visited the beach, which was a shame because it looked very inviting.

Mid-morning, he explored Tropical Jungle. The familiarity struck him again. He knew the layout of the ruins, even though most tourists find themselves lost. He rode on the back of the turtles, he swung on the vines, and stood atop the strange submerged ancient ruins that would have been old even in Sonic’s time. He navigated it without any problems at all, like he already knew the layout. While it was a possible lead, it went nowhere.

Early afternoon, he wandered the Dusty Desert. He remembered feeling frustration when a simple ball puzzle came along that barred him from progressing further into the ruins. He had a feeling he had trouble with it before. Even though it was over sooner than he expected, it was like an old sore suddenly flared up. A sore he never knew he had. Then he felt like he was missing something the further he progressed into the sandy temples. He had been there before, with someone by his side. He thought something pink, but couldn’t place a name. A small vision flashed over him. It was a girl’s voice calling out.

“Silver!” He heard. He looked around, and saw nobody. He presumed it was in his head. The strangest thing about it was that it sounded like Amy, though he wasn't sure what to think about it. 

As the afternoon went later, he decided to go off the beaten path and explore White Acropolis. It felt like a strange compulsion. It was as if he had to search Soleanna in a certain order, rather than at his own pace. There was a high-tech base of sorts. Likely an old stronghold from the likes of Dr. Eggman back in his day. Most of the robots didn’t function anymore. The searchlights lost power long ago. It was just hunks of frozen metal and electronics ravaged by time and icy winds of the mountains. Though, when he reached the peak, he had a strange thought. It was like it was a memory without context. Words appeared in his head without any voice. But he knew it wasn’t his own thoughts. It was said by someone else.

… Chaos Emerald… They are said to be able to turn thoughts into power… keep it as a lucky charm…

He didn’t know where it came from or who said it.

Almost like a vapour of a memory.

Then a familiar colour came to mind. Lilac purple.

‘BLAZE!’ He remembered like a lightning bolt in his mind.

That’s right! Blaze taught him that!

But… He only met Blaze recently, at Sweet Mountain not long ago. He only spoke to her again one other time at Sonic’s birthday party. She never said that in either of those two occasions. Most of the time they spent together was small talk and not much else.

Even when he felt like he remembered something, he just had more questions!

He travelled along the Radical Train network. He tripped on the changing conveyor belts on a couple occasions, but otherwise had no trouble. As he explored the rusting and disused lines from long ago, he felt like he was missing something again. As he got to a railway shipping yard, he felt like he fought someone there… And he ended up elsewhere… The more he tried to remember, the more distant or non-existent the memories felt and he was stuck on a dead end once more. He thought about travelling elsewhere and seeing if there were any more leads, except, he just about visited all the main locations in Soleanna, except Kingdom Valley.

Even though it was the last place on the map, he didn’t feel any pull towards it. In fact, he felt the opposite. When he walked towards the ruinous castle grounds, he felt a sudden pull away. It was hard to describe, like his intuition was telling him without words that he was going the wrong way. So, he turned back to the Castle Town.

He was stumped. He was missing a key piece of the puzzle, but he had no idea where to go or what to do about it. The worst part about being decoupled from the timeline is that not many people, if any at all, actually knew him in his own time. Everyone he had ever come to know and trust were either in the past or other dimensions. The loneliest he usually felt was back where he was technically ‘home’.

Not sure of what else to do, he bought a fresh ricotta cannoli and sat on a public bench. He thought carefully about the day and where he should go next. He didn’t know where he was going to spend the night, but it wasn’t the first and likely wouldn’t be the last time he would find somewhere in the wilderness to sleep. A bed was a luxury he usually didn’t have.

He watched the clear skies change colour from the beautiful light blue, to shades of orange and purple as the first few sparkles of stars shone among the growing darkness. The slightly salty breeze of the ocean gently began to wash over him like a comforting blanket. With the only discomfort being cannoli crumbs, he felt himself begin to nod off a little. Soon afterward, he fell into a shallow sleep, still at least partially aware of his surroundings.

As he thought carefully about the strange situation, hoping for something to eventually ring the bell tomorrow. In the silence of the night, he fell into a deeper sleep.

Bi-ring! Bi-ring! Bi-ring!

A loud noise startled him awake again.  One of the bell towers began ringing in town. He didn't think he slept for very long, but when he looked around, no one was there. The shops were shut and the lights in people's houses were switched off.

It wasn't just one bell tower ringing though. After a minute, another bell tower rang, off-sync with the first one. Then a third, which was the one closest to him. All three of the bell towers rang out of sync with one another across town in a chaotic cacophony of brass. He felt the vibrations in the soles of his boots and tingling on the tips of his quills.

It felt suspicious. If it was chiming to tell the time, they should all ring together. Instead, it was like someone was racing across town to ring one after the other for whatever reason.

As he looked towards the nearest bell tower, he saw a lone figure suddenly jump from the height up the top and land. They were cloaked in a black hood of sorts and carried a strange mallet.

It wasn’t like Amy’s Piko Piko hammer. The shaft of it was long and was about the height of the wielder, and wasn’t attached to the centre of the hammer head. The head itself looked almost like a horizontal cone, with the point heavily rounded off. It had a slightly wider end at the back, and a small and rounder end at the front. If only the outline of it was seen, it would look like a strange blunt scythe. Silver had never seen a hammer like that before.

The owner of the strange weapon started to run off to the bridges in the centre of town. Silver, keeping a safe distance, decided to follow them. He wasn’t sure it was going to help his situation at all, but curiosity was getting the better of him. He needed to know why they rang all three of the bell towers, and where they were going. He didn’t know if they were friend of foe, but he wanted to find out.

As the night grew later, and the gentle sea breeze turned colder, he saw the cloaked figure running towards a small viewing area that the bridge connected to. It doubled as the giant torch that was lit during the Festival of the Sun. The brass ringing of the bell towers began to soften as they steadied into a peaceful quiet once more. Under the faint light left in the sky, he saw the shimmer of a mirror. One he never saw before. He walked across that same bridge throughout the day and saw nothing like it. It was like a secret passage suddenly opened to something much more secret. With only the sound of shoes gently tapping the stone floor, the figure ran towards the mirror and disappeared in a flash of light.

A hidden mirror to a secret location within Soleanna? Silver didn’t know what to think at first. Then he heard mechanical clicking and shuddering of doors closing as the quiet of nightfall set in again. Unsure of whether he was making the right decision, but also knowing he wasn't going to get another chance anytime soon, he ran towards the closing door. He used his psychokinesis to hold it open for just a moment longer. He ran towards the mirror, and was teleported elsewhere.

As he ended up on the other side, he tasted chilly, stale air. It was cold enough he thought he could see his own breath, or he would if there was any light in the place. It was dark, very dark. There was a faint smell of rust and a sensation of a damp cold, like it had rained inside a walk-in fridge. There was a faint sound of dripping water echoing in the distance and a small vibration like a low hum or mechanical buzz. Too sanitary to grow mould, but left to both time and the elements for so long, that everything managed to decay anyway in an almost robotic, dystopian manner.

He was somewhere restricted. An abandoned underwater lab left to rot by time. He felt a sense of familiarity fire up in him like a raging inferno. The sights, sounds, and air tasted distinct and unforgettable. Even if he had no memories of such, the sense of Déjà vu was so indisputable, that he knew in only a few moments, he had been there before.

Something significant happened long ago. The sights of decayed machinery and stagnant seawater triggered something big. The name came to him the moment he set his eyes on it. He knew exactly where he was. He was in an underwater lab right beneath Soleanna itself. Though abandoned, decayed and partially flooded, he still recognised it.

He realised in that moment, his next lead was in the ruins of the old underwater laboratory of Soleanna, Aquatic Base.

But before he could go exploring, he felt the head of a smooth, but hard mallet pushed into his chest. He was being given a warning before it would be swung his way.

“Who are you?” Asked the cloaked figure. “Why did you follow me?”

Chapter Text

Chapter 3 - Mystery in Bloom

Silver felt the hammer pushed into his chest again, a little harder than before. While he could easily pick up and throw both the hammer and its wielder, he didn’t know whether they were friend or foe just yet. If it could be resolved with words first, he’d rather do that instead of needless fighting and risking someone innocent getting hurt, himself included.

“I said why were you following me?” The cloaked figure growled again. They sounded like a grown woman. “This lab hasn’t been used for over 200 years. I know you aren’t a scientist. So, who are you? Are you with the ‘Children’? Give me a good reason why I shouldn’t knock you out right now!”

“I didn’t mean to follow you.” Silver tried to explain himself. “I saw you ring the bell towers and run towards the pavilion from the bridge and I noticed a mirror that wasn’t there before. It’s hard to explain, but I only just got to this future and I felt like… like I have been here before, but I can’t remember. It’s all so confusing.”

“Wait…” The figure inquired, lowering the hammer. “Future? As in… You’re a time-traveller?”

“Yes.” He answered, bluntly. “My name is Silver, and I’m a time-traveller who’s just come back from the past.”

“Silver?” The figure gasped. “As in the Silver the Hedgehog? Psychic time-traveller who preserves the timeline?”

“Yes… I think… why?” Silver asked, taken a bit aback. He didn’t realise that somebody might already know him from the past, much less that he was known like a small legend of sorts.

“Oh my gosh! I’m so sorry!” The stranger apologised. “I didn’t realise that was you! I should probably show some manners and introduce myself.”

They took out a large chaos drive-powered flashlight, switched it on and removed their cloak, revealing a green female hedgehog not much taller than Silver. She had dark pink eyes, with lime-green quills. A small tuft on the top of her head pointed forward, while the rest of her quills looked like Sonic’s. They were drooping down from the back of her head. Two in the middle and two on each side, making 6 in total. One quill on each side curved upwards, while the quill below it drooped down like hedgehog quills should, looking like half an 'x' on either side of her. On her left side was a small, yellow floral clip near her ear.

She wore a plain beige dress that dropped to her knees and had a brown leather satchel hanging over her shoulder. She also had white sneakers with pastel blue and pink highlights. Around her gloves were a pair of silver bracelets. Nothing too glamorous compared to someone like Amy, but nothing made her look like much of an explorer or adventurer either.

“My name is Freesia.” She introduced herself, extending a hand towards him. “Freesia Robotnik. Squee!!! I’m sorry! I’m just so excited! I mean, I’m meeting the Silver the Hedgehog! I can’t believe it! You have no idea! You. Are. My. Hero!”

Silver took her hand and shook it. Almost taken a bit aback at how quickly her mood changed from interrogating him to shaking his hand like she hadn’t threatened to beat him with a large mallet a minute ago. However, her last name concerned him a little more than her mood shift.

‘Did she just say ‘Robotnik’?’ He thought. ‘Now I’m even less sure I can trust her!’

Before he could say anything about it, Freesia answered for him.

“I know, ‘Robotnik’. It’s not really the name I was meant to have, but I changed it. I’m not related to that mad scientist you might be thinking of. I changed it to protect the people I care about. I can't have what I'm doing be traced back to my family. I’m working on a project of sorts and I can’t let just anyone know what I’m doing. However, you’re not just anyone! I’ve read about your deeds and support you provided in the Eggman wars long ago. My mom used to tell me stories of the great battles of the time. They’re practically legends with historical proof! And… I’ll be honest, you didn’t appear in those stories much, but I know a lot of things that you did! Combine that with the fact that you’re a time-traveller and from around this time, one of the most exciting aspects of my childhood was the thought that a legend of history will return to the same time as me! You were also a massive inspiration to me, because I read about the futures you came from and how in spite of all of that, you always remained optimistic to the end. You indirectly helped me through a lot of dark places in my life!"

She took in a deep breath, letting her excitement die down a little before she continued. 

"Anyways, since you’re here, would you be willing to help me? If you do, we’ll be out of here in a few hours and I’ll help you with your memory problem where I can. I’ll also let you crash at my place for as long as you need to… unless you already have a place to go, that is… Umm… Sound good to you?”

Silver nodded gently.

“You know,” He replied. “I don’t know if I have somewhere to call home since I got here. I like your offer, but how do I know I can trust you?”

Freesia blinked for a moment, carefully considering her answer

“What counts as proof?” She asked. “I mean, I can say many things, but I bet you want something stronger than my word, don't you? So, what counts as proof I can be trusted?”

“How about something related to what you’re doing in these abandoned labs?” He replied.

“What I am doing is pretty secret and I can’t let such information get into the wrong hands…” She replied, contemplating her decisions. “Not that I don’t trust you or anything, just… I don’t know if the walls have ears sometimes. You know what? I guess I can trust you with it. How about I show you what I’m working on, huh?”

“I guess that could work.” He replied. “So, what are you working on? And what has it got to do with a place like this?”

“I’ll show you a small copy of a research I have with me. The original copy is kept somewhere secret.” She explained as she reached into her bag and pulled out a slip of paper. “Here it is.”

She handed Silver a slip of paper with various equations and a diagram of a chaos emerald on it. He couldn’t understand anything on it aside from a couple words that looked like instructions. Even with the help of the flashlight, it was a little hard to read properly.

“It’s a copy of research from a scientist I’m trying to uncover.” She explained. “It’s the inner workings of how Chaos Control works and how to perform it. I kept this slip to study when I was first practicing the technique. I’m simply trying to find out more about the scientist himself. Do you trust me now?”

“I guess so…” Silver answered, feeling a little confused by the slip of paper, but carefully considering his decision.

‘It would be weird to be carrying around a slip of paper like that unless she was telling some truth. Name aside, she doesn’t seem too dangerous, and I guess I could use her offer of somewhere to sleep tonight. Maybe she’s just that nice? I guess there’s only one way to find out.”

“Alright, I guess I can help you.” He agreed, reaching out his hand to shake hers. “It’s a deal.”

“Great!” She cheered gleefully, grabbing on to his hand in a firm, but gentle grip and shook. She opened her satchel and pulled out a hand-drawn map of sorts, inspecting it under the beam of her flashlight. “Alright, I’ve explored most of the place, but there’s one area left I haven’t been able to get to. The main problem is that most of this underwater lab had flooded since it was abandoned long ago. I’m not exactly a terrible swimmer, but who knows what’s buried or hiding just beneath the surface. Would you be able to help me get there?”

“Sure.” Silver answered. “I can even help you light the way.”

The time-travelling hedgehog channelled his psychic energy onto his body, like he would when levitating. His power began to cover his body in a bright, cyan aura, illuminating the state of disrepair of the underwater lab. He saw how much the lower floors were flooded with still, black water. With no electricity running through the facility anymore, not a single shed of light shone from any of the heavily dusty and partially salt-encrusted lamps. He had no idea how somebody would be able to explore such a dangerous place alone. Even without Eggman’s robots around, the natural hazards were dangerous enough.

Freesia stood in awe for a moment as she saw her hero's powers in action. 

“What sort of project are you working on?” He asked.

“Well… It’s sort of a personal project of mine.” She answered. “When I was young, I had a hobby for studying history and science. From the great battles of the one and only Sonic the Hedgehog in his prime years, to the declassified documents of Project Shadow and archived research journal entries of Professor Gerald, to the Gaia Manuscripts. I remember hearing my mother tell me stories of my Grandma and the adventures she went on when she was young. Well… the ones she knew of anyway. My mother also told me about a lesser-known scientist who worked in the G.U.N Research and Development sector.

“He was said to be heavily inspired by the great works of Professor Gerald and was a genius when it came to studying chaos energy. He was simply known as ‘Dr. Sow-Had’. He studied the wavelengths and properties of the Chaos Emeralds, even successfully recreated a replica emerald in a collaborative effort with the visionary, Miles Prower. He studied the bizarre properties of the Master Emerald with permission from the guardian, Knuckles the Echidna. He studied the powers of Chaos Control and its effects on time and space. He studied the many abilities only discovered within the Ultimate Lifeform himself. He was a revolutionary! Thanks to Dr. Sow-Had we now have a comprehensive understanding of how Chaos Control works, as well as Chaos Spear, and Chaos Blast.”

“What happened to him?” Silver inquired. “And what does it have to do with this project you’re working on?”

“Not much else is known about him, except that he went missing one day and was never seen since. I suspect whatever made him disappear also made sure to try and destroy traces of his existence. But I know better. My grandma was pretty close to him, or so I was told... I never exactly met her myself... And my mom inherited a few journals that my grandmother kept safe around the time he went missing. I read through them again and again, and I want to know what happened to him. The only way I’m going to find any clues of that is by searching some of the old labs he worked in during his active career and see if there’s any other scrap of his existence. Like research papers, devices he built, mentions of his time working in them, and so on. Among those places were here, in Aquatic Base with blessings from Duchess Elise the Third, a small base set up near the Emerald Shrine of Angel Island, a few G.U.N R&D facilities, and even the Space Colony ARK.

“I want to travel to these places and uncover any other trace of his research I can. I’ve searched the Angel Island outposts, G.U.N facilities, and I’m currently searching through here. The only thing stopping me from reaching the Space Colony ARK is that I don’t have all the information for performing Chaos Control such a long distance. I can’t exactly afford a space craft, even for rent, on a florist’s budget. But enough about me, you said you were having a memory problem? What’s got you so confused?”

Silver took in a breath and tried to think of a way to put his strange feelings into words.

“Well… Where do I begin?” He tried to explain. “It’s weird enough that this is my timeline, and yet I just got here. I’m decoupled from the timeline, so any future I go back to is one I don’t remember, and any past I do remember no longer exists. Yet… ever since I got here, something’s been feeling off. I’ve never been to Soleanna. I’ve only read or heard about it. And yet, I feel like I’ve been here before. I’ve walked along those canals, I’ve travelled through the ancient ruins, and I’ve even solved the puzzles in the desert. I can’t help but feel like I’ve been here, but I don’t remember. And here, especially in Aquatic Base, I feel like more than 200 years ago, something significant happened here, and I was here to see it when it did. I can’t explain it. It’s like I just… know.”

“Weird…” Freesia commented. “Well… if you can help me explore and recover what I need to find here, you can lead me to where you think this event happened. I have read as much as I can about this lab from what has been declassified, speculated, and written in Sow-Had’s diaries, so I might be able to help you learn more if I can.”

Silver nodded.

“Where are we going then?” He asked.

Freesia shone her flashlight around to get her bearings of where she was specifically in the lab.

“I need to get to Level 2.” She answered. “It’s one of the few sections not completely flooded. Sow-Had did his research somewhere in the upper section. It should be an isolated computer room of sorts. He used it to study the effects of Chaos Control on the flow of time and create time-space rifts. Good news is we don’t have to do any underwater exploring. Bad news is that it’s likely closed off under heavy machine doors that likely can’t be powered up anymore. We’re currently at Level 1. I have a rough idea on where to go… So follow my lead, Silver. This shouldn’t take more than an hour if nothing goes wrong.”

So, they started off into the deep, dark, dilapidated unknown, hoping to find a truth that had been buried long ago.  

Chapter Text

Chapter 4 - Aquatic Base Ruin

Silver stared into the black void that was the stagnant floodwater. His illuminated body could be seen reflecting perfectly back. He couldn’t see much beneath the surface. There was neither machinery nor life. It was just a stagnant black mirror of water.

“So… Which way should we go?” He asked, turning his head to look back at his new acquaintance.

Freesia inspected her map carefully, occasionally checking her surroundings to be sure of where she was.

“Let’s see…” She muttered a little. “I’ve been here a couple of times before, just scouting the area to see what’s around, and I’ve drawn a rough map of the place (at least everywhere that isn’t underwater anyway)… And if I am correct about where we are right now… we need to head up about… That way!”

She pointed to a ledge above them with. It looked like there used to be a platform that acted as an elevator up. Silver could levitate himself with his psychokinetic powers. However, he had no idea how Freesia could manage getting up there unless she was an expert climber.

However, before he could wonder long, he saw the green hedgehog get a running start and, swinging her large mallet around vertically, she struck the rounder back-end of the head to the ground and flew high into the air. After a small aerial summersault, she landed on the platform above.

Any questions of how she could manage on her own vanished as Silver followed behind her, levitating himself up to the platform.

As they wandered through a tunnel where security lasers were once active, the deactivated machinery was only lit with both the cyan light of Silver’s powers, and Freesia’s chaos drive flashlight. The only sound that could be heard was the gentle tapping of shoes on metal sheet floors.

Naturally, they began to converse a little more casually to break the eerie silence.

“So, Silver, can you explain your memory thing in a little more detail?” She asked with a small, friendly smile. Her voice echoed down slightly, making the facility feel all the more unnerving. “It’ll be a bit of a walk. So might as well multi-task, eh?”

Silver had trouble forming it into words, but tried to explain.

“Basically, since I got here,” He explained, a little uneasy about if he was describing it correctly. “I mean… whenever I go back to my own timeline, I usually end up somewhere different from where I left. Like… If I returned from Station Square, I might end up in the future version of Spagonia, or Onyx Island, or somewhere else again. This time, I ended up here in Soleanna. However, something felt different this time. I’ve read about Soleanna before, but… I’ve never been here, but I know here. And I can’t shake the feeling that I have been here before. But I haven’t. It’s like déjà vu. And here, in Aquatic Base, that feeling is very strong. I’ve never been here before. I’d remember something this cold and abandoned if I walked through here. But… I feel like something big happened here long ago. Do you know that feeling?”

“Hmm…” Freesia pondered, her hum could be felt vibrating across the walls. “I know of it, though I’ve never felt it before. What you are experiencing is like a variant of déjà vu. It’s called déjà visite. Unlike déjà vu, it’s not a feeling of experiencing something before, it’s a feeling of being somewhere else before, despite never visiting such a place. It’s a natural, but mysterious phenomenon. In some reports, people experiencing the feeling have been known to navigate places as if they were a local who lived there for years, and it was the first time they even knew such a place existed. Weird, huh?”

“So…  It’s not that big of a deal?” Silver inquired, both a little relieved that it wasn’t anything serious, but also feeling deep down that the explanation wasn’t quite correct.

“Now… I wouldn’t say that.” Freesia replied. “Since you’re a time-traveller, there might be the possibility that you were here before. There might be a time paradox involved. Your memories might be gone because the moments you experienced never happened in a completely different way from your ‘decoupling’ thing. But part of you does remember. Perhaps you remember deep in your bones, or somewhere in your heart, maybe your very soul.”

They reached the end of the tunnel, ahead of them was a large expansive room flooded off the ledge of the platform. The next platform out of the water was quite a way away. A good guess would be at least 30 metres. It would have to take quite a running start to be able to clear the gap.

“I guess that’s why we’re here, right?” She continued. “We might have completely different goals, but we have one thing in common, we’re looking for the truth. I heard that there are three things that can never remain hidden forever: The Sun, The Moon, and The Truth. However, it’s possible to hide from all 3 when they are buried deep down. That’s why we’re here. We’re here with a metaphorical shovel to dig deep and bring the truth back to light. It won't be easy, but we have to try.”

"I guess..." Silver replied, not sure what else he could say in response to that. 

Freesia took in a deep breath, carefully overlooking the gap she had to cross to move forward through the decaying labs.

“ok… how are we going to get across…?” She muttered to herself.

“Ahem!” Silver cleared his throat and showed off his psychic abilities by levitating off the ground, answering her question.

“Would that really be okay?” She asked, little unsure. “Using your powers on the both of us wouldn’t be too much for you to handle, would it?”

“It shouldn’t be any problem.” Silver chuckled a little as he placed her in a psychic hold and lifted them both up into the air. “If you don’t mind flying with a green aura.”

As he gently floated them both towards the other side, Freesia was in awe.

“I read that you were a powerful psychic, but I never realised-!” She gasped.

“This is nothing for me!” He boasted. “You should have seen that time I fought Sonic in the ‘Time Eater Incident’. I picked up so much debris that I made a giant rolling boulder out of it! I called it… METEOR SMASH! Sonic looked almost terrified as I sent it rolling behind him while I kept throwing old cars in front of him. I could understand his fear when he sent me under it instead with a well-timed homing attack…”

“Wait…” Freesia inquired. “You fought Sonic? I thought you were a trusted ally of him?”

“Well…” Silver tried to explain. “It was a bit complicated. I wasn’t sure I was dealing with an impostor or not.”

“And you tried to find out by throwing cars at him?” She asked, looking a little sceptical of his method.

“In hindsight, it probably… wasn’t a great plan…” Silver sighed, a little sheepishly.

“Eh, we all make mistakes. It’s not worth beating yourself up over.” Freesia nodded. “I mean it sounds like Sonic did enough of that for you.”

Silver gave a small but reluctant nod as he gently placed the both of them down onto a dry platform.

“Ok…” she pulled out her map again and looked over it. “I’ve never been here before, so I’m just going to quickly make a few additions to this before we move forward.”

She pulled out a marker and doodled onto her hand-made map.

“Did you have a plan for getting across by yourself?” Silver inquired.

“I… Might have figured out something.” She answered without looking away from her map. “I once managed to hover for a few seconds by swinging my mallet around very fast like a propeller. I could have used that technique in theory.”

“Speaking of that mallet, what sort of mallet is that anyway?” He asked. “I’ve never seen anything like that before.”

“This thing?” She asked as she tapped the shaft gently. “It’s a giant Kine. You know a mortar and pestle? This is like a large pestle. It’s also known as a mochi mallet. I originally got it as a tool to make big batches of mochi at one of my older jobs. I was an apprentice at a handmade dessert store. One of my favourite jobs too. Just… Swinging a hammer like this in rhythm with my master felt… right. Like, if I had a purpose in life, it was to swing hammers… Anyways, when I moved on to become a florist, I bought this thing and the usu (mortar) it came with. And after a while, I could barely leave home without my kine and I found it pretty good for pounding more than just rice cakes. I modified it, maintained it, and now it is basically an extension of me. I even made a little sling for it so I could carry it on my back when I need both my hands free.”

“That almost reminds me of Amy and her piko-piko hammer.” Silver commented.

“Heh. Yeah…” Freesia chuckled. “I would like to think I am following in the footsteps of a proud warrior and resistance communication leader like Amy… But I can’t and I shouldn’t try to compete. I could never be so strong. I could never be so selfless and I have never been able to bring out the best in people. I cannot live in her shadow, because I am but a budding scout hiding in shadows of my own. Nonetheless, this hammer doesn’t squeak when you hit something. Though it does have a satisfying TAK! sound when the staff end hits the ground. Sometimes when I do that, I feel tempted in shouting ‘You Shall Not Pass!’ like a wizard of sorts.”

Freesia put her map away and shone her flashlight around to get a look at her surroundings. Fortunately, there wasn’t a fork in the path. But there were many more platforms up ahead in the next room.

“Alright, looks like we’re following the path.” Freesia thought out loud. “And it looks like there are many more platforms to follow. Ready to venture into the dark unknown?”

Silver nodded and picked the both of them up again in a glowing psychic hold.

As the light emanated off their bodies, Silver could see the extent of decay. He could see broken machines that would have once had laser shooting out to prevent unwanted intruders. He could see what appeared to be charging ports for robots of various sizes. He could see panes of glass that weren’t quite broken yet, but were cracked and leaky. With how much of the labs were flooded, it was amazing that there were still a few dry pockets for them to poke around in. He wondered if it was possible to find anything relating to the scientist Freesia was talking about or anything about what he feels like he's remembering, or whether it is buried beneath black seawater and lost to time.

The platform-filled room they crossed ended in a hallway of sorts. It was the first place they found that didn’t look completely run-down. The walls looked pristine, with barely even fingerprints visible. He could have easily believed he just travelled to a time when the labs were brand new in that sudden instant. There were at least 6 different doors and floors that looked like liquid mirror that still managed to retain their shine. The floor moved in strange ripples like it was following the motions of a calm ocean. Compared to the darkness of the other rooms, the way that the light of Silver’s powers bounced around on the floor was almost blinding.

The ceiling looked like it was dancing among waves of cyan light, like there was a party going on for an invisible entity that neither the hedgehogs could see. It felt unwelcoming, but a mild-annoyance kind, not an imposing threat kind.

“Which way?” Silver asked as he still held them both up into the air, unsure if he should touch the kinetic mirror floor. There was no way of knowing what it was or what would happen if either of them touched it. Part of him knew they would be fine, but he didn’t want to take that chance.

“I mean… All the doors are locked,” Freesia answered. “And only one way to open them. Silver, can you let me down for a moment? I wanna take a crack at this.”

“But I don’t know what will happen if you land on that mirror stuff.” He pleaded.

“Oh, that stuff, nothing to worry about. We’ll be fine. Trust me. I’ve come across one of these sorts of rooms before.” She reassured him.

Silver was a little reluctant, but placed her down gently anyway. When he noticed she didn’t sink, he let himself down too. He could feel the movements through his boots. It was like if a gentle and calm ocean was a solid and walkable surface at the same time. It was almost dizzying.

Freesia took in a deep breath and took out her mallet, and started pounding it against the door.

“ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA!”

She cried as she swung away, pummelling the metal door further and further until it all gave way in a great crash.

Watching the green hedgehog turn from sweet and trusting, to beating down a door like it owed her a ton of money made Silver jump a little, especially since she made impressive dents in the door every swing she made before it gave way completely.

“Phew…” She sighed as she wiped her brow and caught her breath a little. “One down. Five to go.”

Silver had no comment, he was a little shocked at the display of strength and brutality that came out of nowhere.

Freesia walked towards the next door to break it down, but before she swung again, Silver interrupted her.

“How are you able to break down a metal door with a wooden mallet?” He choked out.

“Who said this was a wooden mallet?” She chuckled a little, before breaking down another door in a similar process. Then another. Then another again. Eventually, she broke down every door.

‘For a hedgehog who claims to not be following in Amy’s footsteps, she sure seems to be just as strong! Glad she’s my fan or I’d hate to think what she could have managed with that mallet.’ He thought to himself as he watched the metallic carnage unfold.

With all the doors broken down, they explored once again. Looking down, all except one of the doors looked like separate rooms that led nowhere. Naturally, they investigated each one. Nothing much to find other than storage for robots that had become obsolete to age. It was the only reminder that the room was over 200 years old.

The last door led to another hallway, which led to more high-tech platforms and strange decrepit technology.

“How far does this place go?” Silver asked, carrying them into the next section again. “What sort of things would even be researched here? I mean… A laboratory like this? Under Soleanna?”

“I don’t know.” Freesia answered, honestly. “I believe this place connected to Kingdom Valley. If we go any further, we might just reach the exit. Of course, it was sealed off long ago, so it’s a dead-end now. I honestly don’t know what would have been researched here. If it is this secretive, maybe it is best that whatever happened here remains lost to time. I just hope I can retrieve any last traces of Dr. Sow-Had before that happens.”

“Do you know about anything that might have happened here?” Silver inquired. “I feel some familiarity about this place. I know something happened here, and I saw it. But I don’t remember. I just want to know, do you have any theories?”

“Well… Before I moved into Soleanna, I did my research on this place.” She explained. “It’s how I learned the trick with the bell towers to even get here. Not much had been declassified about this place, and most documents that were leaked to the public were buried and lost to time. However, from rumours, speculations, conspiracies and anything that mentioned this place in Sow-Had’s diaries, I managed to piece something together. The most concrete information about Aquatic Base was that it was where most machinery exports were crafted. It was also said that they were researching new energy engines and other sources of electricity. But other sources told me that super weapons were being developed here too. Soleanna is only a small island country, they might have been researching and stockpiling various weapons of mass destruction here in the event of a war in the past. I theorise that it would have been in the height of the Eggman Wars. I mean, that explains the secrecy. The government likely wouldn’t want other nations to know what they were potentially capable of until war might be declared.”

She looked through an empty room one of the platforms led to, before continuing forth to another one on the other side.  

“However, I think in relation to you, I also heard rumours of something called the ‘Solaris Project’, named after the Eternal Sun God. However, unlike Chaos, there isn’t much evidence of Solaris’ existence. That’s where this project comes in. The flames were entrusted to the royal family, but long ago, it was experimented on, and the Eternal Flame was extinguished. Since Solaris was a god of fire, and a god of time, it may have been experimented on to allow people to change history as we know it. Of course, for you, that might be a regular Tuesday.”

She chuckled a little, looking through a filing cabinet in a dark corner, pulling out everything that looked like plans and other forbidden documents that haven’t completely disintegrated yet.

“According to Sow-Had’s diaries, he researched here to generate a machine capable of teleporting someone through time. It was called a ‘Prototype Solaris’. If the entries are true, it was successful, but couldn’t be fine-tuned for long enough to guarantee time-travel to a desired point in time. It required at least 2 chaos emeralds to operate, and side effects included being decoupled from the timeline altogether. Though, a strange entry in the diaries suggests that might have been an intentional side effect. Something about killing two birds with one stone and curing a strange condition and saving someone from something. It’s really weird, but… I’ll explain later…”

Silver winced a little, and the feeling of déjà vu intensified.

The Solaris Project…

Something about that struck a note with him.

A small vision overcame him. It wasn’t much, but it was something. A few brief visions of a dark shadow, the lab when it was still active and pristine, a glowing flame that floated above the ground and steadily grew in size and power, and a small human girl in an orange outfit with red hair. He remembered that Shadow the Hedgehog was with him, but nothing much else.

“I don’t think the eternal sun died.” Silver muttered unconsciously.

“What?” Freesia called to him, stuffing many scrolls of papers into her satchel. “Did you say something?”

“Oh… It’s nothing.” Silver dismissed her, unsure how to explain what he just experienced.

The rest of the night crawled by slowly as Aquatic Base seemed to stretch on for a long time, even the parts that weren’t flooded. The final room before their journey was over was a hallway that somehow remained clean after so much time. In the darkness, there was only a large, mirror-like sphere and an endless looking void below.

Silver felt something familiar about the giant ball. It was a similar feeling he had towards the ball puzzle in Dusty Desert. It wasn't as bad, but the feeling was there.

“Not doing that again!” Silver spoke again without thinking as he picked up Freesia and levitated both of them towards the other end.

“Again?” Freesia asked. “You remember going through here before?”

“I… don’t know…” Silver answered.

The path ahead seemed to have forked. One led to another room, the other to the sealed off entrance to Kingdom Valley. They took the first path. Silver held the flashlight and used his powers to light up the room.

“I think this is the end.” Freesia commented. “If there’s nothing here, then there’s nothing here. As soon as I’m done searching, I’ll take us both back to my place.”

“Good!” Silver exclaimed, before yawning. “I just want to sleep at this point, Freesia. I think we’ve been here much more than an hour.”

“Ugh! Tell me about it!” Freesia complained, and then shrugged. “Eh, I can take tomorrow to sleep this all off.”

“Is that ok with your boss?” Silver asked.

“Of course it’s ok with my boss. She’s me.” She joked. “I’m self-employed, kid.”

“Kid? You don’t look much older than me.” Silver retorted. "And I'm no kid!"

“I get that sometimes. I’m actually 22 years old. You're 14, aren't you? That's a kid to me.” She replied. “Now, let’s see… There’s a pile of papers here and… EUREKA!!!”

She pulled out a slip of paper from a pile.

“There it is!” She exclaimed. “Written right there! ‘Research originally published by Dr. Sow-Had. Research Project: Replica Solaris time machine thesis and calculations… Let’s see… A few results here, I’ll go through them later… HERE! Research Project: Limits of Chaos Control using a replica chaos Emerald’! This is it! This is it! We did it! I’ll just grab all the other papers here and I’ll sort through them later!”

She excitedly grabbed every last slip of paper she could find and stuffed them into her bag.

“How are we going to get out of here?” Silver asked, the mission seeming completed.

“Don’t worry! I got our ticket right here!” She gleefully cheered as she pulled out a blue chaos emerald.

“That’s a… Chaos Emerald!” Silver exclaimed. It wasn’t every day that someone had a powerful jewel in their possession. What were the chances that a complete stranger he just met had one?

“Looks it, doesn’t it?” She explained. “It’s actually a fake. There’s a few of these out in the world. I have two of them, in fact. They have the same wavelength and properties, but just have no real power to them. Anything that they are capable of has to come from the user itself. I’ve been using these for a while, so I know how to do this. Just come closer to me, and I’ll have us home in no time at all.”

Silver didn’t waste much time in closing the small gap they had. He handed her flashlight back and she placed one arm around him, holding the fake chaos emerald with the other.

“Here we go…” She said as she took in a breath. “CHAOS CONTROL!”

In a brief flash of light, their presence vanished from the dark and dilapidated labs, leaving it abandoned once more.

Chapter Text

Chapter 5 - Rest and Recover

A flash of light appeared as the two hedgehogs teleported into a room by the front door of a small house. Freesia nearly collapsed to the floor as she propped herself up using her mallet. Even in the darkness, Silver could see she looked very drained from that experience.

“Are you ok?” He asked, wishing he had any rings with him to help her recharge her strength.

“I’m fine, Silver.” She replied, very out of breath. “The… downside with replica emeralds is… Using Chaos Control really takes it out of you… It’s why I used the mirror to enter instead of teleporting directly… It… It’s a lot less exhausting. I’ll be fine in a moment. Hang in there and I’ll switch the light back on…”

Freesia struggled to catch her breath for an awkwardly long time, which felt even longer since Silver was in the darkness could only watch and listen. After what felt like a minute without her condition changing by much, he used his powers to light up the room around him, covering everything in a faint, cyan light. The first thing he noticed was a small bulletin board of sorts, full of various pins for various orders of flowers and a few photos as well as an old Broadway ticket to a musical called ‘Balan Wonderworld’.

The various photos included a dark-coloured female hedgehog who looked dressed like a nurse, and a male hedgehog who looked to be dressed like a university professor, despite the fact that male hedgehogs aren’t normally dressed in anything further than gloves and shoes. It was hard to tell the colour of their fur against the light of his abilities.

There was only one photo of all three of them together, with Freesia standing in the middle at what appeared to be a park area in a big city that he knew wasn’t Station Square. He could only assume that they are her family or close friends.

Next to the board, he found a light switch, which he flicked to light up the room.

A warm yellow light began to brighten the room, allowing him to see the photos more clearly. The dark female hedgehog was a dark indigo colour with pinkish highlights. The male hedgehog was a bright green in colour. Silver could only guess the male hedgehog is her father.

As he continued inspecting the board, he noticed other items like letters from friends, a receipt from a bizarre sounding shop called the ‘Ventos Venporium’ with a note written at the bottom mentioning what sounded like a small location in Soleanna Forest.

Before he could look any further at the busy bulletin board that almost spilled the important aspects of Freesia out for plain eyes to see, she tapped him from behind. She had finally caught her breath.

“You can continue looking at that in the morning. Let’s get you to bed.” She said in a surprisingly motherly tone, her eyes meeting with a clock on the wall. “Goodness! It’s 2AM! We’ve been out way past bedtime!”

Silver tried to take in his new surroundings. The walls were a light green, and it looked very lived-in. There appeared to be an upstairs, a small dining room with only a small table and two chairs, a small kitchen in the next room with chequered yellow-brown wallpaper, and a small backyard connected from the kitchen. It felt very homey. Despite being a stranger’s house, Silver already felt like a guest that was welcome to visit.

However, it wasn’t long before Freesia started ushering him up the stairs. She took his hand and gently pulled him up, which he followed without resistance. For a moment, an image from his non-existent memories came to mind. The dark of night with a star-studded sky, while he walked across the tops of the buildings in Soleanna’s Castle Town.

“Two heads are better than one when looking for someone!” He remembered. There was a faint voice attached to those words. As he looked ahead in that memory, he saw Amy Rose, eagerly pulling his hand, dragging him unwillingly to elsewhere.

‘Amy…?’ He wondered. ‘I wonder who we were looking for…’

Eventually, his memory ended as he came back to the present moment, Freesia had led him to the doorway of her bedroom at the top of the staircase.

“You can sleep in my bed tonight.” She explained. “The bathroom is to your left. Rest as long as you need.”

“What about you?” Silver asked, trying to politely resist the sudden push of hospitality. “I mean, I’m fine to sleep on a couch or something.”

“Are you kidding? With a discovery this big, I couldn’t sleep even if I wanted to!” She answered as she dragged him into her bedroom. “No need to be polite with me. With all you’ve done to help me, a complete stranger, with something that barely related to anything about you, you deserve the best hospitality I can give.”

She quickly ran ahead to open the doors to her bedroom and bathroom, turning on the lights for both of them.

“If you want, you can take a shower first, but please, I insist. You can use my bed. I’ll be downstairs sorting out a few things.” She explained. “If you need anything, don’t be afraid to ask. Just… relax here. Make yourself at home. We can discuss your memory thing in the morning. … Well… When the sun is up anyway…”

Freesia gave Silver a soft pat on his front quills. It was gentle as she stroked back over his head, causing the quills to spring back into position when her hand left them.

“Just… take care of yourself, Silver.” She spoke, gently and reassuringly. “Sweet dreams.”

She looked him in the eyes one more time. After blinking once, she turned around and walked downstairs, leaving Silver to settle down in on his own.

He walked into the bathroom first to have a quick shower after the day he had. He noticed the tiles were a reddish-pink in colour with a warm yellow light shining down on an eggshell blue bathmat. He walked into the shower and let himself relax a little in the warm water.

When he was done, he dried himself off with a towel that was handing on the rack and let the towel hang over a laundry bin to let her know it was used.

He walked into Freesia’s bedroom cautiously and slowly looked around.

‘I guess if she insists…’ Silver thought to himself. ‘It would be nice to sleep in a soft bed tonight. Maybe I can trust her. She seems to be hiding a lot of things, but she hasn’t shown any real threat either. I’ll just see where this goes. While she is strong, I could take her on if she couldn’t be trusted.’

He walked inside and turned on the bedside lamp. It was small green lamp on a bedside table that matched the lime-green walls. It was a single bed with pink sheets and red blankets. On one end of the bedroom, there was a dresser with various dresses, shoes, and minor accessories. On the other side, there was a large bookcase. Curious, he looked over the books in her collection.

She had various books on a variety of different topics including:

• The Project Shadow Conspiracy – The story G.U.N tried to bury
• Professor Gerald Robotnik – The Visionary Betrayed by his Government
• Sonic, The Shattered World, and the Gaia Manuscripts by Cucumber G.
• Phantom Ruby – How it revolutionised VR gaming
• Little Planet and the Seven Stars of Time
• The Black Arms – How they invaded and how they were stopped by one of their own
• The Eclipse Cannon – Earth’s most dangerous weapon and why it was deactivated
• Soleanna – The Island of a Hundred Wonders
• The Ultimate Lifeform who went M.I.A – The Mystery of Shadow the Hedgehog’s Fate
• Sonic – The Hero of the World, Zero to the Public (How Earth’s Greatest Hero Ruined his Reputation)
• Sonic and Humanity – A Discussion About Species
• The Rookie who Could – The Story of How a Nobody Saved the World
• Chaos Theory – From Emeralds, to Drives, to Space-Time Manipulation
• Chaos Emeralds – A Comprehensive Guide
• Making Mochi at Home the Traditional Way
• The Inspiring Medium of Floral Arrangements
• Eggman – The Man who Made the World Tremble
• Maria Robotnik– How one tragic death nearly destroyed the world

There were many more, but he didn’t want to go through them all. He couldn’t help but notice that there were many books written about Shadow and the Space Colony ARK. Silver heard of it, but he never saw it himself. There were a few stories about Sonic too, which would make sense. Someone like him would likely inspire many to record his achievements for the future. However, Sonic wasn’t looked at completely favourably if the titles were anything to go by. He could only assume something controversial happened during the course of time.

Getting ready to make his way to the soft bed, he turned on the light above, leaving only the lamp illuminating the room.

‘At least I’ll be able to research anything I need to know about the past here.’ He thought to himself as he got ready to get under the blankets. He saw a book on the bedside table. He presumed it was the one Freesia was currently reading through. Judging by the bookmark, she was already close to the end. It was titled ‘ARK – Everything You Need to Know, and Everything We Don’t’. As he got under the blankets, he opened the book up to the first page. After the title, there was a brief acknowledgement:

To my family.

Thank you for supporting me,

Even when the pressure made things feel like an illusion

After that, there was the contents page. It seemed to be broken down into history, with subsections of the timeline of events before it became abandoned completely, the scientific advancements made aboard it, and the mysteries and controversies surrounding it, before it concluded with a final recap and special transcript of an interview with Shadow.

He turned the next page and started reading.

Forward by Shadow the Hedgehog

When I was made on the ARK, I remember spending some of the earliest days of my life staring out the window towards Earth in wonder of what could be down there and what the purpose of my creation was. It was like how many children on Earth look up towards a starry sky and wonder about tomorrow, about life, about purpose. It was a window with a view I’ve never seen. Those were some of the happier memories I carry to this day. Of course now, I don’t think and wonder like I used to. I no longer ponder of my purpose or meaning in life. I feel as though it is mostly already fulfilled.

There are many things I can say about the Space Colony ARK. It was where I was created. It was where the Eclipse Cannon was fired. It was where many weapons of mass destruction were built, but also where many other scientific breakthroughs were made. It was where most of the earliest, and to this day most detailed, reports were made about the ancient Gizoid robots. It was where I was given a soul as another step to bring mankind towards immortality and eliminate disease. It was where the chaos drives, of which we rely on to power our robots humanely, were invented.

While I cannot speak much on behalf of my creator, Professor Gerald Robotnik, I can speak on behalf of myself and everything I know and have experienced from both my life there, and the few occasions that I had returned for one reason or another.

When I was approached to give testimony and provide additional details about the now defunct space station, I was reluctant at first. However after seeing the final results of this documentation carefully put together and that the curator was not afraid to mention the controversies of my creation, as well as the tragedy of Maria and the impact it left on both my creator and I, I found myself more inclined to give my two cents worth. After all, the Eggman wars were over, and a time of peace is also a good time to reflect on our past mistakes so we don’t repeat them and plunge the world into chaos once more.

This book you are holding is the result of a deep reflection of both scientific accomplishments of one of the most brilliant minds of yesteryear, and the incident that tried to undo it all for sake of war. Here you will find anything there is to know about Project Shadow and its controversies, the Artificial Chaos, the Eclipse Cannon, what life was like living there, and why, even to this day, it still remains a testament of scientific accomplishments.

However, it is also a record for some of the darker aspects of our history. It is also a story of government corruption and cover-up, needless death, and the tragic tale of a grandfather’s love corrupted by grief that nearly spilled the end of the world. This book also highlights what we don’t know. Many of the secrets aboard the ARK are lost to time. I can only fill in the gaps with what I know and speculate what I don’t. Though, I guess that could be said of anything, really. As for those parts, they will forever remain in the darkness, and it is probably for the best it remains that way.

To whoever reads this, I can only hope that you can learn to stray from the path to darkness when it happens. Should ever any of the heroes of our time or their respective descendants read this, keep up the good fight. Thank you for your patronage and I hope you can understand, even for a moment, reality as I once knew. An inverted place without flowers, bagels, and currently devoid of life as it stands now. A place where one can only look to Earth and hope that there is more meaning to the world.

Silver felt a little taken aback from the excerpt. While he never knew Shadow as a bad speaker, he also never knew that he could also hold certain eloquence to his words either. It almost felt depressing. Though he met and got to know Shadow in the past, he never knew that Shadow wasn’t born. He always just thought that he was being a little egotistical when he kept calling himself ‘The Ultimate Lifeform’.

‘Must feel strange to have been made…’ He thought. ‘And this professor Gerald guy? His last name is Robotnik. Does that mean he and Eggman are related? Wait, yeah, I remember that name! Gerald was one of the few scientists in his lineage who were well-respected. I think I remember Eggman- Nega mentioning something like that. So I guess that’s the lineage… Freesia introduced herself with Robotnik as a fake last name (fake as far as I know, anyway). She’s certainly not doing herself any favours with a name like that, but maybe it’s in honour of Gerald? I guess I might find out more tomorrow. Maybe this book has a bit more to go off…’

But as he continued to the first part, which described the design and construction of the space station, he felt the tugs of exhaustion get the better of him and he fell asleep with the lamp still switched on.

If there was darkness out to get him, it would not reach him yet. He was safe for the moment. Ever since he came to the strange future, he felt a strange peace he hadn’t felt in a while. It was a peace that assured him that for the first time in a while, he was safe and he didn’t need to fight anymore. Even if it wasn’t a peace that would last, he could at least enjoy the feeling in the moment that night.

Chapter Text

Chapter 6 - A Bright and Sunny Day

When Silver woke up the next morning, he noticed a sugary smell in the air. When he got to the bottom of the stairs, he noticed Freesia was out cold on a couch with a note left for him taped to her face.

Silver,

Fatigue caught up to me finally. However, breakfast should be on the table for you. Hope you like pancakes! There should also be a small pouch of rings on the table too. I’m likely to be out for a while, so think of it as some pocket money. Soleanna is a place with a lot to discover. I’ve lived here for about a year and I’m still learning more about this place.

So go and explore for today. Just please come back by the afternoon if you want dinner. I was working on calculating if my replica chaos emerald could allow me to travel to the Space Colony ARK next.

I’ll explain everything later.

Just go and have fun now, hero.

~ Freesia

As Silver made his way to the table, he noticed a small stack of pancakes with syrup on the side, ready to pour. They were cold.

While not the most ideal, he took a seat, grabbed a fork, and starting eating the short stack.

The flavour was surprisingly good. The pancake itself tasted like a vanilla cake, yet the syrup still managed to add to the flavour. He could taste creamy milk, vanilla bean extract, and high-quality egg, all mixed together and cooked until golden and no further. It was fluffy in texture too, like an heavier edible foam. The balance of sweet wasn’t overblown. He only wished he got up earlier to try them fresh. The only downside was that he still needed a glass of milk to wash it all down.

When he finished, he politely put the plate and cutlery into the kitchen sink, and briefly took off his gloves to start washing up. As he got the sponge and soap into warm water and started scrubbing off the syrup residue, he looked out the window into the back yard. There was a little tree growing right in the middle. Looked like an orange tree or something similar. There was grass, various flowers along the sides of the fence, and a couple beige stepping stones in the middle. Looked like a peaceful spot to just lie back and watch the clouds during the day, and the stars at night. But he wasn’t going to do that right away. He was just washing his dish and cutlery and was about to explore what else the bright future had to offer. When it was clean, he placed them into the drying rack, and dried his hands off before putting his gloves back on and inspecting the pouch of rings.

He counted them. There were about 500 rings altogether. He almost felt guilty about even seeing that much, but he was grateful that he had pocket money. He spent all his remaining rings on the cannoli the night before. He didn’t have many rings with him very often. So, he took the pouch of rings, and headed out the door, giving a polite wave to the unconscious Freesia before heading outside.

He looked outside, and he knew roughly where he was. He was in the suburban outskirts of Soleanna’s New City.

He decided to explore and have some fun.

This was his future.

No doomsday. No Eggman. No struggles for justice.

He was going to enjoy it!

He started by heading down to the beach. He made his way to Wave Ocean. He had seen beaches before, but he never visited one within his own time. When he got into the cool and clean seawater, he stepped in and swam out.

Even though he never did it often, he was a good swimmer. He was at least skilled enough to handle a 10km marathon at the Olympics. Unlike Sonic, he was buoyant enough to not sink (or at least able to make himself artificially buoyant with psychokinesis if necessary). He swam out a little and felt the gentle rocking of the waves. He decided to swim from one end of the monitored area of the beach to the other. It was nothing strenuous or extreme like an Olympic event, just enough to enjoy the water.

As he thought about his time in Aquatic Base, he knew he had a feeling of Déjà vu. He had visions of something he couldn’t place. The flame. The girl. The black shadow. He thought back to those moments. He remembered Shadow was with him. But he didn’t remember why.

“Is that…?” Silver remembered exclaiming. “That flame… It’s Iblis!”

He thought about that moment.

“Iblis…?” He pondered. Saying the name out loud made him shudder uncontrollably, like he just summoned a great evil onto the world. The only other name that gave him so much dread was the Ifrit from a previous adventure. But something about the word ‘Iblis’ felt so much worse.

In that vision, he remembered seeing Shadow there with him. But there was no context.

‘Did… Did Shadow experience this too…? I guess I could ask him next time I see him, but who knows when that’ll be.’ He wondered. ‘This strange déjà vu… Those visions… What does it all mean?’

He decided to push past those thoughts and enjoy the rest of the day. He wasn’t getting much further in uncovering the mystery. He decided to swim back to the shore.

When that was over, he bought himself a small bottle of ginger ale and some pizza from a pop-up kiosk using the rings Freesia left him.

When it turned to early afternoon and the waves began to pick up a little, he decided to have fun in the sand.

He scooped up handfuls of sand from the shore and tried to pile them up. He managed to make a small platform. He tried stepping on it, and sunk a little. So, he pounded the sand a little more firmly. He stepped on the sand platform again, it held his weight.

He wanted to take it a bit further. He wanted to be taller.

He started taking out bigger scoops of sand using his psychokinesis and stacked it on, using his powers to press the wet sand down firm. The platform was starting to form more like a short tower that was about his height. As he stood on it again, he finally learned what it was like to be as tall as a full-grown human.

He wanted to go further. He wanted to stand taller.

He levitated further down the shore and took bigger and bigger mounds of wet sand and piled it on like stones on a tower in Kingdom Valley.

The more he built, the more he wanted to build.

Before he realised, he made a tower as tall as one of the older buildings in the New City.

The light of the setting sun was shining on him, and he decided to stand atop his towering achievement.

“I am the Master of Time and Sand!” He boasted like a king surveying his kingdom. “I control the sands of time!”

However, as soon as he uttered those words, he began to sink into the tower a little. The sea breeze began to topple the tower, and it broke. The top of the tower, and Silver included, fell back to the ground. Chunks of wet sand and partially dried sand buried him up to his eyes.

People both human and mobian looked and laughed. Not laughing at him, but laughing at the silliness of it all. A young human boy offered to help him out of the sand pile. He accepted the help and was quickly pulled out. Silver noticed the boy had a golden badge with a sun on it. He thought it was a strange thing to take to a beach, but didn’t think much else about it. He was just glad to have surfaced from the ocean of sand.

“Pah! PSSFFFF! PSSFFFF!” He spat out as much sand as he could. “Pah! Put-put!”

“Ugh.” He grumbled as sand made its way into everything. His shoes, his gloves, even the pouch of rings. “It’s gonna take forever to get it all out…”

He decided to call it a day and walked back to Freesia’s house. Sand was steadily dripping off him as it began to dry. As he walked towards the door, he gave a gentle knock.

“I’ll be right there!” Freesia yelped as she ran to open the door.

She looked surprised to see the amount of sand over the psychic hedgehog.

“So…” She smiled a little as she spoke. “Did you have fun at the beach?”

Silver gave a small nod, but kept his head down in shame.

“You can tell me more about it when you get cleaned up.” She explained as she stepped away from the door. “I’ll get a brush!”

She shut the door in front of him and reappeared with a brush for a dustpan and started brushing him down, forming a small pile of sand by the doormat.

When she got most of the loose sand off him, she let him inside.

“Head up to the shower. I’ll get the vacuum on the floor in the meantime.” She told him.

Silver did so. The warm water felt nice as he felt the grains start to rinse off him. 

He struggled to get all of the fine grains out of his boots and gloves. He even found some sand in his ears.

‘It’ll take forever to get rid of it all…’ He grumbled in his head. ‘Why did I think going to the beach was a good idea? What a pain…’

Once he managed to get rid of most of the sand he could find, he headed back out. Freesia seemed to have made risotto for dinner.

“Like I mentioned on that note, I need to talk to you about what happens next.” Freesia explained as she got the table ready. “I hope you are okay with that.’’

Silver gave a small nod as he walked to the table and was served a bowl of food. There was also a bottle of chilled water on the table and two tumbler glasses ready.

The green hedgehog served herself, and then sat down.

“Ok…” She took in a breath and continued. “I have a lot to say, so I hope you’ll hear me out.”

Chapter Text

Chapter 7 - Dinner Talk

“Before I get started on my side of things,” Freesia explained. “I want you to tell me everything about what you were saying about your memory issues. I noticed you looked a little uneasy when we searched Aquatic Base. Did you remember anything?”

Silver took in a deep breath, and then began to explain.

“Yeah. But not much. A few images flashed in my mind. I remembered seeing a flame, like a miniature sun, growing in size and threatening to burn the world. I remembered seeing a black shadow on the ground. I think… I also saw Shadow there with me. It was as if I was right there in Aquatic Base back when it was new. And… A word came to mind. Iblis. I think it was the name of the growing flame. And when I thought about it, I had this feeling of cold dread wash over my body. I think it was the name of something really evil and it's haunting. Oh! I also remember seeing this little girl with red hair and an orange outfit. Since you know a lot about Soleanna, can you make any sense of this?”

Freesia took in a mouthful of food, and pondered for a moment.

“Uh-huh.” She nodded. “Yeah. I don’t know much about this thing called ‘Iblis’, but the girl… If you can bear with me for a moment, I think I have a book somewhere in my room. Hang on a second…”

She left the table and walked upstairs for a few moments. Silver had another couple spoonfuls of the risotto while he waited. It was pretty good. Almost restaurant quality. After a minute, Freesia came back down with a thick hardcover book titled ‘Illustrated History of Soleanna’s Royal Family’.

“This wasn’t a cheap book, but it is an interesting read about the royal family and how they were recorded in history here.” She explained as she opened up the pages and flicked through them. “It’s a bit of a long shot, but give me a moment to find the right page… and… Here!”

She opened the page to a red-haired monarch and held it to the white hedgehog. It was Princess Elise the Third. While most of the photos were of her as a teenager and young adult, there was an old picture of her when she was around 6 years old. While she wore a different outfit, she was the very girl Silver remembered.

“But…! How!” He exclaimed. “That’s her!”

“A lucky guess.” Freesia explained. “I figured if you remember Aquatic Base while it was still pristine, you either remembered something from a researcher’s ‘take your kid to work day’, or you saw one of the monarchs as a small child. It was pristine around 200 or so years ago, so I did a rough guesstimation that it was during the reign of The Duke. That’s his daughter, the Princess Elise the Third, at least she was princess anyway. She had her coronation when she turned 20 and her reign was friendly to mobians to such an extent that Soleanna was jokingly called a 'Haven for Hedgehogs' back in the day. If this is her, whatever you remember happening in Aquatic Base sounds like something went horribly awry. Let me take the pages back a bit…”

She flicked a couple pages back before stopping again.

“This is the late Duke, Elise’s father.” She explained. “Does he seem familiar?”

Silver gave a good look at the royal figure. He looked tall in a white coat, with a white fez and black boots. The coat had the Soleanna emblem on the front. He seemed to have a bit of age to him as he had grey hair and short beard.

Though, as he saw the human in the photo, he felt something triggered within him.

Another vision came to him. He remembered using psychokinesis to hold Iblis in place, while the Duke approached him. The Duke brought out a chaos emerald, and Iblis vanished. Soon after, he fell to the ground and stopped moving.

“Yeah… “ Silver answered. “He does seem familiar. What can you tell me about the Duke and Elise?”

“Well… I am not a royal history buff,” Freesia explained as she put the book down and went back to the table. “But I know a little bit. The Duke lost his wife, the Duchess, when Elise was only very young. It isn’t mentioned what killed her, but it was widely believed to be of natural causes. The Duke never remarried, leaving Elise to be the only surviving heir to the throne. However, he was more than just a leader. His passion was also for scientific advancement. He was a head scientist in the Aquatic Base research centre. Some say he was the leader of the Solaris Project, though that’s just rumours. It appears that in another time and place, you witnessed the Solaris Project, and you saw what happened. Do you remember anything about the project?”

“I remember…” Silver mumbled a little as he tried to put the pieces together of the fragmented memories with the new information he just learned. “I remember that it went wrong. That flame and that black shadow were the result. The Eternal Flames didn’t die, they changed into something that threatened the entire world. The Duke… I think he died. And the princess…”

He felt another memory trickle back. It wasn’t much, but he remembered the feeling of a young Elise in his arms, and the simple sight of her asleep under a tree at the high ground of Kingdom Valley. He felt terrible for the young girl. He knew she suffered something great at such a young age.

“It’s a lucky charm.” He remembered saying. But he couldn’t remember the context as to what that meant.

“…The Princess was ok, but she was orphaned.” He continued a little. “And I don’t remember much else.”

“That’s okay.” She tried to comfort him. “From what I can gather, you saw something terrible take place. I’m sorry that you saw things like that at such a young age. Whatever you did, I’m sure you were very brave. But if there are some things you don’t want to remember, don’t force them. Know that I am here to answer any questions you might have about these strange memories. Just be aware that there’s only so much I know. Take care of yourself. You might be able to change the future, but you can’t undo your own past. Trust me, I know.”

Silver nodded.

“I will.”

He took another bite of risotto.

“Alright.” Freesia took another mouthful of risotto and continued. “I’m going to explain my findings and calculations from last night, if that is ok.”

Silver nodded again.

Freesia nodded in turn.

“Last night, I collated the data-!” She explained.

Silver developed an expression that could only be described as sheer perplexity. He never heard that word before.

“That means I organised it.” She explained. Silver’s face began to relax again and he nodded to show he understood.

“I looked though and organised the data.” Freesia continued. “Like I was hoping for, it was results on experimentation using replica chaos emeralds and how far they can be used for Chaos Control before they disintegrate. The answer: It could, in theory, take me to the Space Colony ARK, and then disintegrate. So, it would only be a one way ticket for me. However, I could boost its potential using chaos drives. So I might be able to take both of us there. However, there is still the issue of return travel.”

Freesia looked a little down about the news. She paused for a moment to have a few mouthfuls of the rice mixture.

“Fortunately, I have 2 replica emeralds.” She continued, her tone turning very serious. “Unfortunately they are difficult to come by. In fact to some extent, it’s just as hard as the real deal. As much as I never want to lose these replicas, they’re our only option to get there. This means we only have one shot to get there and back in one piece. I have studied everything I could about the ARK, from conception, to Project Shadow, to the Artificial Chaos, to even the de-weaponization of the Eclipse Cannon. Even though no scientist has ever come to visit there in years, that doesn’t mean it isn’t full of its own dangers.

“I have heard rumours of something being sealed away there from alleged Ex-Child members through an old informant of mine. A monster taking place of the Biolizard, wandering, looking out, and threatening anyone who dares come on board. They say that, one day, soon after Dr. Sow-Had vanished, a monster was found within a basement of an underground lab or underground prison. Some speculated that Sow-Had was killed by this monster in his research, and the monster itself was so dangerous, that any evidence of the scientist was wiped off records to prevent the public from digging deeper and learning what lies and waits in the darkness.

“Of course, this is just rumours and conspiracy theories, but when there is little information about something, it can be the only thing to go off. I heard that this monster was sealed away to the ARK to contain it. After all, it was de-weaponized, abandoned, and just floating there. There is one more piece of Dr. Sow-Had’s research I need to find. His final papers on the nature of chaos energy and its effects on time and space. According to his diaries, he did that research aboard the ARK.”

“This feels pretty dangerous. Is it worth it? Is it worth risking your life for the chance to uncover the past?” Silver asked. “Why is this so important to you? This is just a hobby of yours, right?”

“Well… “Freesia paused for a moment. “Ever since I was a little girl, I was invested in the mystery of Dr. Sow-Had. My mother used to show me his diaries. My grandmother kept them hidden since his disappearance. The more I learned, the more questions I had. The more I knew, the less I understood. The more I understood, the more I realised I didn’t know. As I studied chaos theory, chaos energy, and chaos abilities to understand the journals better, I realised I inherited more than a set of diaries from a missing scientist. I inherited a mystery. The mystery of what sort of relationship he had with my grandmother for her to be trusted with his journals. The mystery of what led to his disappearance and why he is scrubbed from most official records. The mystery of who he really was.

“I suspect that his name was a pseudonym. I mean he had what he sowed. I also want to know who he really was and what sort of history he had. The further I dug into this mystery, the more I just want to close the book for good. I won’t go into too much detail because I don’t want to burden you with my life story, but I lost a lot in my pursuit of this and a good part of me wants to finish what I started because I’m at the point of no return. I am so close to putting the last piece together and figuring out what happened to him. And now I have a chance to end this. Though, there is also another reason. There was an organisation involved with his disappearance.” She continued.

“Someone else involved?” Silver inquired. “But who?”

“It’s a group who call themselves the ‘Children of Faust’.” She answered, getting up and walking towards the window to shut the curtains before continuing. “I guess I should explain who they are. They are a group who came out of nowhere, and it’s unknown what their goals are. However, I’ve seen their members around wherever I go. It doesn’t matter where I live; I keep seeing their insignia, a golden sun. Usually in a crowd, and usually in broad daylight, but I see them. I think I’ve made the list for them. I’ve had to cease communication with my father over it and had to change my last name so they don’t hurt my family again. I suspect that they are involved and, I’m sorry, they will likely target you next. They’re likely targeting you by proxy of even crossing paths with me. If I am going to be targeted by them, I’d rather have all the answers together before something happens. At least that means it won’t be all for nothing in the end. If I’m lucky, I can expose them for what they did and take them out!”

“So… You’re risking your life out of curiosity and revenge?” Silver asked.

“Well, not exactly… but sort of.” She answered. “I know this is a bit much to ask, but will you help me one more time? I don’t know how dangerous it will be, but I do know we’ll only have one shot at it. I’ve read a lot about some of your achievements, like your contribution in the resistance against the Eggman Empire. Originally, I planned to go myself, but after last night, I realised that this is something I can’t afford to do alone. I’ll need every bit of help you can offer. I don’t know how to pay you back for any of it, but I would be indebt to you for the rest of my life. I know this is a lot to ask for, so I won’t put the pressure on you or force you to say yes. I’ll let you come to that on your own. I guess for now… Let’s just enjoy dinner. I’ve also made us some mochi for dessert. It’s in the freezer. I pounded it myself and filled it with some ice cream. I hope you’ll like it.”

There was silence in the air. Not a tense silence, but a natural quiet that happens when carefully thinking something through.

“I’ll think about it, Freesia.” Silver answered.

Gradually, they ate their serving of dinner, Silver explaining what he did in the day, Freesia chuckling a little when he got to the sand incident. After dinner, Freesia served the mochi. It was black sesame flavoured. Silver thought it was a bit of an acquired taste, but didn’t find it completely disgusting.

“It’s fine,” Chuckled Freesia. “I didn’t like black sesame much at first, either. I also have chocolate if you’d prefer?”

Silver nodded, and Freesia provided. He found himself liking the chocolate ice cream more, but he liked sweets in general.

“I know this is going to sound weird.” Freesia pre-empted a little, her face turning a little serious. There was a slight pink tinge to her muzzle in embarrassment. “But there’s something I feel like I should tell you. Even though we only met last night, I can’t help but feel as though… I know you. Like how you felt with Soleanna, I knew of you from history books, but I feel like there is something more. I have no memories of you, or anything like that, but I can’t help but feel like… you have ties to my past. It's like I can feel it in my blood!

“I don’t want to go over my entire life story, but I hope you can hear me out with a few little details. I never knew my grandparents personally. All I know is what my mother told me, and she didn't tell me that much. Before I started living on my own, she told me something big about my life. She told me that she was a time-traveller.”

Silver’s eyes widened. He knew that he wasn’t the only one capable of travelling through time, but he didn’t know anyone else who had actually done so.

“More than that…” Freesia explained. “It was actually the opposite situation to you, Silver. She wasn’t from the future, she came from the past. When she was very young, she was sent to the future, in this timeline, for no known reason. She only learned of her past thanks to a robot built by Miles Prower to track her down through the ages. A sweet thing. We called him ‘Capsulo’. He led her to the diaries in a time capsule, and to any last remnants of her family history. If you ever heard of her, she was called ‘Memori’. Unlike me, she felt satisfied with what she had of her family, and she eventually met my father and instead of looking to the past, she looked to the future.

“When I inherited that mystery though, I couldn’t let go. I had to know. Why was my mother sent through time? What happened to Sow-Had? And what relationship did he have with my grandmother to trust her with his secrets? I had to look further to find any trace. And so far, I have found some of his scientific discoveries, and I knew that he was from Sonic’s timeline. He had ties to Sonic, Knuckles, Miles Prower, and even the Ultimate Lifeform, Shadow the Hedgehog. He worked for G.U.N’s R&D division. And he had the knowledge to uncover the secret of time travel. From all of that, I believe he sent my mother and one other small child forward in time. And if the Children of Faust were involved with his disappearance, then it was possibly to prevent them from doing to her what they did to him. Even if it is strange and doesn’t make sense in the grand scheme of things, there is a piece that I am missing.

“That’s all I know and it doesn’t have ties to anything. In fact, I’m sorry I told you that. It doesn’t involve you. Just for some reason, I feel like you’re more than just a guest here. Like you’re a little brother I never had. Whatever happens, and whatever your choices, I will try to keep you safe and taken care of, even if it kills me. I know that seems a bit dramatic, but it is the truth.”

Silver recoiled a little at that in surprise. He never had anyone show that level of kindness aimed towards him before and especially not that quickly. It was a lot to take in. But, despite that, he didn’t feel anything ill-meaning about Freesia. In fact, he didn’t want to admit it directly because the atmosphere was already a little awkward, but he found himself somehow able to understand what she was feeling.

‘It’s weird… Especially that out paths crossed like this. But… For some reason I feel like I can trust her. If what she is saying is true, I wonder what ties I might have to her past. I wonder what ties she has with mine?’

She finished her last bite of black sesame ice cream and wiped her face over gently with a napkin. Her facial expression started to perk up again to something more cheerful.

“You know, I’ve decided.” She started again, Silver barely processing everything else she said so far as he took another nibble of the chocolate mochi. “You shouldn’t be involved with what I am doing. I’ll be heading up to the Space Colony ARK tomorrow morning by myself. If anything happens… Silver… Everything you see in my house before you… everything in it… It’ll all yours…”

Silver’s eyes shot up in surprise.

“WHAT?!” He exclaimed, choking a bit on the ice cream.

“Silver.” Freesia calmly explained like it was something as casual as asking him about breakfast. “It’s ok. I’ve read of you and your heroic deeds in the past. I have read of the disasters you’ve prevented. I admire everything you, Sonic, Shadow, Knuckles, Tails, and co. have done to ensure the future is as bright as this. You have fought so much for people like me. But as far as I am aware, you don’t have anywhere here to call your home. I am fine to give you a place like this to call home. You should rest easy. I’m not going to risk your life for something I dedicated my life to.”

“Then I’ll go with you.” Silver replied, taking a final bite of his mochi. His expression was dour, yet was a little hard to take seriously with chocolate ice cream smears on his face. “I may not know what is going on, or what this means to you, but I’m not going to let you die over it. Between the two of us, we have a good chance to get back in one piece.”

Freesia looked surprised for a moment, then smiled gently.

“Thank you so very much.”

She grabbed a napkin and wiped his face like a mother to a small child before she gathered the bowls and cutlery and began to wash them.

“You can use my bed again if you found it comfortable.” She said. “It’ll be a big day tomorrow. It’s not every day that you can go into space.”

“Wait!” Silver wondered. “Don’t you need to work tomorrow? You already took today off.”

“I’m so close to completing my goal.” Freesia answered. “I can take a small financial hit if it means everything I’ve been working towards is within my grasp. If you were me, could you wait?”

Chapter Text

Chapter 8 - Lost ARK

Silver slept in Freesia’s bed again, continuing to read the book on the Space Colony ARK. Though, he got bored with the history segment and decided to look at the book on the Phantom Ruby instead. He found it interesting that Phantom Ruby VR games are not only passive simulator games that have no risk of injury, but also have a timed suppressor that automatically boots people from the game so they still function in the real world and get adequate sleep, exercise, and food intake. Because of this, they only managed to gain niche popularity.

Eventually, he got a decent night’s rest while Freesia slept on the couch again.

She made scrambled eggs on toast for breakfast. They were cooked with milk and butter and served with a sprinkle of cheese melted on the top. Silver found it delightful.

After a few minutes of preparation after breakfast, they were ready to set off on another expedition.

“Ready, Silver?” Freesia asked, holding out her blue replica emerald. “This is going to be a little intense, but I promise we’ll get there safely. I have used these time and time again. I know what I am doing.”

“As ready as I’ll ever be to be honest.” He replied, a little apprehensive. “The sooner we get this done, the sooner we can get back in one piece, right?”

“Of course.” She replied. “I’ll reward you with something very special if we get through this. Even if I haven’t thought of anything yet.”

Silver nodded and walked towards her, mentally bracing himself for the rapid transport and the rest of the day to follow.

“CHAOS CONTROL!” Freesia called out, holding Silver close with her free arm.

In a flash of light, they both began to warp.

In an instant, they both landed on metallic ground. Silver opened his eyes, and he saw the Earth below, from a window on the Space Colony ARK.

The fake emerald she was using disintegrated into nothing more than a clump of shards, but Silver didn’t worry about that. He was just glad that they were able to travel such a distance in one piece.

Soon after the emerald shattered, Freesia collapsed to the ground. She looked like she just managed to run an entire marathon by herself after pulling an all-nighter at a warehouse job. She looked exhausted beyond anything he had ever seen. It reminded him of the time he exerted his own ESP power on a previous adventure when he tried to prevent the Ifrit from being released to the world. Reaching into the ring pouch she gave Silver earlier, she absorbed a few rings to recharge. Within a few moments, she stood back up and looked refreshed again, like nothing had happened. 

"Always keep a few rings on you!" She chuckled a little with the advice. "Or otherwise know when it's safe enough to take a rest."

Silver smiled a little. 

"I know that all too well..." He agreed. "You can't afford to rest when you're racing against time."

"I know, I learned that trick from you from the historical archives." She chuckled. "From the... Ifrit incident I believe, right?"

"That's right!" Silver jumped a little at how much the matcha-coloured hedgehog knew about him. "Umm... How much do you know about me?"

"Only about as much as what was written down and recorded to time." She answered. "Mostly just the adventures you've been on and a rough outline of what took place. Don't worry, I don't know too many intimate details about you. You didn't appear much in the history books. I actually know more about Sonic and Shadow than I know about you."

“Speaking of Shadow..." The psychic hedgehog commented, his voice echoing down the halls as the topic shifted to something a little more dour. “So... This place is where he was made?”

“Yeah. This is it. This is the Space Colony ARK.” She nodded. “This is a place where many bad things happened. Though Shadow’s creation was not one of them.”

They breathed in the stale air. Silver didn’t want to think about it, but he knew he was likely breathing the same air that existed over 250 years ago, but simply freshened up once in a while by the life support systems. It was the kind of air one would find in a crowded department store, except somehow both stale and sterile. It was bizarre. He simply hoped that they didn’t stay on the ARK longer than they had to. The strange air, the potential dangers, and just the isolation of being in an abandoned space station was already getting to him. Whatever rumours Freesia was talking about the previous night, he hoped that most of them weren’t true.

But, besides that, he couldn’t help but look towards the planet from the giant windows and be in sheer awe of the sight. He had never seen the planet from afar before. The strange blue sight, gradually rotating before him. He knew he saw a sight similar at Eggman’s amusement park, but from the ARK, much closer to it all, it felt much more personal. It was almost familiar, but not like his strange memories. He knew he had never been on the ARK before. He had no memories or flashbacks to such an event. But… He felt a strange, unexplainable sense of nostalgia.

‘I wonder how long Shadow must have been looking towards Earth from here.’ He thought to himself. ‘It’s a beautiful sight… but like he said in that book, he was looking towards Earth like I would look towards a clear blue sky… I can see where he’s coming from. This looks so beautiful… I… I still can’t believe he was made…’

“Alright,” Freesia prefaced, interrupting his train of thought. “While this place looks big, there is a better idea of where not to look. We won’t find anything on the outskirts. Though, considering the size of the interior, it is still very easy to get lost. Good thing I packed some lunch and some snacks, this might take a while. I think a good place to start would be the computer room… If it weren’t for the fact that it broke off and fell to Earth around 200 years ago during the Black Arms invasion, that is… However, according to Sow-Had’s diaries, most of the research he did there, was in the Central Control Room. And if memory serves me correctly, we can either take the Lost Colony route, or we can go through Crazy Gadget. Both ways have their troubles. Lost Colony still has lighting troubles, and is hard to navigate at the best of times. Crazy Gadget’s artificial gravity generators can be nauseating at the best of time, if they even still work right.”

She looked at Silver, and remembered he can both fly and generate light.

“Though, I guess with your abilities, either path shouldn’t be that much of a problem.” She commented. “Maybe Lost Colony might be the safer way to go for me at least.”

As they wandered through the ARK that’s been abandoned for over 250 years, there was a notable lack of dust or sense of decay about the place. It was so sterile and desolate, that not even dust and grime stained the windows. It wasn’t pristine or completely clean, but it looked as though it was only abandoned for a few months, as opposed to over two centuries.

They walked through carefully, keeping an eye out for any last remnants of anything left behind.

“In the times when Shadow was first awakened 50 years after his creation,” Freesia explained. “The only things left on the ARK were the Biolizard, Artificial Chaos, and a few G.U.N robots from the raid after Project Shadow’s cancellation. While most of them were taken care of, there might still be a few left behind.” Freesia explained.

“What are ‘Artificial Chaos’?” Silver asked, curiously.

“Exactly as the name implies,” Explained Freesia. “A creation of Professor Gerald before Project Shadow. They look like Chaos, but were artificially made. They’re a body of water given life and animation through a machine on their ‘heads’, which also serves as their weak point. A simple homing attack in the right place enough times should take care of them, from what I’ve read anyway. But beating them up enough can also do the job. They are still a threat though as they can attack with greater range than what you might expect and they move with greater speed that what you might think a creature that shape could move. They look like Chaos 0, but are just another robot. Believed to be a precursor for the Ultimate Lifeform Project.”

Silver nodded in acknowledgement.

Freesia led the way as they went down a hallway into the ARK’s interior. They came across a working elevator of sorts. It looked like a metal platform. It seemed to be weight-triggered, as the moment the both of them stepped on, it took them up higher.

It rose slowly, but consistently. They both looked up, trying to find where it might stop, but it just looked like an ongoing vertical tunnel. All over the walls were covered in strange patterns that were coloured a static blue, and glowed a pulsing red. It felt like they weren’t on a space station, but on an alien vessel of sorts with technology beyond anything either of them could imagine. The platform kept rising. Both the white and green hedgehogs looked at each other as they slowly ascended. It was an awkward silence as both of them felt a strange mix of impatience and awe. Both of them felt a little over their heads. Despite having each other as company, they both felt like they were about to deal with something beyond their understanding, alone.

For many minutes that felt like at least a solid hour, they finally stopped at a metal platform that opened down a dark corridor.

“Looks like we’re here.” Freesia commented. “Lost Colony.”

“Well, here goes nothing.” Silver commented as they headed their way down the path.

As they turned into the dark labyrinth that was Lost Colony, the rooms became very dark. With Freesia’s flashlight and Silver’s glowing aura, they could only see just ahead of themselves, leaving whatever might be ahead of them a mystery. There was a strong and sinister feeling as the only other light was the occasional pulse of red circuit patterns along the metallic walls. There was a strange buzzing going on in the background, like stray robots were active, but broken and were left malfunctioning an unknown distance away from them.

“Interestingly enough,” Freesia said, making small conversation to drown out the silence. “Even in Sonic’s time, this place was decommissioned. Everything that went on in here was shut down after Project Shadow’s cancellation. Though, even then, there were a few G.U.N robots that remained. If we find any, I don’t think it would hurt to have a few extra chaos drives.”

“I still can’t get past the fact that Shadow was made.” Silver replied, not knowing very much about the ARK itself.

“You didn’t know?” She asked, and then began to explain like a scholar or geek. “It’s one of the most well-known things about him. Shadow the Hedgehog got his namesake from the project he was created from. Professor Gerald Robotnik was tasked by the United Federation to create the Ultimate Lifeform since his previous experiments with infusing living tissue with chaos energy were successful. They hoped he would find the formula for immortality. He declined at first, since the United Federation was a lot more war-hungry and corrupt at the time and would have used it to create weapons of mass destruction.”

“That’s sick!” Silver exclaimed. “They had the potential to make a prosperous future, and all they cared about was making weapons?! That’s disgusting!”

“I know. It’s sickening what humanity, and I guess to some extent mobians too, are capable of when it comes to destruction.” She replied, before continuing. “Gerald later accepted the task when he learned that his granddaughter, Maria, contracted a terminal and incurable disease called N.I.D.S or Neuro-Immune- Deficiency-Syndrome. He hoped that his research would hopefully find a cure for the terminal illness. He managed to create a prototype, known as the Biolizard, which was capable of cellular regenerations and rapid growth, but required a life support system and had a primitive mind that made the creature incredibly dangerous. Eventually, Gerald went in a different direction. It was back to the drawing board. It was rumoured that the Professor based the Biolizard off Chaos from a mural on Angel Island’s ‘Lost World’ Zone. It was also rumoured that he based Shadow off a mural in Angel Island’s Hidden Palace Zone, depicting a prophecy of a large machine taking the Master Emerald and being stopped by a blue and spiky creature engulfed in golden light. But he needed more. He was missing a key component for Project Shadow to become a reality. He needed something beyond Earth.

“That’s when he made contact with the Black Comet, a comet that used to come by once every 50 years or so. It was the means of transit for a powerful, and dangerous alien race called the Black Arms. He made a deal with their hive mind leader, Black Doom. Doom-!”

“Wait… his name was actually Black Doom?” Silver interrupted. “That’s not just a title given to him like a title passed down in legend? That was his actual name?”

“Yeah.” She confirmed. “I know, right? Anyways, continuing from where I left off, Black Doom gave Gerald a sample of his DNA to work with, but in return, Gerald was to gather the seven Chaos Emeralds when he returned 50 years later. As to be expected, Black Doom didn’t have the best intentions in mind with such a deal. In fact, Gerald saw the writing on the walls and it was the inevitable invasion that Gerald sought to create the Eclipse Cannon (a weapon embedded on the ARK with power capable of destroying an entire planet or pierce the very stars themselves) in the first place, to blow up the Black Comet. However, from the deal, the project was successful and Shadow the Hedgehog was created. The Black Arms are a very powerful race, more than capable of chaos abilities, and are immortal. In fact, Black Doom is believed to have been over 2,000 years old. Also, according to an interview with Shadow around 200 years ago that Black Doom is still alive, and had been in contact with him once in a while. However, they are considered critically endangered in most classifications, with Shadow being the only confirmed member left of their species. Thank goodness for that.”

“Wait,” Silver inquired again. “So not only was Shadow made, but he is also part alien?”

“Yes.” Freesia replied, almost matter-of-factly. “It’s weird, isn’t it? He looked like Sonic greatly, but he was never a complete hedgehog. If anything, he only looks like a hedgehog, as far as we know, he might not have a single trace of hedgehog in his body, but who knows? But when Gerald made him, he made sure Shadow could never become a dangerous war machine like the Biolizard. He gave Shadow a ‘soul’ in a sense. Making sure he would have intelligence and personality like his beloved granddaughter. Eventually, Shadow was complete and awakened. He lived on the ARK with Maria in the meantime while Gerald began working on how Shadow could help develop a cure for NIDS. Shadow formed a close friendship with her that impacted the rest of his life.

“However, the United Federation started to get worried about the implications of Project Shadow. They got scared that what they were asking for was beyond anything humanity could handle. They wanted to cancel Project Shadow. But much to their horror, the Ultimate Lifeform was already made. So, they tried to bury the project and the dangerous information gathered about it, and the Space Colony ARK was raided by G.U.N. Several scientists were shot dead on sight, and Gerald was arrested. Shadow only managed to get into an escape pod with Maria’s help, and her sacrifice. She was among the casualties.”

“So, the government killed all those people for doing exactly what they were asked to do?” Silver tried to clarify. “Even killing an innocent girl who was wrapped up in it all by circumstances out of her control?”

“Essentially, yes.” She nodded, her expression a little saddened. “Though, the soldier who shot Maria had come out when Project Shadow was declassified and said that it was one of the biggest mistakes and regrets of his life. He suffered reoccurring nightmares of the event he killed an innocent child. We also have to remember that even people who commit atrocities can still be human deep down. Not all, but many.

“But unfortunately, Maria’s sacrifice was for nothing. Shadow was intercepted when he landed on Earth, and was kept in stasis for over 50 years. Gerald was interrogated for any information about Project Shadow and the Eclipse Cannon. Instead, Gerald grew insane when he learned his beloved granddaughter was shot dead. He planned his revenge on the whole planet, deeming humanity not worth saving and he couldn’t wait long enough for the Black Arms to invade and wipe out everything for him. He tampered with Shadow’s own memories to believe that Maria’s final words were a promise of revenge and to carry it out the moment he was awake. He also rigged the Space Colony ARK itself to go on a collision course with the planet the moment that all seven chaos emeralds were gathered to power the Eclipse Cannon. He was going to destroy the entire world in his grief. Fortunately, when Shadow was awakened by Dr. Ivo Robotnik or ‘Eggman’, that ploy was stopped by Sonic and his friends. In the process, Project Shadow was declassified when the Government could no longer hide their actions.

“Even more interesting, Shadow eventually recovered his memories thanks to Amy Rose, and Maria’s final words were for him to promise to protect the planet and humanity. However, in the aftermath of stopping doomsday, Shadow was presumed dead for many months. He was still alive, but he lost his memory of everything and everyone. I mean, he did recover them again eventually, but those were intense moments in history. Even more interesting, he later joined G.U.N and worked together with Elite Spy, Rouge the Bat, and the walking arsenal E-123 Omega. However, a few years after the Robotnik Wars ended, he became M.I.A.”

Silver struggled keeping up with the information dump. Even if all of that happened, it sounded both a little convoluted and ridiculous.

“You… Really know a lot about this stuff, don’t you?” He commented.

“Huh? Well… I have studied a lot about it as a passion of mine. While studying chaos energy was almost a necessity to understand the journals, Project Shadow was more of a topic of interest to me. Like I had some kind of gravitational pull towards it.” Freesia shrugged. “Though, I guess I really do talk a lot. Sorry if that was boring.”

“It’s… a lot to take in…” Silver commented. “So… Shadow was an alien this whole time?”

“Technically, part-alien.” She corrected. “And was? He still is.”

“I thought he was just boasting when he called himself the Ultimate Lifeform.” Silver shook his head as they got to the end of the hall, they saw it continued left. So they followed. “What does M.I.A mean, anyway?”

“Missing in Action.” Freesia explained. “It means that he isn’t confirmed dead, but nobody knows where he is. He has been missing for over 180 years. He was considered legally dead for a while but until somebody finds a body I believe he’s still alive.”

“But…” Silver began to ask, but feeling a little foolish for asking. “Wouldn’t Shadow have died by now anyway?”

“Not of old age, that’s for sure.” She corrected. “While Shadow could die in battle, he is otherwise immortal. He can never grow old. How he was when he was made, during Sonic’s time, during our time, and beyond, it does not matter. Until something stops his heart from beating, he will never die.”

Silver’s eyes widened in surprise. He knew he didn’t know everything about Shadow, but at the same time, he never realised that he was an artificially made immortal alien hybrid creation who, if still alive, would be over 250 years old! As strange as it was, Silver found himself feeling a bit more respect towards the black hedgehog. If he ever encountered Shadow during his most recent adventure, he thought it might be a neat idea to catch up with him after so much time.

As they walked through the next hallway, they saw that there was a dead end. It was just a small platform, followed by a dark abyss. As Silver and Freesia looked down, the flashlight showed a platform at the bottom, so they headed down.

It was a drop of at least 80 metres, Silver, floated the both of them down gently with his telekinesis.

“Don’t know how I could have managed that without you.” Freesia said. “Thank you.”

“No problem,” Silver smiled. “But since you studied history so much, could tell me more about what happened in this timeline? Like, what happened to Sonic?”

They wandered down yet another hallway into the darkness, not unlike the one they just walked down before.

“After the Robotnik wars were over,” Freesia proceeded to explain. “Many were expecting the Blue Blur to settle down. Many thought Amy Rose would be the lucky one but… She ended up with someone else instead, much to everyone’s surprise… Sonic eventually did find someone else in his life but… let’s just say it was controversial. Tabloids grabbed on and never let go. Eventually, the public turned against him and he never rebuilt it again. It was said he died alone, but it is unknown what happened to him. He just disappeared and nobody saw him again. I still don’t know what to think about the whole thing or how much of the rumours were true. I won’t tell you much more. I don’t want you to think less of him since you know him personally.”

Silver left it there. They continued down another dark corridor with faint pulsing red patterns along the metallic walls and ceiling. They came across parts of broken wooden crates that faintly had one of the older logos for G.U.N printed on them. The corridor continued to the right, then down a slope into a lower floor.

“Even though there shouldn’t be anyone here, it really feels like we shouldn’t be here.” Silver commented.

“I know. It’s pretty creepy, huh?” She replied. “Almost expect something to jump out at you. At least Eggman cleared the way to the central control room some 200 years ago.”

The hallway ended in a room with a metal path in the middle, and a green and glowing substance of sorts around them. Without saying a word, they both looked at each other, and agreed that it wasn’t a good idea to fall into it.

At the end of the room, were two platforms floating just above the green fluid. As they both jumped on, it began to rise and took them to a higher platform, which led down yet another corridor. However, it expanded beyond just another hallway. It looked like a decommissioned storage area of sorts. As they wandered, they noticed a stray G.U.N beetle. Freesia took it out with a single swing of her mallet and took the chaos drive it spat out.

“Looks like it’s nearly used up, but not bad for a robot that’s over 250 years old.” She commented as she placed the purple tube into her bag.

As they explored the new area, they noticed that it was a square room that circled back to the entrance. But as they tried to make out their surroundings, something caught Silver’s eyes. As he shone light on something, he recoiled in horror and yelped a little. It was a skeleton with scraps of clothing still attached. Freesia looked towards the sight to see what caused him to react like that and froze for a moment.

“I’m sure that’s just a researcher from the raid.” She tried to reassure him, breaking the silence. “Let’s just focus on getting to the core. Nothing we can do about whoever they were. Besides, they don’t look like they were attacked by anything dangerous.”

Silver agreed, and kept trying to progress further. He noticed that there were metal crates that led to the next floor above, and they both jumped up higher. From there, they eventually found another doorway that led deeper within the ARK’s core.

There was a pulsing red hallway that looked like it extended over another pool of the mysterious green fluid. Silver took them both across to the other end with psychokinesis. The glow of his powers barely shone against the faint red light emanating off the walls. If anything, the teal glow of his powers were overshadowed and turned into a faint lilac purple.

Down the path led, down another corridor, to the left, and then the right, then at one more doorway.

When they stood at the doorway, they were left breathless.

It was huge! A larger than life expanse into darkness below and above with only a barely visible purple glow off the walls to indicate that they didn’t just walk out into space itself. Freesia especially gasped when she realised that it wasn’t even the core of the ARK yet. It was just another room of sorts, filled with platforms that allowed them to progress further to another door on the other side, with other large platforms somehow spinning in artificial gravity.

The technology, history, mystery, and danger of the space station made Aquatic Base look like a high school science classroom by comparison.

As they got to the next doorway, it opened to the other side, with an elevator progressing downwards. In the distance, they saw yet another doorway that progressed further. It led into another room with another elevator, up a long vertical tunnel.

As they stood together, they looked up as it seemed to keep moving further and further up. There was the pulsing red pattern all over the walls. Silver’s golden bracelets and anklets looked a dull grey in the red light and the cyan patterns looked like an off coloured dusky purple. He was mesmerised by the red lights. It almost reminded him of a heartbeat. Like the ARK itself was somehow alive and more advanced, and yet ancient than anything else he could imagine.

After a little further along a path of sorts, they found the very bottom of the central control room. The only thing left was to make their way to the top, where the computer was. The first challenge was over.

Chapter Text

Chapter 9 - Something Else Was Here...?

Silver stared in awe of the central control room. Even after so many years, it was still running. Freesia made her way towards the computer console.

“Let’s see…” She muttered, typing away at the keys. “Password… E-G-G?”

Access Denied!

“Alright, how about… Maria?”

Access Denied!

“What? Could have sworn that was… Wait! I remember now! It’s typed differently! Let’s try this… Ma- Ri- A?”

Welcome!

“Bingo!” She exclaimed happily. “Alright, I’ll see what I can dig up on the computer. I shouldn’t be too long. Let me know if you get hungry. I have sandwiches in my bag.”

Silver nodded, and stepped back to get a good look at the control room. Holographs and machine parts were spiralling around them in many vibrant colours both above and below. The holographic displays were of codes and programs and other technical things that he didn’t really understand or care about. Embedded in the central control hub were seven slots. They looked like they were for the chaos emeralds.

“The chaos emeralds would go in there to power the Eclipse Cannon.” Freesia explained without looking away from the screen. “Of course, the Eclipse Cannon’s been de-weaponised. Nothing can make it fire again. It’s nothing more than a shell now. It’s basically an empty cannon. Another interesting piece of trivia about this place is that there’s also a replica Master Emerald Shrine not too far from here. It was believed to have been built when Gerald researched the ancient echidnas and other mysteries on Angel Island as he was still working on Project Shadow. I wouldn’t exactly go looking for it if I were you though. Close to that is a room that once contained the Biolizard, the prototype Ultimate Lifeform. While Biolizard is long gone, who knows what remains in its place or what other hazards could possibly be there? I’m not saying you can’t go exploring, I mean I’m not your mother and you’re much stronger than me anyhow. If you do, just try not to get lost, and be careful. We were lucky to only encounter a mere GUN Beetle, but who knows what else there is here.”

“Like that monster you were telling me about last night?” He asked.

“Yeah. Like that.” She agreed. “I suspect it might be in the Biolizard room, but who knows. I mean, there could be nothing left here but relics of yesteryear’s breakthroughs and the monster story is just a ruse to prevent people from coming up here. Just be careful, ok?”

“Ok.” Silver agreed and decided to explore a little while Freesia was searching through the computer.

Since they came from below the control room, the entranceway was somewhere he’d never seen. To his surprise, the lights were still working and lit the area well enough to see ahead. The hallways had an almost purple hue to them as he walked down them, with a faint tunk sound of metallic footsteps as he took each step.

He didn’t think he could get lost from just walking in a single direction, so he stuck to just walking down a corridor and not wander too far away. The Space Colony ARK was huge and with its own dangers. Silver wondered how humanity would have managed to live in such a place. But at the same time, there was something that felt nostalgic about it all.

It almost reminded him of sneaking into other places like Meteor Base the first time he travelled to the past. He remembered he was racing against time to stop Eggman Nega from turning the world into a card. It certainly was a strange adventure, but it was the first time he met Sonic, Shadow, and even Knuckles.

As he wandered down, curious as to how far the single corridor went, he saw something in the distance. It looked like a couple of objects on the floor, like something was left there long ago. As he got closer, he saw there were many things that he couldn’t quite recognise up ahead. All on the floor. All not moving. But all definitely there.

As he got closer, they started to look more certain. They looked pale, but didn’t look like robots. When he got even closer again, he saw they were more skeletons. At first, he thought that they were just left over from the raid 250 years ago. But on closer inspection, he noticed certain things didn’t add up.

As he did, he heard something. Like someone crying out in pain, except it sounded unnatural and distorted. 

He wanted to believe that the silence of the ARK was playing tricks on him. But he knew he heard something. But it was faint. Very faint and hopefully very far. It sent shudders down his quills.

Rrrrrrrrrrraaaaaaauuuuuuoooooogh!!!

As soon as the sound reached his mind, he smelt the foul stench of brimstone and burning buildings. The air felt hot. It felt very hot. As Silver blinked, the ARK no longer existed. He saw a creature of flames, destruction, and magma. The eternal sun responsible for burning his world and devastated it long before he was born. He saw the being whose very name gave him chills. He saw Iblis!

“Iblis!” He called out. “Come on you…. Monster!”

Iblis picked up a large chunk of a skyscraper, and held it just above Silver. As he tried to run out of the way, he found he couldn’t. There was a wall in his way that he couldn’t break through. He tried to grab the building in a psychic hold, but he couldn’t. His psychokinesis no longer worked, no matter how hard he tried to either grab the building or pull himself out of the darkening silhouette. He froze in fear, and closed his eyes, anticipating the end. But before he was crushed to death, he opened his eyes again and the flames were gone. He was still on the ARK. He was trying to push through a wall. None of that nightmare was real.

Silver tried to steady his breathing again. His hands were shaking a little after such a vivid vision came over him.

He knew that vision wasn’t just Phantom Ruby shenanigans. He knew it was a memory. It was one of his memories. He remembered the future was once burning away and never being extinguished. Iblis was responsible. While he felt some relief that such a future no longer existed, he felt disturbed that the future was once like that. He felt even more disturbed that the more time he spent in his current future, the more memories of a timeline that no longer existed came back to him. If it never happened… and if Iblis never existed… What was he remembering? How was he remembering?

Then there came another worry, what if Iblis still existed… even if partially? What if it waited until nobody knew how to seal it away to burn away the world once again?

Silver got chills all over his body thinking about it. But he knew such thoughts were getting him nowhere. Even if it were true, he felt like he knew how to stop the monster again, regardless if he wasn’t quite sure how just yet. But it wasn’t helping him in the moment. He was on the Space Colony ARK, not Crisis City.

As he tried to think of something else to take his mind off, he remembered what he was originally doing. He was looking at the skeletons.

Something was wrong. As he wandered further down, he saw more and more skeletons lying about. Both human and mobian alike. But it was the remnants of their clothing that disturbed him more. They weren’t dressed like scientists. The clothing looked darker and thicker. He noticed dog-tags around their necks. They looked like soldiers. They were even armed with handguns, 2 sizes, a smaller one for humans, and much larger revolvers for larger mobian hands.

No bones were broken, so they likely didn’t die from a vicious attack. But something caused their deaths.

As he inspected further, he noticed that each one of them had a badge. A little tarnished, but likely would have been golden when it was new. He inspected one of them closely. The badge had an image of a beaming sun. Embossed at the bottom were the words ‘Children of Faust’ on it.

Silver gasped a little as he instinctively jumped back like he saw a giant spider crawling along it. It was the organisation that Freesia was talking about before! The skeletons weren’t leftover from the raid. They were much more recent!

He noticed that there was a machine of sorts attached to the soldier’s necks. Looked like a breather machine of sorts, but was badly damaged and decayed.

As he walked further down, he saw another skeleton in a damaged hazmat suit. It looked like it was slashed across the back by something monstrous… Something with vicious claws too wide apart from each finger to be considered a wild animal that existed in nature.

Among the other items, he saw one of them had a notebook. It was a skeleton much further away from the rest. Hoping for more answers, he grabbed it with his psychokinesis, and opened it to the last thing written down. It was very crude, but was legible enough to understand.

My breather is broken! I’m alive… but my body is seizing up. I can’t move. I hope they’ll come back for me. If not, to whoever is able to read this, tell my parents I’m sorry! I should have listened to them!

Silver felt a heavy unease over him as he read that. The person wasn’t killed. He was paralysed and left there. So, he turned a page back, hoping to get a bit more context.

I can’t believe I’m going to the Space Colony ARK! This is exciting! Though I feel a little uneasy about needing guns for this. Our team leader didn’t tell us what we were doing. I can only hope nothing goes wrong. The only thing we’re told is to keep our breathers on. Apparently a test had been done and the air is unsafe to breathe. Something about neurotoxin or nerve agent... Apparently it paralyses you if you breathe it in… oh well… What could possibly go wrong?

Silver felt like he was treading in dangerous territory.

“Neurotoxin?” He found himself muttering out loud. “But Freesia and I… We’re not wearing any breathing protection…! How… How are we…?!”

Before he could finish, he felt a slash across his back and was knocked to the floor.

“Augh!” He exclaimed as he turned towards his attacker.

It looked like a body of blue with two bubbles of green looking at him. He suspected it was an artificial chaos. He quickly got up, and grabbed it with his psychokinesis and slammed it against the wall. It turned into a puddle, but quickly reformed into a large blue bubble of water. The Artificial Chaos stretched its body out and tried to impale him. It lashed out with surprising speed, but he managed to roll out of the way and he threw the diary towards the old monster. It didn’t do that much.

The creature tried to attack again, and Silver managed to jump out the way of another slashing of watery blue tentacles.

He grabbed it in another psychic hold and slammed it against the wall again and again until it seemed to have stopped moving. The electronic head on it was smashed to pieces and the fluid fell to the ground, not reforming. It was gone.

“Ok…” Silver said without thinking. “Maybe that’s what I heard earlier…”

He had hoped the danger was over but when he caught his breath again, he felt a dark presence behind him. It was a presence he couldn’t hear… he felt it! It was a sensation of extreme dread, like something evil waited. It was breathing down his neck, close enough to smell his fear. As he quickly tried to turn around to see his new foe, he felt a sudden blunt strike to the side of his head that rendered him very dizzy.

“Uooh!” He grunted as he fell to the floor.

Chapter Text

Chapter 10 - Someone Else Was Here!

Freesia was looking through the computer database for any entries from Dr. Sow-Had. Though, she also found some of the archived research by Gerald fascinating too.

She tried to look through the files by date, looking for the most recent entries. She found some that were dated over 150 years ago.

As she looked through, she saw one labelled ‘A thesis on Chaos Energy’. And her eyes widened in excitement. When she opened it, she saw the name attached was ‘Sow-Had’. She squealed in delight like a little girl going down a slide and pulled out a portable drive to copy the files into. She also had a hard copy printed out by the computer just to be safe. She found what she was looking for quicker than she expected.

‘If things continue going smoothly, I might treat Silver to a nice picnic in Soleanna Forest.’ She thought to herself as she kept searching through the files. ‘Wonder what I’ll bring. I already have some sandwiches. I guess I can make some nice fruit tea when I get home, and quickly grab some nice butter cake for dessert. It’s lovely weather predicted today! I hope he might like a nice afternoon like that! It’s not enough of a reward for how he’s helped me so far, but I hope… I hope it’s at least a start. But after this… Should we say goodbye? He should probably get away from me if he still can to avoid any more trouble, but will he have anywhere else to go? I guess he’ll be fine on his own but… I guess… I guess I might ask him what he would prefer to do when this is over. I just gotta focus on now… If I get too caught up in ‘what-ifs’ I’ll get nothing done and I would have been captured long ago. Let’s see…’

Under the research, she noticed it wasn’t the most recent entry on the computer. It was buried under a few other files, they looked like journal entries, text files or transcripts of an audio log of sorts. Either way, it could only open as a text-only document.

While she knew they likely not related to the files she was looking for, curiosity started getting to her. If Sow-Had was one of the last known visitors on the ARK, then what were the new files? It wasn’t debug reports or something automatically generated by the computer. It was made manually. She had many questions burning in her brain, and only one way she could hope to find answers. It was like reading the diaries all over again. She opened the file that was dated just a couple years from the research on Chaos Energy. As soon as it opened up, she began to read.

I can’t remember anything at all.

I need to remember. I feel it… I feel something is wrong… When I wake and when I sleep… I feel a darkness over my mind… I don’t know what it is.

I don’t know why I’m here. At least this Space Station is self-sufficient enough that there’s still food available. I know I won’t starve to death here. I guess that’s a bit of a plus.

Freesia felt a little unnerved, but opened the file dated roughly a day after that.

I am here…? Yes… I am here. I feel like I’m missing something… Did I always look like this? Was I always alone? I can’t remember being born, but I feel like I should. That’s crazy though. Who remembers being born?

She opened the next one, and then the next one after that. She read through all of them until the last entry.

Entry number 3

I should probably number these. So, I’ll start where I remember best, which was a few days ago. Was it days ago? Hard to tell the passage of time. The last thing I remember was waking up somewhere dark. I felt angry about something. I couldn’t remember what though. But I was found by people and I was taken up here. Will they come back for me? I don’t even know what they wanted. But since I woke up, I felt like there was something missing. It is like I woke up in the body of a middle-aged man, having only the vapour of an idea that I was once a child at some point.

I feel like I forgot something important. Maybe the people who brought me here might help me remember? Though I doubt it. I think the world was afraid of me. They likely brought me here to lock me away. But I won’t let it get to me. As soon as I can remember who I was, I will make my way back to pick up where I left off.

At least, I hope so.

Entry number 4

I realised that I remembered the password to this computer. I can barely remember my own name, yet I remembered the password. That is strange. Maybe… I used this before? I might look through some of these files. Maybe something will come to mind…?

Entry number 5

If there is any way of describe what I am going through, it is like being perpetually in a state between wake and sleep, where hallucination and the darkest thoughts that can come to one’s mind are all the more real, and yet not real, and reality itself is thrown into questioning as everything from my surroundings to my very thoughts begin to feel synthetic, while the dreams and nightmares feel more and more real.

It’s horrible. I am not sure if my entries are real or will be read by anyone…. To some extent, I don’t think anyone can. Alas, these entries are for records of my spiralling insanity. The dream journal of my nightmares. Perhaps, my final thoughts as a conscious and thinking being before my psyche is forever lost to the ether. Hopefully, it may not come to that, but I do not have too much hope otherwise.

Entry Number 6

Memories are scattering. Almost fading. But I know there’s part of me that does remember, but something is disrupting the full recollection. Like an intrusive thought or another voice disrupting my real thoughts. The longer this has been over me… That harder it has started to become to tell my true mind from the wordless voices dragging me further into the depths… Do I belong in the darkness? Or should I fight it?

Entry number 7

I don’t remember my face, but the names and files on this computer… it feels familiar… Robotnik… Why does that name haunt me? Did I know someone with that name? Was that my name…? And Maria… I feel a strange resonance about that name… It fills me with hope and despair… What happened?

Entry number 8

I can’t remember what I used to be. Something’s turning me upside-down.

I think I was someone before… That name, ‘Sow-Had’. I remember something about it. But it feels wrong. It’s like it’s backwards. No… scrambled. It’s scrambled! But in the right order… Surely I’m not… The one mentioned in these files…

Entry number 9

The research on chaos energy… I feel like it’s something I already know. I know it. I can’t tap into it. If I could, I would have used Chaos Control to get back to Earth. But I can’t… Something has changed… Something is missing deep down, but unknown…

Entry number 10

Yes… I remember faintly… I was someone else… I don’t know why I’m not… What am I? I… I have 4 arms now… My teeth are jagged… and my mind feels like its perpetually dreaming and it’s a nightmare I can never wake up from. I’m not even sure if I can sleep or if I can wake. I’m not sure if anything is real. Is there at least a photo of what I used to look like? Did I always look like this? I’d like to think not. Whatever I have become feels distorted and twisted like I was a straight path twisted to a Mobius strip.

Entry number 11

It hurts in every way short of physical. Someone, please wake me up! I want to wake up! I want to wake up! I want to wake up! I need to wake up! I need to wake up! I need to wake up! I need to wake up! I need to wake up! I Need To Wake Up! I Need To Wake Up! I Need To Wake Up! I Need To Wake Up! I Need To Wake Up! I Need to WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP! I NEED TO WAKE UP!  I CAN’T WAKE UP! I CAN’T WAKE UP! I CAN’T WAKE UP! I CAN’T WAKE UP! I CAN’T WAKE UP! I CAN’T WAKE UP! I CAN’T WAKE UP! NOW WAKE UP! NOW WAKE UP! NOW WAKE UP! NOW WAKE UP! NOW WAKE UP! WAKE UP! WAKE UP! WAKE UP! WAKE UP! WAKE UP! WAKE UP! WAKE UP!

WRITING ON THE WALLS… In the walls… Under the floors… This is the most unconventional of graves…! Except I can’t die! I can’t die! Death or sleep? Death or sleep? I won’t die… I am locked out of freedom and the key is beyond my reach…

Cold burning. Cold burning. Memories are burning… lost… what… who am I…?

Entry number 12

I think I had visitors here. I couldn’t talk to them. They came with guns. I think they wanted me dead. So… I pushed back. They froze up and couldn’t move. I don’t know how… I didn’t even mean to… Are they dead? Have I truly become a monster?

Entry number 13

The darkness… I suspect it’s a force within me. I might be able to purge it and maybe I’ll be able to shed light on things once more. I think it’s at least worth a try. What have I got to lose? Part of me understands how something like that could be done. According to Gerald’s research, there is a chaos energy extractor somewhere in the labs. It was intended for extracting energy from chaos emeralds to create chaos drives. Perhaps I can adapt similar technology to extract the strange dark energy from me instead.

Entry number 14

It hurts… All ways except physical it hurts… What does physical pain even feel like anymore? Am I in constant pain that I’m used to it? If I was hurt, would I remember what it feels like?

It hurts… It hurts… I feel it… The darkness… midnight black… I shiver with the cold… The burning cold… I am on fire… yet I am still frozen while my body feels corrupted electricity through its nerves… I struggle against the despair…

My smooth contemplations are broken like a road smashed to time and cruelty…

My deepest concerns remain buried and unspoken for not the entries in this machine…

Almost as if my mind is trapped in this machine while my body is almost dancing in invisible fire.

It burns… it freezes… it’s all so wrong but I can’t remember what else there was of my life…

Entry number 15

I managed to craft an apparatus using the technology on this ARK to theoretically purge my body of whatever this is. I just need something to power it. I might scour the area for any remaining G.U.N robots and see if I could reuse a few old chaos drives. It’s strange that I understand this technology. I must have been someone who worked here before…

Entry number 16

I ran a small test. I successfully managed to purge some of the darkness from my mind, but barely. It was only a small vial of a strange vile purple substance of sorts. But now… I feel weaker. I fear the darkness might very well be the only thing keeping me alive. But I know somewhere deep down, that wasn’t always the case. Just… Who was I before this?

Entry number 17

Echoes on my mind… Memories I don’t know are mine… I hear gunshots ringing but there’s nobody but me… Gunshots are ringing… Gunshots are ringing… only one shot… only one shot was enough…

I hear her voice… but who is it?

Moria? Maria? Who are they?

Who is there? What do they want from me? How can I help the world when I can barely keep myself sane?! Who are you? Where are you? What are you? Who am I?

This darkness… I try to keep myself together… but how much longer can I keep fighting...?

My lungs still breathe… but I drown in him…

In the deeper darkness I drown…

I am drowning in the darkness… Help me!

Oh dark. The darkness that dozes in the dusk…

I see light unreachable, no matter where I go…

And these memories or hallucinations, I have to keep facing them again and again… and again… and again…

I lose my mind and does it even matter anymore?

Entry number 18

I don’t think I can remember. Because I don’t want to know the pain of how much I truly lost. If I was someone important before, perhaps I should let the past remain buried… I can’t go back. I can never go home… This is my home now.

They tried raiding this once a long time ago. They tried coming back for me here, and now they are dead. This is my home now. My prison or not, I will protect it from anything that comes here!

The darkness is my only company anymore… and it might be for the best to stay that way. There is no light anymore… There is only me and all I am… Something that shouldn’t exist, an anomalous consciousness to an impossible body. An endless life forever…

The green hedgehog gasped. She was able to put some pieces together. She hoped they were fitting incorrectly.

Entry number 19

What is the point of writing anything down anymore? Nobody will ever read it. I was doing it for myself. No point anymore. So… I’ll leave this as is… Here I am… All I am… A shadow of my former self…

Freesia gasped. The pieces fit together too well. Even though it wasn’t proof, the realisation resonated with her in a way that removed all doubts about her conclusion.

“Dr. Sow-Had is alive!” Freesia exclaimed. “And his real name is…!”

Before she could finish, she heard Silver grunt, followed by a loud slam. Without even thinking, Freesia left her things, save for her mallet, and rushed towards the source of the sound with speed she never knew she even had.

Chapter Text

Chapter 11 - Fighting Shadows

Silver stumbled to the floor. He didn’t know what hit him. But before he could get his bearings again, he felt something pick him up from behind. It felt like pair of long, thin fingers was wrapping their way around his body.

He was turned around and he saw the face of his attacker. He wanted to scream. He didn’t even know what he was looking at, but as he managed to make out more details, it just kept looking worse.

The creature looked at him with eyes that were blood red with a sickly-yellow sclera. The head looked mobian, but heavily mutated. It had ‘quills’ like a hedgehog, but they were lengthy and moving almost like tentacles with neon patterns that were glowing in various bright and pastel colours. The body seemed to have 4 arms. Two were long and thin, and were currently holding him. The other two above it were shorter, but thicker and more powerful. Toned red at the hands, and each finger had a bone-white talon extended from the tips. They looked capable of tearing Silver in half like wet paper. The legs looked powerful, with feet that stretched forward with 5 toes, three forward, and two back. Each toe had a large, bone white talon extending from them. Swinging back and forth, the creature had a long tail with a devilish barb. The body looked like it was covered in a sort of tough leather that was black and red. The only thing that looked out of place was a tuft of white fur on its chest.

Silver was frozen and hyperventilating in panic. He had faced monsters in the past, but nothing that looked like what was holding him. As he snapped out of the daze of fear for a moment, he tapped into his psychokinetic powers and tried to get a hold of his attacker. As he placed it in a psychic hold, its body grew a glowing teal aura.

“Let go of me!” Silver screamed at it. “And only one of us will need to get hurt!”

He pulled hard at the hands that were wrapped around him, pulling them off finger by finger, until he could finally fall through to the ground. As soon as he did, he threw the beast down the corridor.

“Take this!” He taunted. “If that’s all you got, then give up! With the power of my psychokinesis, I can grab a hold of anything and send it right back. You can’t break free!”

He heard a satisfying slam as the creature crashed against the metal plating of the corridor. He smiled a little at his achievement. But as the creature got back up, he saw it smiling in turn. It was a creepy smile. It was a toothy smile, and the teeth were very sharp, but even. They were slightly yellowed. Silver knew he didn’t want to be bitten by the beast. The muzzle was a dark grey like a storm cloud.

“So… A creature for my amusement…” It taunted. It sounded hoarse and grotesque, like it almost forgot how to talk altogether. Silver was surprised that the creature could speak at all. But that didn’t make the taunt any less threatening. Whatever he was facing thought this was a game that he had every intention of winning.

Silver braced himself for it to charge at him again, but he didn’t expect it to move so fast. The way it moved seemed unnatural. It charged on all sixes, like an angry centipede that was ready to kill a dragon. It was a way of running that went beyond a wild animal, and it was moving towards him faster than he could react.

Silver made a swipe with his left hand as a large cyan blade formed in front of him out of concentrated psychic energy. He called them ‘Psychic Knives’. With a wave of his right hand, it was sent flying at high speed towards the beast. He heard it collide, it did some damage, but it wasn’t very effective.

Before he knew it, he was in the hold of the creature again, once again in the long, bony fingers like roots of an ancient tree threatening to crush him in an instant. He saw it open its mouth and exhale a strange gas on him. It smelled horrible, like the mega muck from the Chemical Plant Zone if it was corpse flower scented. Silver found himself gagging and feeling nauseous, but otherwise held it together. He suspected that it was the same neurotoxin that was used on the Children of Faust.

Just as Silver braced himself for paralysis, hoping at least his psychokinesis wouldn’t be affected, he found that there was still strength in his arms and legs. Even though he was in a tight hold again, he could still move.

“What? What are you?” The creature asked. Silver noticed its expression looked bewildered. Its eyes were widened and its mouth was slightly opened in disbelief. Silver could understand the confusion, even he didn’t know why he could still move after getting the nerve agent blasted point blank on him.

“I’m no monster like you!” Silver answered sternly as he tried to get out of the creature’s grasp once again. “I am Silver the Hedgehog, guardian of the future, and warrior of justice!”

Silver managed to get pull himself out of its grip once again, but before he could counter, the creature attacked first.

With a swipe of its shorter, but stronger arm, Silver was thrown into the floor, and it collapsed beneath him. He fell into a dark pit, his fall cushioned by what felt like fluid. It wasn’t the green fluid from earlier. It looked bright yellow and sticky, but ultimately harmless.

“Silver…?” The creature muttered, like something familiar came to it.

Freesia charged forward, mallet in a tight grip and ready to strike like it was a game of strength at a carnival.

“HEY!” She yelled. “Get away from the kid! This doesn’t involve him! I’m the one who wanted to come here. Whatever you have, this is between you and me!”

With a single swing, Freesia sent the creature flying into a wall with an impressive crash and dent that stunned it for a moment.

“Silver!” She called out, noticing the hole in the floor. “Are you alright? I came running as fast as I could!”

“Freesia!” Silver called out in return, levitating his way up to meet her again. “Don’t get near him! He can paralyse you with this strange gas!”

As he got back up, he saw Freesia was swinging relentlessly, an impressive thump could be heard as each swing connected to the monster. The green hedgehog was attacking with zeal like the monster was a giant spider in her bathroom.

“If being in close proximity didn’t paralyse me then,” Freesia replied while still beating down in the creature like it was a batch of mochi in a rhythmic and rapid manner. “It’s not likely to paralyse me now!”

ATA! ATA! ATA!

She cried out again, in rhythm with her swinging.

ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA! ATA!

However, while on the ground, the creature wasn’t completely helpless to the beatings. It extended one of its slimmer arms towards a leg, and with a quick grab and pull, Freesia fell to the ground, smacking her face on the metal floor.

“Interesting…” The beast commented. “You Look Familiar…”

The creature got back up, a little slowly as it looked like the hammering did a number on it, and quickly picked up Freesia by the same leg. With a quick yank, Freesia hung upside down and dropped her mallet out of reach. Despite looking helpless, she didn’t panic or seem too afraid. In fact, she barely struggled or tried to fight back with any punches.

“I know who you are!” Freesia shouted to him. “But that won’t stop me fighting back! You might be important, but I can’t let you hurt Silver! I’ll knock some sense into you! I’ll find a way to free you!”

Silver tried to intervene, and readied another psychic knife to the dark beast. He was behind the monster as it held her, so he didn’t worry about accidentally hitting her. But something else came to surprise him.

He noticed Freesia beginning to glow red. An aura began to envelope her body as he felt a small pulse of chaos energy emanating from her.

“I’m not some helpless little lady you can push around either…” She spat in his face. “Especially when I…!”

Silver saw in awe and horror as he saw Freesia start to crackle with a bright red energy. He knew that power all too well.

“CHAOS…” She yelled, as her body began to glow a more intense red. Silver steadily lowered himself back into the hole with his levitation ability to avoid the firing line. He knew what was about to happen. He was on the receiving end of such power from Shadow too many times before.

“BLAST!”

Ka-POW!

A small but powerful pulse of fiery red energy exploded from her body, sending the creature back. It tumbled over the hole and was sent further down the corridor. It began to roll a little, stunned in surprise. Silver felt a little underwhelmed. It wasn’t the same extent of power as Shadow. It barely damaged anything, and only seemed capable of knocking things back a little bit. But he was nonetheless surprised that anyone else could use one of Shadow’s techniques.

“Yeah…Ha… There’s plenty more… huff…where that came from…” Freesia threatened, panting very heavily on the floor.

Silver could hear it was clearly a bluff, so he took over the fight again, darting back out of the hole. He readied another two psychic knives, both vertical and horizontal.

“HA!” He roared as they started rushing towards the monster.

“Do what you have to do, Silver.” Freesia called out to him, propping herself upright on one of her knees. “But don’t kill him! I know who he is!”

Silver nodded. He knew what to do next as the creature got up, looking a little more scuffed and tired out from the fight so far.

“I’m just getting started with you!” He called out.

The creature charged towards him again. Silver had the perfect counter. Just before the creature got to him, he quickly teleported behind it with a well-timed Teleport Dash. The creature tackled the ground instead, causing another hole in the floor, missing the young psychic altogether. Not wanting to waste much more time, he quickly charged up a small burst of psychic energy and released a shockwave that he called Psycho Shock. He saw the psychic energy pulse through the creature and in that moment, it couldn’t move. Silver grabbed the beast in a psychic hold, catching it by surprise once again.

“You can’t paralyse me for some reason, the same can’t be said for you. You know what that means, Mr. Monster-Guy? It’s no use!” He taunted. “Take this!”

He threw the dark beast down into the hole it made earlier, sending it splashing into the yellow fluid.

“RRRRrrrrrraaaauuuugggghhhh!” The beast roared. “S… Silver….? … … NO!”

The voice sounded vaguely familiar. He couldn’t place it. But he knew that it wasn’t going to help him in the fight. He had to just focus on knocking him out and making sure to not get badly injured or killed in the process.

As Silver readied a few psychic knives again, he saw a pulse of purple light coming for him. The beast had a few other powers as well. It moved fast, and couldn’t be negated by his energy blade projectiles.

He tried to dodge it, but he was too late, and it hit him across his back.

“Auoooof!” He grunted, a little stunned.

He tried to get back up to avoid being grabbed again. Though as he did, Silver felt reality itself change around him for a moment.

He could smell the grass and stone as well as fumes of an intersection at Radical Train. He couldn’t remember the context as to why, but that it happened. It was as vivid of his visions of Princess Elise as a child or his vision of Iblis.

“No!” Silver cried out against his own mind for reminiscing at a bad time. “Not… Now!”

He tried to pull himself back into reality.

In the moment he was vulnerable, the creature climbed its way out of the room below and out of the hole.

Silver remembered something. He was fighting Shadow at Radical Train. He fought Shadow to a standstill…

The creature got up behind him, and in one quick lunge, landed a roundhouse kick to the back of Silver’s head. His reality crumbled beneath him as both Radical Train and the ARK faded away. All he saw were small twinkles of light as his brain tried to comprehend what was happening. He swore he could see shooting stars for a moment.

The creature grabbed him once again, this time with the shorter and stronger arms. As Silver shook his head and reality came back to him, he realised he was going to have a much harder time getting out again.

He tried to grab onto one of the guns that the skeletons had on them with psychokinesis. It was the only thing he could think of grabbing even if it was a little bit away from the scene of the fight. He only planned on threatening the creature since it was intelligent enough to speak. But he had trouble focusing as the back of his head started throbbing. He knew that was going to leave a lump the next morning.

The creature held him in place. It growled fiercely. It was very angry at the beating it took so far. However, it also looked rather pained. Not physical pain, but almost guilty. It looked at Silver, but not in the eyes.

“I… You…what…? I don’t want to fight… I can’t… I don’t…. Get OUT!!!” It bellowed, it sounded like it was struggling with something internally.

It went to open its mouth again. Though, instead of neurotoxin, it spewed a strange, purple gas. Silver tried to hold his breath at first, bracing for the nasty neurotoxin again, but he was caught off-guard. Taken by surprise, he gasped instead. It smelled exactly like one would imagine. It was foul, but indescribable. He started coughing violently, which also caused him to accidentally breathe in more of the cloud as he struggled to catch his breath. He didn’t know what it was, other than he probably shouldn’t have breathed it in. While it didn’t paralyse him, it did cloud his judgement. He had a bad feeling about what the strange substance was.

He felt a rush of anger overtake him shortly after. Like someone had run him over with a rage-truck. He didn’t care about what Freesia told him, he had enough of the creature that was attacking the both of them. He managed to pick up one of the guns left behind from a plan gone wrong. He heard the click as he turned off the safety.

“Freesia might know what you are…” He growled out as he pointed the barrel towards the head of his attacker. “But I don’t care.”

As the gun’s trigger was slowly being pulled, Silver suddenly snapped out of whatever heavy aggression he felt overcome him. He didn’t believe it was right to kill someone unless it was to save the world. Even then, he wasn’t sure it was the right path to take.

But he still needed to fight. So, he slammed the butt of the gun with as much force as he could muster into the head of his attacker. It seemed to be the final blow needed. The beast loosened its grip and let him go. The gun fired off from the impact and the bullet ricocheted down the hallway and stopped, leaving all three of them unharmed.

Freesia rushed over to him to check on the both of them. She quickly looked over his body for any signs of injury.

“Silver!” She cried, hugging him tightly. “I’m glad you’re ok.”

Silver wasn’t ready for the sudden squeeze around his ribs. It somehow felt even tighter than the grip of the monster!

“Says you,” Silver retorted, trying to pull himself out of the loving embrace. “I think I swallowed some of that purple stuff he sprayed on me!”

The matcha-coloured hedgehog let him go the moment she realised the last thing he wants is to be held in a tight grip around his body again.

“Do you think you’ve been poisoned?” She asked, very concerned.

“I… don’t know.” He replied, unsure of how to answer the question at first. “But…. I… It’s strange.”

Silver thought about it. He didn’t feel poisoned. He wasn’t sure what exactly it did or what it was supposed to do. The most that the mysterious gas did was smell terrible and make him angry. He suspected that it might have just been a chemical spray of sorts. He decided that it was probably best to monitor and see if he has any reaction later. It wasn’t like much else could be done in that moment anyway.

“I mean, we’ll see what happens.” Silver answered. “The sooner we can get back, the sooner I can see a doctor and see if there’s anything wrong.”

Freesia nodded in agreeance, before looking over the monster they fought. She knelt down over the beast like it was an injured animal on the side of the road.

“So this is where you’ve been this whole time…” She whispered softly as she gently stroked the leathery head.

Silver was a little taken aback by her sudden tender approach to the best that attacked them not long ago. Then he remembered her comment about knowing that it used to be somebody before.

“So,” He inquired. “You said you know who this creature is. So… Who is it? Isn’t it the monster rumoured to have killed Dr. Sow-Had?”

“Yes and no.” She replied, carefully inspecting the strange creature before them, gently patting the ‘quills’ tenderly like it was only a kitten on the streets. “He died in essence when this creature first began to exist. But the creature didn’t kill Dr. Sow-Had. This creature before you is Dr. Sow-Had! However, the name isn’t quite right. Like I suspected, it was a pseudonym.”

“Who is he then?” Silver asked. “Who was this doctor? Who is this monster?”

“This is no monster.” She replied. “And the Space Colony ARK was his home long ago. He was made here. He was imprisoned here. The creature before you is none other than the Ultimate Lifeform, Shadow the Hedgehog!”

Chapter Text

Chapter 12 - Farewell to the ARK

“This is Shadow?! How?!” Silver exclaimed.

Freesia inspected the beast before them that caused so much trouble. He seemed to be knocked out for the moment.

“I don’t know.” She shook her head a little, making sure to not take her eyes off the beast. “I don’t know how Shadow came to become this, nor do I know why we are still able to move despite the dangerous nerve agent in the air. I believe the Children of Faust are behind this but… Look… I got what I came here for. I just need to get my things and I’ll… Umm… I’ll see if I can borrow any reserve power to supercharge my replica emerald.”

“What do we do about Shadow?” Silver noted towards the previous chapter’s boss fight.

Freesia looked towards the monster, towards Silver, and blinked quietly as she pondered, appearing unsure the entire time. Silver could only wonder what thoughts were going through her head, but alas, he wasn’t the mind-reading kind of psychic.

“I… I’ll see if I can take him back with us.” The green hedgehog answered, her voice sounding reluctant.

“But he tried to kill us not even a moment ago! This isn’t the same Shadow I knew before, or what you might have read about!” Silver argued fervently. “Surely there’s another way to help him without getting us killed?”

Before either of them could argue further, the monster started to shift and wake up. With one of his arms, he cradled his head where Silver butted him with the gun. He looked a little different than before. His glowing quills were slightly shorter and his eyes looked a little more lucid.

“Y… You?” He asked as he looked towards Freesia, without any sense of malice. “No… You’re not her… Who are you?”

Freesia extended her hand towards him, grabbing onto one of the upper, thicker arms, and helped him upright before shaking his hand.

“My name is Freesia. I’m so happy to see you come back to your senses after so long.” The mysterious green hedgehog answered. Her voice was soft and friendly. It was a complete 180 of the tone she had only a couple moments ago. “And I am you biggest fan, Dr. Sow-Had.”

Shadow looked bewildered. Lucid or not, it wasn’t the same Shadow. He was different compared to how he was in Sonic’s timeline in every sense possible. Compared to the last time Silver interacted with Shadow, only a few days ago on his last adventure, it was certainly jarring to the psychic hedgehog to say the least.

“Doctor… Sow-Had?” He asked. “Is that who I was?”

Freesia nodded, giving a friendly smile to him.

“I have no doubt about who you are. I have your old diaries. I might be able to help you jog your memory.”

Shadow then turned to Silver. Despite his beastly appearance, his eyes looked less intense than they did before. Yellow sclera aside, Silver noticed the crimson glance. Those were Shadow’s eyes, no doubts about it.

“Silver? What are you doing here? Why… aren’t you in your own time?”

Silver felt a little taken aback with the question.

“Umm… I am…” He answered.

Shadow’s yellow eyes widened. It wasn’t surprise, it was clear and very real horror. He wasn’t scared, he was haunted.

“Has it really been that long?” He gasped in disbelief. “How long have I been here?”

“Doctor Sow-Had,” Freesia answered. “Well, Mr. Shadow, you’ve been M.I.A for over 180 years. You are in Silver’s time now. It has been that long. But don’t worry. You’re not alone anymore. We can help catch you up. I can take you back to Earth. I have a replica emerald that can take us there.”

“A fake emerald…?” Shadow inquired. “Can you really do that?”

“Yes I can.” Freesia assured him. “I learned from you since you wrote the book on why it’s possible! Though, teleporting 3 people at once over such a distance will definitely cause it to disintegrate. I think it would be wise to give it a little boost with some chaos drives too. Just to make sure there’s no… displacement…”

“Chaos drives…?” He carefully thought about it. “I might be able to help you find a few…”

“Hey,” Silver inquired, cutting off Shadow’s train of thought. “You were trying to kill us a moment ago. What changed… Shadow…?”

“I don’t know…” He answered without looking him in the eyes. “It’s strange. Whatever darkness clouded over my mind had cleared… partially. I don’t know how long it will last before I may snap again. Though I’m not sure how much more I can fight. I don’t feel as… vitriolic… as I was a few moments ago…”

Silver decided to accept the explanation as is. He wasn’t sure he was going to get any better answers anytime soon. Every answer seemed to bring more questions.

While Shadow and Freesia made their preparations, Silver decided to just sit down and wait, snacking on one of the sandwiches Freesia packed in her bag while he did. It was a strawberry jam sandwich. Silver was hoping they were something savoury, but the sugar helped him through some of the shock of everything that’s happened so far.

Eventually, Shadow and Freesia regrouped. Shadow brought a few chaos drives that still had some power left in them, and Freesia injected the energy into her replica emerald. It began to glow a brilliant deep blue as it was given that extra charge. With one hand on the emerald, and another holding onto Silver’s hand, she called to Shadow to come close and hold onto her as she readied the teleportation.

“Alright. Hold on tight!” She commanded. “I’ve only got one ticket out of here. I need to make this count. Ready?”

Silver and Shadow nodded, bracing themselves for transport.

“CHAOS CONTROL!” She called out as they vanished in a flash of light, leaving the ARK abandoned once more.

Chapter Text

Chapter 13 - Fleeting Feelings of Safety

In an instant, the trio found themselves just above the floor of Freesia’s house. Silver managed to land on the floor well, Shadow tripped a little. The replica emerald shattered to pieces as soon as Freesia landed.

Freesia looked very drained once again. She collapsed to the floor, struggling to breathe.

“Are you alright?” Shadow asked.

“Give her a moment, she’ll be fine.” Silver explained. “She just needs to catch her breath. She’s not as strong as you used to be with chaos control.”

“Silver…. Could…. Could you pass me…the… the rings…?” She gasped out between breaths.

Silver obliged and reached into her bag to bring out the pouch of rings. After dusting off a few grains of sand from them, he handed them over. By the time Freesia recovered, there were only about 100 rings left.

After getting her strength back, she got back up and looked towards Shadow.

She smiled as she took one of his hands and led him towards the backyard.

“Come with me, Doctor.” She said in a soft and coaxing voice. “It’s about time you got your old journals back.”

Silver watched as she led Shadow out the door. As soon as the sunlight hit him, he collapsed to the ground. It looked as though gravity itself magnified on him and started crushing him in a way he couldn’t escape.

“Mr. Shadow!” Freesia exclaimed. “What happened? Are you ok?!”

The psychic hedgehog ran outside quickly to try and help him back up. At first, he tried to help him up under his own strength, but struggled. Even when resorting to using his psychokinesis, he noticed Shadow felt much heavier than he was before. While heavy objects were usually no problem for Silver, he was surprised with how much effort it was to get him back up, much less getting him back inside. It didn’t so much feel like lifting heavy weight, it was like wrestling a black hole. Something beyond normal gravity was pulling him down like it was trying to escape the sunlight.

“What… Happened…?” He mumbled as he looked like any strength he had suddenly left him.

With combined efforts from Silver and Freesia, they managed to get Shadow back into the shade. As soon as he was in the shadows, he was able to stand on his own again.

“Thank you.” Shadow grunted a little as he regained his bearings.

“Hmm…” Freesia pondered. “It looks like we can’t take you out into direct sunlight. How strange. Alright. I can bring the diaries to you. Just give me a moment to get them.”

Both Shadow and Silver watched from the window as Freesia ran outside towards a small shed in the corner of the yard. She quickly pulled out a shovel, before looking towards them in the window and giving a thumbs-up. Soon after, she ran towards the little tree in the yard and started digging it out.

As soon as she softened the soil, she let go of the shovel and pulled the tree out in one quick yank. After digging a little further down into the hole she wrestled out a small, wooden chest and ran back inside the house with a big grin on her face.

“Here we are!” She gleefully cheered. “In here, Doctor.”

She placed the dirty chest on the table, entered the right numbers on the combination lock, and opened it. Inside were a set of old, leather-bound journals and a strange silver bracelet with a green gem attached to it.

“These should help jog your memory.” She explained as she pulled out the oldest book and handed it to him.

Shadow, using the longer and slimmer arms, gently opened one of the books up and started on the first page.

“And there’s something I need to say to you.” Freesia said towards Silver.

Before he could react, she gave him a gentle kiss on the forehead.

“Thank you!” She said as she stroked his head behind his top quills. “I could never have gone through that without you. You helped me not only recover the last of Dr. Sow-Had’s lost research, but you helped me find Sow-Had himself! I still can’t believe I didn’t figure it out sooner. Never in my life did I think I would have been stumped by an anagram pseudonym!”

She laughed a little at the whole idea. Silver chuckled a little, himself.

“I mean… WOO-HOO!” She cheered. “We did it! WE DID IT! The project I dedicated my entire life to uncovering has all the pieces together. I want to celebrate. I’m making dinner! Just… what do you want? You name it, you got it! Anything at all!”

She jumped up and down like a kid in a candy store that’s just been told she can have anything she wants.

“Oooh! How about …” She continued, showing no sign of shutting up anytime soon. “Spaghetti alla puttanesca or harlot-style, whatever name works. I’m in the mood for something spicy! However, that won’t take very long to make, so I might also make some cannoli for dessert. That’ll take a while so I guess I better get started! Oh, but what do you guys want? Does that sound tasty to you? I should show some better hospitality. Silver, would you like some hot cocoa? What about you, Mr. Shadow? We can talk a little more at dinner and discuss what exactly happens next. I should probably get started! Ha ha ha ha ha!”

She started rushing to the kitchen, without any input from either the psychic hedgehog, or heavily mutated ultimate lifeform. She was in her own little world, steadily getting ingredients together to make a celebratory dinner.

“Silver…?” Shadow asked, turning to him. “Who is this girl?”

“Her name is Freesia.” He answered. “And that’s roughly all I know other than the fact she seems to be your biggest fan. She talks a lot, sometimes too much. I mean, I’ve only met her the night before and she seems really nice. She let me stay here in return for helping her.”

“Hmm…” Shadow nodded. “Perhaps my past is in good hands… I hope… It’s been a while since I’ve last said that word… hope…”

“There’s pretty good reason to feel hopeful now.” Silver tried to reassure him. “You’re no longer trapped on the ARK, and Freesia has a lot of books related to who you once were. Even if you don’t fully remember, you can relearn what you lost.”

“I suppose I can.” Shadow replied. “It’s all very strange. The past 180 years felt like a trance or bad dream and it’s like I suddenly woke up. I wonder what caused that?”

“I don’t know.” Silver answered. “Maybe we knocked some sense into you? Do you know what caused you to think ‘cloudy’?”

“From what I can remember,” He explained. “I woke up like this in a dark basement or bunker of sorts, not knowing what happened or who I was. I remember that I felt like I was in mourning… but I couldn’t remember who or what I had lost. Next thing I knew, I was taken to the ARK, and I was trapped there for some 180 years or so… I tried fighting whatever this was over my mind, and I realised this darkness was the only thing keeping me alive. My chaos power is gone, and replaced with… this… However, the more of this darkness I managed to exorcise, the clearer I could think, but the weaker I became. I suspect that I am able to talk and think more normally now because you managed to beat a significant portion of power from me. Thank you…”

“Wonder where it went?” Silver commented, unsure of what to make of the explanation.

The conversation was disrupted by the sound of Freesia bringing out a large stainless steel pot into the stove. She began to pour in milk, evaporated milk, heavy cream, and a can of sweetened condensed milk. She turned on the stove heat and stirred it all together.

“Oh,” Freesia turned to them. “I didn’t get an answer to the hot cocoa question. Would you guys like some? I promise you, it’ll be really good! I mean, you look like you could use a little sugar kick, Silver. No offense, but you look a little pale, probably just the shock from the fight, but this might help you perk up again. Would you like a cup?”

“Sure.” Silver answered, suddenly a little self-conscious of his complexion, but not enough to warrant a dash for the mirror.

Shadow gave no answer.

“I’ll make you one too then.” She replied on his behalf. “You look like you need some sweetness in your life. Or… Do you just want to chew on some coffee beans instead?”

“Coffee beans…?” He inquired.

“Yeah.” Freesia elaborated. “I remember reading in an interview that you don’t drink coffee, but rather you eat the beans straight. I can understand though, because dark chocolate covered coffee beans are the BEST!”

She dashed towards a pantry and pulled out a small tupperware container full of chocolate covered coffee beans.

“See if this jogs your memory a little.” She replied, gently placing a small handful of beans into one of Shadow’s larger, but stubbier hands.

Shadow looked down at them for a few moments, giving them a small sniff, before putting them in his mouth and crunching on them. He looked like he was pondering his experience carefully.

“Yes…” He mumbled. “I think I might have enjoyed these once… It’s delicious and crunchy…”

“It’s ok,” She tried to comfort him as she dashed back to the stove and started adding in cocoa powder to the hot milky mix in the pot. “Your memory will come back to you. After all, this isn’t the first time you’ve had amnesia. That was around the time of the Metal Overlord conspiracy. You regained most of them during the Black Arms invasion. Thank goodness for that! Who knows what the world would’ve been like if you joined them? But that’s not important now. Just… don’t pressure yourself. As they say, a watched pot of milk never boils. And speaking of a pot of milk…”

She gave the pot a gentle stir and turned off the stove when she saw that it heated to hot, but not boiling, and proceeded to add dark chocolate chips, cocoa powder, and sugar to the pot, gently whisking it.

The scent of the confectionary concoction hit Silver’s nose. It smelled delightful. He felt a little excited about trying some of the drink when it was ready.

Freesia went further, stirring the pot gently and adding in half a teaspoon of instant coffee, a pinch of salt, and a teaspoon of ground cinnamon. She grabbed a small teaspoon and gave the mixture a taste, nodded happily and got a soup ladle ready. She scooped out and served 3 mugs of the hot chocolate mix and placed a marshmallow in each mug and handed them over.

Silver blew on the hot milk so it could cool down a little and took a sip.

“Oh my gosh!” He exclaimed.

Freesia wasn’t kidding. It was really good! It tasted incredibly chocolatey and creamy while not being too sickly sweet. It was enough to bring a child-like smile to his face. The smell alone put any of the junk food of Sweet Mountain to shame. The only criticism he had was that it was very rich. It was comparable to the chocolate-chipped cream sundae supreme from Apotos; it was tasty, but at the same time eating more than one is too much. By the time he reached half-way down the mug, he felt like he couldn’t drink any more or he would get a bit sick.

He looked over and saw Shadow cupping the mug with his the slimmer arms and gave a gentle sip. He didn’t look like he enjoyed it much. His expression barely changed.

“This feels… Oddly nostalgic…” He commented. “It’s good, but it’s not my preference. It’s too… milky and sweet… Though… for some reason it feels familiar. Like I never drank something like this, but I knew someone who did… and often…”

Silver found his response a little strange. It was clear Shadow’s memories were mostly lost, but not completely gone, like faded ink on an old piece of paper. He knew some aspects of Shadow in Sonic’s timeline, though, not that much all in all. He did remember that Shadow worked for the government.

“Was there anyone at G.U.N who enjoyed hot cocoa?” He asked. “What about Rouge?”

Shadow’s expression changed. He looked like he was pondering the question deeply.

“Rouge…?” He thought out loud. “Rouge that Bat…? She was an elite agent and treasure hunter… I remember her a little. She was one of the few people I didn’t hate but… I don’t have any memories of her associated with sweet chocolate. Wait a moment… Yes… She used to buy chocolates on sale after Valentine’s Day every year. I don’t recall if she ever made a drink with them. As far as I can remember… no… she did not. She did have a sweet tooth. But this isn’t it.”

Freesia started working on fresh cannoli for dessert later. She wasn’t privy to the conversation.

Silver thought a bit about it.

“Hey… Earlier you mistook Freesia for someone.” He commented as the thought came to mind. “Do you remember who she was?”

“Hmm…?” He asked, taking another small sip of the hot cocoa as if it were a potion of recollection. “Perhaps I remember her a little… Yes… She made chocolate like this often. I remember the smell of it, and to some extent the taste of it. It was almost exactly like this… But… Part of me feels sad about it… Is it possible to feel both sadness and nostalgia at the same time?”

“Well, it’s possible someone like her wouldn’t be around anymore.” Silver tried to explain gently. “But the same thing can be said about Sonic, Tails, Knuckles, Rouge, Espio, even Eggman.”

“Sonic…?” He continued, taking another sip of the hot cocoa. Silver also drank another mouthful. “That name… I know that name… and I feel… it’s hard to describe. I could better describe it with an image than an emotion. The image being the end of a race, and I won, but I wouldn’t call it a victory. I would call it ‘outlasting’. It’s like a combination of bitter resentment, pride, sadness, and… respect? Can you make any sense of that? I’m not sure I have the right context for it all just yet.”

Silver nodded.

“You and Sonic were serious rivals back in the day.” Silver explained based on what he knew from the past. “Sometimes, it was almost as if you lived just to see if you could win against him. Be it a race, or a fight. From every time I saw you two, you never got along. Is there anything else you remember?”

“I remember… that he wanted me to do something.” He replied. “I think he wanted me to keep a secret. Though, I cannot remember what it was.”

“I guess that means you kept it better than anyone else since you can’t share it anymore.” Silver commented, trying to be optimistic.

“I suppose so…” He commented. “At least I have some confidence knowing I didn’t break that promise.”

After a while, Freesia continued making dessert, and then dinner. Shadow checked through his old diaries, and Silver decided to spend time looking at another book on Freesia’s bookshelf, ‘Little Planet and the Seven Stars of Time’. He knew of Little Planet, but not much else, and he was a little curious. He opened up to the first page that wasn’t the title or contents.

It was an introduction explaining the basics to know of Little Planet with a detailed illustration of what it looked like when it appeared over Never Lake.

Silver never saw the planetoid before. It fascinated him. He continued as it explained the history of when it was first discovered and its strange orbital patterns, in that it didn’t revolve around the Earth, but rather simply appeared and disappeared. It was populated primarily with flowers and plant life while also possessing strange technology that suggested there was a civilisation that lived there long ago, or still lives there to this day. There was even a theory that the first mobians originated from Little Planet and migrated to Earth millions of years ago during one of its appearances over Never Lake.

Silver’s eyes widened in intrigue when that theory was presented, however the book also clarified that it was just baseless speculation as there was no fossil evidence of mobian activity on the planet aside from a strange statue of unknown origins recorded in Wacky Workbench. The more generally accepted theory is that the planetoid itself is a living being. Like a benevolent eldritch anomaly that likes to visit Earth annually. This was the general speculation since there was evidence of civilisation such as cities and working machines and factories, but no sightings of any civilians aside from a few small animals. Also, according to Sonic, during his first adventure on Little Planet, he faintly remembered seeing the planetoid itself thanking him by generating a light show in the image of his face before disappearing for the rest of the year.

It continued on in explanation of the different zones and the mystery behind them. It later continued to an introduction into the Time Stones. The book explained that they were mysterious and powerful gemstones like the Chaos Emeralds. It was said that one could allow someone to travel through any point in time. Collecting all seven was said to grant one control over time itself. Functionally, they were similar to the emeralds, but weren’t the same. The theorised technique for activating them was dubbed ‘Chronos Control’. It was speculated that the Time Stones, unlike the Chaos Emeralds, didn’t possess chaos energy and thus, could never be used to power anything.

‘Interesting…’  He thought to himself, continuing to read along.

Silver eventually found himself engrossed as he learned more and more about the mysterious planetoid and where it could be found. The Time Stones, and their strange relationship with time itself and how Little Planet changed time periods often. He didn’t even notice how much time had passed when Freesia called him to a ready dinner. He suspected he read through around 40 pages straight.

He found himself dazed for a moment before he remembered where he was again.

Freesia greeted him with a plate of spaghetti. He looked out the back window and saw that it was already sunset outside as a beautiful orange light could be seen shining on the tops of the trees.

“Little Planet is a fascinating place, isn’t it?” She commented. “You looked like a little kid with a comic book reading that. I guess you were enjoying it? Come on, dinner’s ready. Come and join us, unless you want it cold.”

She grabbed a milk crate for herself to sit on since there were only two chairs in the dining area. Silver sat down at the table.

“Let’s eat!” Freesia cheered. “This has a bit of a spicy kick to it. I used chili-infused olive oil. Hope you like it!”

Silver grabbed a fork and twirled the pasta around until he got a small amount he was confident wouldn’t immediately spill off, and ate it. He tasted the salt and tomato base at first. The spicy kick came after the first mouthful. It was a little more than he was expecting. He found himself coughing a little because of it. The last time he had anything even close to that spice level was the chilli dogs from Sonic’s birthday party a while back.

“Oh my goodness!” Freesia exclaimed. “It isn’t too spicy for you, is it?”

Silver shook his head. He never liked the idea of admitting his weaknesses to anyone.

‘I have fought super-dimensional beings and otherworldly creatures!.’ He thought to himself. ‘I will not let myself be defeated by spicy pasta of all things!’

So, he powered through. It also helped that the pasta was actually pretty tasty, until the capsaicin kicked in and made it feel like his mouth was on fire. It was salty and savoury with tomatoes, olives, capers, and even a bit of anchovy. He never tasted a combination like that before, and if were a bit milder, he could easily see himself enjoying a meal like it again. The only problem was the spice. He didn’t want to admit his spice tolerance was much lower compared to Sonic, even if it felt like he just learned what the Ifrit would have tasted like.

“Really, it’s not too spicy for you, is it?” She asked again. “Do you want some milk?”

Silver shook his head and tried to wipe the tears from his eyes, unable to do anything about his muzzle turning a little red.

Freesia ignored him and poured him a glass of milk anyway.

He thanked her, and it did help him get through the meal, but he still couldn’t admit it was a little too spicy for him. He didn’t want to be the odd one out at the table and he especially didn’t want to come off as weak to Shadow. Whenever he and Shadow crossed paths in the past, he always tried to show his tougher side, not only because they fought often and he wanted to prove himself, but part of him looked up to the Ultimate Lifeform. He saw Shadow as a fierce opponent in the past, and he wanted to be a strong fighter like him when he got older. Even in his more monstrous and lost state, Silver still felt like he should show his tougher side to him.

Shadow ate his serving with little response, as if he couldn’t even taste the spice whatsoever. He didn’t look like he was enjoying it, but he didn’t look like he was not enjoying it either.

“Oh, wold you like something to drink?” She offered, opening the fridge. “I have milk, juice, and ginger ale.”

“Ginger ale.” Shadow answered surprisingly quickly.

“Ok, ginger ale it is.” She cheered as she pulled out a couple bottles. One for herself, one for Shadow, and she even placed one in front of Silver, too. He didn’t ask, but he didn’t object either. He also liked ginger ale. He did find it a little weird that they all had that exact same preference, but didn’t think much of it. It was a pretty popular drink, so it could have just been a coincidence.

Silver was happy to get the ginger ale, after the milk and the spicy spaghetti, he needed something to settle his stomach. He felt very slightly nauseous for some reason.

Freesia ate her meal eagerly and happily. The table was quiet aside from the clicking of cutlery on ceramic.

“So,” Silver broke the silence a little. “This is pretty good. How come you are a florist and not a chef at a restaurant?”

“My cooking is considered sub-par here.” She answered. “The standards for being a Soleannean chef are higher than most places in the world. Well, that and I suck at making omelettes. I picked floristry because I have a bit of a talent for floral arrangement. It was a hobby of mine to brighten people’s days with beautiful flowers and leaving coded messages behind the species. Did you know there’s a language with flowers? It’s called ‘Floriography’. Even my namesake is a flower from the Iris family that means ‘trust’ and ‘friendship’.

“But nonetheless, I enjoy floral arrangements because I feel like I’m helping inspire people to follow their dreams, or at least making their day. Besides, since I’m self-employed, I can choose what time I can take a day off to continue with my real goals. I guess the whole floristry thing is more of a front.”

“Where are you going to go once the mystery is solved?” Silver asked.

Freesia opened her mouth as if to speak, but shut it as the question seemed to have left her stumped.

“You know… I don’t really know. I never thought I’d get this far.” She replied, honestly. “I mean, I can’t stay here forever. I’m amazed I managed to dodge them for about a year. Though I don’t think that’s gonna last much longer. But we’ll worry about that when it happens. You want me to bring out the cannoli now? It should be ready.”

Silver nodded and he was given a chocolate cannoli. It tasted pretty good. Slightly better than the ricotta cannoli he had a couple of days ago.

However, he lost his appetite altogether before he could really eat much of it.

Freesia wasn’t blind to this.

“Silver? Are you alright?” She asked, concerned. “Are you full?”

Before Silver could dismiss her concern, he felt a slight headache coming on and his sickly feeling began to worsen.

He decided putting on a tough act wasn’t going to help. While he was still strong, he could see the writing on the walls that he was getting worse as time went on.

“Freesia…I… I don’t feel so good.” He confessed.

“Ahhhh!” She screamed. “It’s that gas! Isn’t it?! That purple stuff! I almost forgot about that!”

She scrambled to a phone next to her bulletin board, knocking her plate to the floor in the hurry.

“I’m gonna call a doctor! Just hang in there!” She tried to reassure him in an increasingly panicked tone.

She picked up the phone and her heart almost dropped from her body in dread. There wasn’t a dial tone. There wasn’t any power either, yet the lights above her still worked. The phone line was dead. She got a horrible feeling, a terrible feeling of trepidation raced through her. Her ears twitched. There was the sound of soft footsteps outside. Something caught her eye. Even though she kept the curtains closed, she could see through the thin strip of visibility through her windows, the parting crack between the curtains, she saw sudden movement. Not like the wind on a blade of grass or flowers in her front garden, it was a person. She noticed a few more soon after. She could hear the muted footsteps of multiple intruders getting closer in no time at all.

“Oh Spring Haven In Tragedy! Not Now!” She cursed.

"Freesia, what's happening?" Silver inquired, able to pick up that she was scared of something other than booking a medical appointment.

"There's no time! We need to get out of here, all of us, RIGHT NOW! Silver, I know this is a lot to ask of you right now, but if you can, I need your help to fight off the Children of Faust so we can all escape together. I promise I'll get you to the best doctor I can find afterwards. Can you help me? Can you hold on?!" She yelled. Her anxiety was so intense that it was infectious. Silver felt the fear crawl against his own skin, and he knew it wasn’t just his own fear. It was like Freesia’s anxiety overflowed and leapt towards his own body.

"Freesia, I'm not dying! I’m just a little nauseous and a little woozy. I'm fine! I'll take care of this, don't worry!" Silver tried to reassure her, knowing he had plenty of power left in him, but just wouldn’t be fighting at his peak.

“Alright. Thank you.” Freesia nodded. “I need to get my ‘Get away’ kit ready for a full evacuation. I’ll need you to clear a path of anything and anyone for a few minutes. I’m counting on you!”

Karash!

A window was broken with a brick. There was a piece of paper tied to the brick, but no message, just a familiar picture of a sun. The Children were moving quickly and they meant business.

“Ok.” Silver reacted to the threat with one of his own. “Let’s clean up this trash!”

He started with the intruders at the door. He was ready to activate his powers…

He saw the cyan glow spark from his palms, but in the next second, it suddenly snuffed out.

“What!” He exclaimed as he tried again. His powers suddenly stopped! He couldn’t tap into them. He could focus, but his powers didn’t respond.

The first shots of panic began to hit him as he knew his telekinetic powers were the only real weapon he had in a fight. It began to send goose bumps throughout his body as he suddenly felt vulnerable. He didn’t know what else he could do to fight.

The fear began to set in. His sense of reality began to distort as fear clouded his vision. He heard a ringing in his ears like he was suddenly thrown underwater.

In a split-second later, he felt faint. His legs felt weak and stiff and he fell to the floor. A migraine began to develop soon after. A vicious pulse of pain travelled along his heartbeat and punched the inside of his skull in a brutal rhythm.

Tears began to fall as he tried to get up and use his powers, but he couldn’t. He struggled to breathe and his illness intensified suddenly. Next thing he knew, the pain echoed throughout his entire body. He didn’t know what was going on, but he knew it wasn’t good. He saw a dark purple border at the edges of his vision, steadily growing and consuming whatever light was in his eyesight until everything went dark.

Chapter Text

Chapter 14 - Unseen Terror

“AUGH!!!” Silver grunted. He looked down in horror as the cyan highlights of his golden bracelets and gloves started to lose their colour and become a dark grey.

“Silver!” Freesia exclaimed, racing towards him. “Are you ok? What’s going on? Did they hurt you?”

Silver tried to explain what was happening to him, but the words wouldn’t come out of his mouth. In fact, his mouth had its own problems. It felt like a set of invisible hands held every single tooth and was pulling them with a vicious force.

AAAAAAUUUUUGGHH!!! He screamed.

“Dr. Sow-Had, keep this chest secure!” Freesia commanded, turning to Shadow. “Go to my room upstairs and grab every book relating to the ARK and Project Shadow. There should be a large travel case under my bed. Get that out, pack those books in and keep your diaries safe! I need to attend to Silver!”

Shadow nodded, and promptly followed the instructions.

“Understood.”

Freesia ran over to him, kine in hand and ready to bash anyone close by.

She heard the attackers running towards the backyard and surround them. The danger was closing in on them like a tightening noose of an armed and dangerous militia.

Karash!

The kitchen windows were shattered. The door was soon to follow.

“Silver!” She called to him in a worried and motherly tone as she tried to pull him upright. “Are you ok? Tell me what’s wrong? How bad has the poison gotten?”

Silver’s breathing became more laboured as he tried to focus enough to answer. He tried to cling to as much semblance of language he could manage as the pain kept intensifying. He placed a firm hand over her shoulder and tried to hold on tight as his legs struggled to keep him standing.

“The brain is dying!” He managed to gasp out, his eyes rolling back a little.

“You have a headache?” She tried to infer, struggling to decide what to do next. “Is that it? I’ll get some pain relief tablets!”

She was about to quickly run to the medicine cabinet to get some pain meds, but then she noticed a nasty pain in her shoulder. Something sharp was piercing her skin through the dress. As she looked towards what could be causing it, she noticed Silver’s cyan highlights had changed. They turned a dull grey. Silver’s grip was tight, but something was digging into her. She could see in the corner of her vision, claws already poking through his gloves. Her heart froze as she knew it wasn’t an injury or food intolerance, it was a curse.

“Silver!” She called out to him, trying everything in her power to not panic and make the already dire situation even worse. “What’s happening to you? You didn’t find any eldritch rhinoplasty, did you?”

Silver shook his head. He didn’t even know what she was talking about. It sounded like nonsense. He tried to stay upright, but he lost his grip of her and fell to the floor again. His head felt heavy and the rest of his body felt like it was sinking through the floor as if the world had melted away.

Freesia’s door was broken down in little time. Five people rushed in towards Silver.

“Back up! Back up, I said!” Freesia screamed at them, kine in hand. “Take another step and you’ll regret it!”

They took more than one more step towards them.

She quickly rushed towards them, taking out two in one powerful swing. To make sure they stayed down, she swung her kine like a croquet mallet and sent the same two flying towards the door, making a slight block against more members closing in.

Unfortunately, it did nothing to stop the Children of Faust from breaking in.

They were surrounding the two hedgehogs quickly from all openings available. The Children were human and mobian alike of various ages from teenagers to full-grown adults, all armed with wispons of various colours.

“You took everything from me! I won’t make that same mistake again!” She boasted, slamming her hammer to the ground and creating a shockwave that rattled the entire house

She swung two more times, taking out another two members that got too close for comfort.

However, the Children didn’t give up. Silver and Freesia were still surrounded, with more Children beginning to progress up the stairs, towards Shadow.

“You shall not pass!” The green hedgehog yelled, a charge of chaos energy pulsing through her body and channelling towards the head of her hammer.

“AAAAAAUUUUUUUGGGGGGHHHH!!!” She charged towards them, swinging with speeds she didn’t think was possible. She dashed towards the side of the stairs and swung. She broke the guardrail like matchsticks and smashed two members in the shins, tripping them down and stunning them with a jolt of chaos energy. She then turned back to Silver and swung in violent circles around him, making sure nobody got near him. She became a green tornado of mochi-pounding prowess. However, there was only so much she could do. They fired indigo wispon bullets at her. She deflected them with her mallet like baseballs. She managed to keep up with the onslaught of projectiles coming from all angles.

From her point of view, it was as if time had slowed down. She didn’t know if it was adrenaline or if she actually managed Chaos Control to slow down time, but she knew that it was her desire to protect Shadow and Silver that fuelled her sudden burst of speed and coordination. Her movements were a furious green blur.

Silver was helpless on the ground as he had no strength to even get up. He wasn’t sure anything that was happening was even real, or if the poison in his veins had put him in a coma and he was dreaming everything that was happening. Whatever was happening to him felt like a mild delirium among the intense pain. Either way, he felt completely powerless. He wanted to help, but he could barely move.

He felt darkness clouding his vision, as if pitch black nightfall was a case of cataracts that was developing faster than life. The dark pulses that ran throughout his body felt both cold and hot, but also heavy and strange. Every throb brought on a new level of pain as he felt something like his fur and tail being pulled out individually by a supernatural force. His eyes were closed, so he could only envision what was going on around him. Everything sounded underwater, from the footsteps to Freesia’s voice. He tried to open his eyes and see what was happening and stay awake, but his eyelids were almost fused shut.

He had a splitting headache. It took the ‘splitting’ part to the most extreme degree as he could have sworn that his forehead was tearing itself open from the inside! He tried to rub his left hand over it to feel if there was any injury and felt a strange lump. It wasn’t a lump like he was just smacked in the face with a baton. It felt slimy and gross, but also foreign. It was alive and moving like an alien eyeball suddenly embedded itself in his skull.

‘WHAT IS THAT?!’ He mentally screamed, shock hitting him like he just woke up from a dream about falling into the abyss.

He reached to feel it again. It was still there. In fact, he could feel it ache slightly as he touched it, like it was a part of own his body that was always there. It was a little sensitive too. It hurt, but not like what was happening to the rest of him.

Freesia managed to hold the unspeaking crowd away from him for a while. One of the Children wielded a blue wispon and fought her hammer against hammer. While the green hedgehog’s kine was superior in strength and range, it was nothing more than a diversion. Another member snuck from behind and grabbed her.

“NO!” She screamed as she struggled to get free. Another Child grabbed her and pulled. Another Child grabbed the staff of her mallet and snatched it off her.

“No! No! No! No! No! No! No! No! No! No!” She cried out as she tried to hold on tight as her weapon was being separated from her. In an instant, her grip was overpowered and her mallet was tossed aside like a piece of trash.

“AHHHH!” She mourned the loss of her main weapon, struggling to find any upper-hand. “That’s not my only weapon! Chaos-!”

She tried to ready a chaos blast, even if it was only able to knock a few opponents back. Before she could use it, she was jolted with the electrical current of an ivory wispon. In that moment she was stunned, she had a pair of handcuffs placed on her and she was dragged to the corner.

The last member that looked her in the eyes placed a special collar around her neck.

“Good luck trying to teleport away!” The Child taunted. “That collar inhibits superpowers, from psychokinesis to chaos powers!”

When Freesia recovered from the shock, she wasted no time struggling.

“Help! Silver! Doctor! Anyone!” She called out.

She was gagged with a piece of cloth soon after that.

Silver wanted to help, he wanted to do most of the fighting, but he could barely stand in the pain he was in.

He felt a sudden pulse of power run down his arms. He hoped maybe, his psychokinesis had returned to him and the nightmare would soon be over. Trying to get back up, he tried to tap into his power again and channel it through his right hand. Instead, he felt a vicious jolt that felt like a nasty electrical sting.

“YEOUCH!” He exclaimed as pain reached his fingertips.

His right hand began to feel insanely inflamed soon after as his glove felt tighter and tighter. Eventually, he heard the faint sound of it tearing at the seams. He tried to move his fingers, but he realised they no longer moved individually. They could only be moved together and open and close into a fist. His left hand felt fine for some reason, his glove only feeling a little tighter than normal.

His muscles felt like they were hot magma steadily hardening as he felt physical strength he never knew he could have. It made him feel heavy like stone. However, such strength was worthless if he still couldn’t stand up to use it!

The scientist once known as the beast of the ARK came appeared at the top of the stairs, baggage in hand. The intruders caught his eyes. He recognised their symbol anywhere.

“You…” He snarled, 180 years of payback stockpiled and ready to unleash. “You want to revive the light? By drowning me in the darkness?! Then I hope you’re happy! I hope you’re ready for darkness that will eclipse a new moon!”

The heavily mutated ultimate lifeform stomped on the ground with one foot, a pulse of dark energy exploded from his body. It left the house untouched, but all the Children around him began to shake in terror as the wave struck their bodies. It didn’t appear to damage them… physically anyway.

Shadow charged down the stairs, his eyes glowing a furious red. His broader arms swung around, clobbering one Child to the ground, breaking the floor in the process.

RRRRRRAAAAAAAAOOOOOOOOOOOOUUUUUUUGGGGGGGHHHH

He roared the same way as he did on the ARK, a hauntingly sorrowful and pained roar that shook the ground and made everyone around him, including Freesia and Silver, shudder.

Shadow took in a deep breath and exhaled his strange toxic cloud once again. Unlike before, the Children before them weren’t wearing breathing protection.

The Children of Faust backed away for a moment. Those closest to him began to seize up and stopped in their place.

“This gas mixes with the atmosphere and forms a dangerous nerve agent!” Shadow taunted, his voice intensifying in a deep a monstrous tone. “Once it is inhaled, it enters the bloodstream and acts quickly!”

“You forgot one thing!” One member shouted from the back row. “This area is well-ventilated! You can’t gas the whole planet either!”

Soon after, the once-paralysed Children in front of him were able to move again. He blasted another round at them to keep them stuck in place to buy some time as the ones who were out of range started firing away.

Fortunately, Shadow still had his dark projectile attacks from before, and 4 arms capable of firing them.

Orbs of dark energy collided with wispon projectiles, cancelling each other out in a puff of smoke. It didn’t matter how many were being fired, Shadow managed to keep up with each one. However, much like Freesia’s speedy swings and mallet proficiency, it was just a distraction from the real attack.

The children behind him took advantage of the compromised flooring, and swung blue wispons down to the ground. The impact was intense enough to flip Silver over from lying on his back to lying on his belly instead.

The impact also caused the floor beneath the half-eldritch hedgehog to collapse. Shadow was trapped for only a moment, but that time he spent stuck meant time that the Children could incapacitate him. He managed to buy himself a little bit of time to regain his bearings by releasing another cloud of paralytic gas. However, he was still vulnerable from behind…

Meanwhile, Silver tried push through the pain as he knew was still needed, but he struggled to even open his eyes and see what was happening. It was as if his eyelids were so much heavier and couldn’t move and open like they should.

Then, as if whatever invisible entity causing his agony had loosened its grip, he found himself able to breathe normally again. The pain suddenly subsided like it never existed.

“Shadow is vulnerable! Now is your chance to avenge your brethren!” Silver heard a strange voice in his head that caught him by surprise. He jumped a little hearing it. The voice was familiar, but also menacing. He knew the voice, it was unmistakable, but he couldn’t place a name to it.

He attempted to open his eyes and look around again, but he didn’t see the walls, he saw the intruders. The house itself was basically non-existent. It was as if the assets of the house and the furniture didn’t load, but the collision and the inhabitants still did. He saw Freesia next to him and Shadow stuck in the floor. He saw the Children surrounding him and the many more reinforcements waiting outside. Whatever happened to him, it felt like he was in a dream-like state and unsure what was real and what wasn’t anymore. Regardless of his perceptions, he knew the danger was very real and he needed to act.

‘What happened to me? Is this because of that purple stuff Shadow sprayed on me?’ He thought to himself. ‘What was that stuff? I just hope this isn’t permanent…My body… It doesn’t feel like my body…’

He turned to face Freesia, who was tied up with her back against one of the walls, and he noticed something even stranger than his strange sense of vision. Not only was he able to see people past any walls or obstacles, he saw what they were feeling. He could sense Freesia’s fear next to him. She was terrified, angry, and… she felt a little glimmer of hope. He felt those emotions ripple across over his own body. It was more than empathy, he was able to feel her emotions. She looked defeated, but deep down, she had one more trick to pull. He felt it.

He turned towards the Children of Faust and counted them. Minus the ones Freesia and Shadow already knocked out, there were 19 in total remaining.

They all had their attention of Shadow at the moment, but he was definitely next. There was no mistaking it.

He sensed their malice. It was like a ripple in unison throughout all their individual bodies. All of them were interconnected in a psychic network with strands connecting one another in an elaborate web. He felt it. He read it. He could almost reach out and touch it. In fact, he could touch it.

He felt a part of himself beyond just his physical body reach out and link himself up to the invisible network. They didn’t notice him like he noticed them. It was like he suddenly found a secret room only a few knew about and was invisibly observing the inhabitants. As he did, he felt their joined malice and bloodlust surge up his connection and flooding his body.

He realised he still had his psychic abilities, but they’ve changed. He wasn’t powerless, he just wasn’t using telekinesis anymore! He became a telepath and an empath!

As Shadow was still vulnerable, he was soon met with a painful zap of an ivory wispon. It wasn’t enough to stop him from moving, so he was hit a few more times. In that moment of being unable to act, he too found himself hand-cuffed and with a power-inhibiting collar placed around him.

Silver was the last one able to stand. It was all up to him to fight back.

‘OK! Whatever has happened to me can be focused on later, right now, I just hope I can still fight with these abilities! There has to be something I can do!’ Silver internally pep-talked himself, trying to draw in the malice of his attackers.

It felt like a small electrical jolt that was neither hot nor cold, but it was definitely a kind of energy. It was unlike anything he had ever experienced, and he could feel the bitter malice he somehow collected start to overshadow his own feelings. It tapped gently at his mind like another presence. From there grew an impulse, starting as a small temptation. As it grew, he felt himself growl a little.

No, he felt more than a growl coming on.

Something much more wanted to escape his mouth.

RRRRAAAAAAAAOOOOOOOOUUUUUUGGGGGGGGLLLLLLLHHHHHH!!

An unnatural roar boomed from his mouth. It sounded unlike anything else that could be heard from any animal that ever existed. It had a horrible reverb to it that grated against ears and shook the furniture around him. Even the howl of a werewolf would have sounded calming and reassuring by comparison. He felt the unanimous shudder of everyone echo down the network. He sensed fear. He reciprocated that fear in his own heart.

‘What happened to me?!’

Knew he had to fight, but he wasn’t sure how. He had to improvise.

“Another monster to take care of!” The next target shouted, seemed to be a human leader. “We know what to do, Children!”

RRRRRRAAAAAUUUUUUGGGGGHHHLLLLLLHHHHHH!!!

He roared at them again, as a warning, hoping that his recent condition would demoralise them a little. He hoped he would be able to handle whatever they were going to throw at him. He took in a deep breath in anticipation. He felt their malice course through him, and he was going to return it back to them!

He charged forward. The next closest Child, a young human man, staggered a little at the sudden rush, but pulled out his red wispon. Before he could pull the trigger, Silver beat him to it. He punched the man with his left hand, and then pulled him back up with his right hand. Clamping down hard on an arm, he swung up and tossed him into another Child, another human male, taking down two at once.

He heard the footsteps and saw the remaining members going after him.

“You wanna fight?” He taunted. “Alright, I’ll take you all on!”

He noticed the Children around him weren’t fighting as fiercely as they did with Shadow and Freesia. The fighting edge they once had was much more blunt.

He grabbed the wispon off his last target. He could feel the terror of the wisp inside as it quickly fled the weapon, rendering the weapon unarmed and useless.

That didn’t stop it from being useful by other means. Silver threw it towards the next Child that was closest to him, a male mobian bear. It hit them square in the chest and knocked them to the ground. Silver didn’t stop there. He had to quickly make sure they would stay down.

He reached out with his right hand and grabbed the bear by the shoulder. He realised in the lunge, his arm could stretch out and retract, like a grappling hook of sorts. He dragged them towards himself and picked them up easily with is sudden newfound strength. With a quick toss, he threw them at another Child, a mobian fox girl, and had her pinned under his body. Another two down.

He noticed them regroup around him, no longer paying attention to the house. They had other wispons ready. A mobian cat girl tried to fire at him with a green wispon, blasting him with a powerful gust of air, but he stood his ground, barely moving from where he was.

Silver grinned, showing off teeth he wasn’t sure had changed much or not. He felt her bravado turn to fear as she quickly darted behind the rest of the group. Two more members ran up to him, a human woman and mobian hedgehog respectively, and pointed their wispons at him. They were both ivory wispons.

Silver was about to charge at them, but he got struck and electrocuted by the ivory whip before he had the chance. The electricity jolted through his body and he felt his own heartbeat struggle before it reset. In the meantime, he was on the ground, comforted only by splinters of broken glass from the window.

“You are surrounded!” The human woman shouted to him in a tone not unlike a police officer or agent of G.U.N. “And you’re can’t throw stuff at us like you normally would, Silver. You’re allies are already defeated, you cannot win. Give up now before you get yourself more hurt!”

Silver might have ended up on the ground, but that didn’t mean he was ready to give in just yet. He wasn’t going to let them win.

He bided his time, trying to understand his sudden power exchange from psychokinesis to hyper-empathy. He reached out the psychic link forward towards his targets again. He felt their ambition, bravado, and malice. They spoke as if they were upholding justice, but that was the surface. It was just a facade.

As he dug deeper in the psychic link, he found himself able to read their thoughts. Overlapping, but legible, he heard the thoughts as words in his own mind. They were taking orders from a higher power and any semblance they had of individuality or individual morality was an illusion. They may have been diverse in terms of the mix of human and mobian, but all their thoughts were the same, almost in unison. He wasn’t exactly too sure what the proper term for it was, but the reality of what the Children of Faust really were was terrifying.

They all thought: ‘Oh Master! Grant us advice for how we can please you! The giver of precognition! The father to our family! The bringer of light in the darkness! We are your children and we ask for your power!’

He reached out across the network, including the members he managed to take down. He managed to not only feel what they felt, but he felt their negative emotions run down to him like he was a magnet. He felt like he turned into a psychic vampire as he felt it begin to course through him. He felt it build up within himself, like a power gauge filling up. It wasn’t like absorbing the malice from earlier. It was much more intense. He was sapping away much more.

He felt it travel through his body. It was like a new source of power. He couldn’t just make himself angry off their anger and fight like a wild beast… He could do something else. He felt energy and strength drawn from it. Something that could be wielded according to his own will. It didn’t feel too different from his psychokinesis, at least that’s what he hoped.

‘Come on! I have no options left! I need to win this! Not just for me, but for them! Let this be something I can use!’ He pleaded deep down.

With a ripple down his right hand, he felt the sudden power expel to a strange, shapeless form in front of him.

“What…?” The human woman taunted in a mocking tone. “Do your powers not work anymore, sweetie?”

The energy form lingered a little longer, then it began to change shape. It manifested as a powerful monster. Whatever it was, it didn’t have a physical form. Silver felt the raw power he absorbed from the crowd wasn’t in his body anymore. Whatever he absorbed, was what made up the creature before him. The emotions that turn thoughts into violence!

It moved outside Silver’s will as it began to take on a more defined shape. It developed vicious jaws with a giant mouth as well as sharp teeth and claws. Had 4 legs, but could stand on two without too much issue. It had no eyes. No real body. It simply existed.

It began to rush the crowd. It extended outwards like a creature of primeval times, existing only on instinct and savagery.

It didn’t make a sound, it just attacked. The members closest to Silver suddenly collapsed to the ground with the air knocked out of their lungs as the manifestation pinned them with its front legs.

“What is that?!” One member exclaimed.

“Looks like psychokinesis to me!” Another answered. “Fire at will!”

A few wispons were fired, ivory lightning, red burst, and indigo asteroid were fired, but not a single projectile hit the mutated psychic hedgehog. They all stopped just before him. The manifestation acting as the shield.

The creature that spawned from Silver’s corrupted abilities circled around him, and charged at his attackers, biting down and crushing the weapons in its teeth before slashing at anyone who got close.

“No!” A member from the back row exclaimed. “This isn’t psychokinesis! This is another monster and the blasted thing’s invisible! Keep firing!”

The other members kept firing their wispons, even firing a small black hole from a violet void wispon, but nothing damaged the invisible monster formed from psychic energy and negativity.

If anything, it only made the creature angrier. It charged harder, slashing and biting the group, taking them down one by one, but never straying far from Silver in the process. It was like the new creature was tethered to him, but couldn’t be controlled by him. Like he was the battery that powered a killing machine.

It charged towards anyone nearby and bit down on one, picking them up in its mouth, while swiping and knocking another Child into a fence nearby. After shaking the Child in its mouth enough, it threw it upwards with a swipe of its head and they landed on the lawn, the breath knocked out of them. The mutated hedgehog felt terrified at the potential his new powers carry.

Silver partially studied the manifestation. It looked like a feral monster, something almost demonic that stood tall with a massive mouth and sharp teeth with thick arms and vicious claws. It lacked any eyes, ears, tail, or even a throat. It looked all in all like something out of a horror movie of sorts.

Silver could see it, unlike everyone else, but it wasn’t alive. It was like a fire in a way, it could consume and destroy and die, but it wasn’t alive. To Silver’s strange vision that saw living things, but not inanimate objects, it was translucent and had an aura of negative energy about it. It reminded him of Shadow back on the ARK and how he fought. It was just a feral, savage mess of teeth and claws that was invisible, indestructible, and somehow a product of corrupted psychic abilities.

Just out of his vision, Freesia got to work while everyone else was distracted. Curling up into a ball, she managed to move her arms from behind her, under her legs, to in front of her. Reaching up towards her hairclip, she pulled it off, revealing that it wasn’t a hairclip. In fact, it was a tool. Within the pin’s lining, was a myriad of various picks for various locks. She pulled out a thin piece of wire not unlike a bobby pin from the assortment.

She began to pick the locks on her while the carnage unfolded. It didn’t take long. She had too much experience with cuffs. As everyone was distracted, she made her way to her kitchen and began to look for something capable of breaking the collar that inhibited most of her strength.

Trying to not make much noise and be noticed, Freesia searched through her cooking utensils and found a tool that would be out of place in any kitchen, a small pair of bolt cutters. She was glad that she decided to keep a pair lying around for an emergency occasion like that. However, before she could free Shadow next, she needed to grab a few more important items.

In the carnage of tackling, biting and slashing against the small army, Silver could only count another 5 members remaining, a human, a wolf, a cat, a hedgehog, and a shingle-back lizard altogether. However, the creature began to fade and cease before more could be done.

As soon as it faded, Silver felt a sudden wave of fatigue wash over him, like what happened when he overexerted his psychic abilities. He felt dizzy and fell to the ground, barely able to move.

The last 5 children around him took advantage of it and ran towards him. They pinned him to the ground, pointing 2 blue wispons, an ivory wispon, and 3 indigo wispons respectively towards him.

Silver tried to reach out with that strange psychic hold he developed, but couldn’t syphon their negativity for another round again. The best he could manage was simply reading their thoughts and feelings. He decided to dig into their thoughts, having not many other options.

He heard a strange voice among over all 5 of them. It was the same familiar voice he heard in his head before. This time, he knew it was a voice speaking to all of them at once.

“Make sure Silver is properly captured and unable to escape!” The sinister voice ordered. “While you were focusing on the unseen threat, Freesia has managed to escape! She is weakened, so recapture shouldn’t be difficult. I trust you to carry this out, my Children. Let’s snuff out this darkness and work towards reviving the light! Now go!”

“Yes, Master…” All 5 chanted in unison.

Silver gasped in horror. Their leader was managing to communicate telepathically to them, if not completely mind control them. He also realised that if he couldn’t do anything, all three of them were toast! He knew that Freesia wouldn’t be able to fight the rest of them off by herself, especially not to the same fervour she had trying to protect him.

‘I have to get back up…It all depends on me!’ He thought to himself as he tried to plan around his sudden powerlessness. ‘But I can barely move. I can’t… lose here!’

He tried to move his right arm towards one of them, attempting to grab one of them by the leg and pull them to the ground. However, he instead felt treads of a shoe on his wrist as it was pinned in place.

“You have no other options, Silver.” One of them taunted him. “You can’t fight back.”

He couldn’t give up, but he also couldn’t do anything either. He was too weakened and his strongest ability had burned him out.

However, he didn’t have to fight anymore.

He noticed a figure walking towards the 5. It was Freesia! She was sneaking up behind them. With Silver’s strange sight, he noticed that she was emitting a strange energy all over her body in that moment. She was clearly sneaking up behind his captors step by step. At first, he wondered how she wasn’t noticed by them. It reminded him of Espio’s camouflage abilities to stay hidden. Then it hit him, she had the power to make herself invisible! With a swing of her mallet, she managed to send 3 of them flying at once. The other two turned around to confront her, but what happened next took them off guard.

“Chaos Stun!” She called out as she slapped the remaining two in the face. They were both jolted with a small charge of chaos energy that paralysed them for a brief moment. Freesia then swung her mallet one more time and sent the last two a few feet.

“You’ve done enough, Silver!” Freesia explained, grabbing his left hand and pulling him up. “I just need to quickly grab a few things and we’ll leave immediately! There’s no going back now, so say goodbye to this place! I promise… I know somewhere safe we can go to. Just… Follow me!”

Chapter Text

Chapter 15 - Blooming Butterfly Effect

As Freesia pulled him up, Silver found himself losing balance from the fatigue and stumbling a little. She managed to catch him before he inevitably fell again. Not having any time to see if he was strong enough to walk, she flung him over her shoulders like a father with a disobedient toddler.

“You did great.” She complimented, cradling his legs firmly.

Shadow was nearby, suitcase in hand.

“Where do we go?” He inquired.

Freesia turned towards him, Silver hanging over her shoulder.

“There are a few other things I need to grab first.” She explained. “Some personal and… irreplaceable things.”

Shadow nodded.

“Do what you need to.”

With Silver still over her shoulder, she ran towards the bulletin board and carefully pulled off every photo and letter and stuffed them into a dress pocket. She also quickly ran upstairs and grabbed a book off her bookcase. She handed it to Shadow, who in turn placed them into the suitcase, and nodded.

“We have to get to the Forest.” She explained. “I made a small campsite in case they ever found me!”

Shadow nodded.

Freesia took one last look at her home, and silently said her goodbyes before running off, Silver slung over her shoulder and Shadow followed close behind her.

Into the early evening, they ran off down the darker backstreets, making sure to be out of the field of vision from most Soleannean civilians. Nonetheless, Freesia kept an ear out, carefully listening for footsteps behind them. She could hear a small group behind her in the distance, likely the members she stunned before. Her Chaos Stun abilities were very weak, but useful for buying a bit of time.

As she ran, carrying Silver with her, she passively reflected on how she ended up in such a situation. Where was the catalyst that led her to being on the run for many years? When did she go from an ordinary hedgehog to someone who struggles to live each day in the brightest future? What decisions and mistakes did she make to somehow end up on such a strange, yet dire path?

The only thing she could think of was her 8^th birthday. Every moment after that was what sealed her fate.

On that birthday, she was given her replica emeralds as a present from her mother. She remembered the way they glistened in the light. Despite being only a replica and not the real deal, there was something about them that drew her towards them. Much like her large hammer, there was something that just felt correct about holding an emerald in her hands. They quickly became her most prized possessions as a kid.

She heard that they had the same wavelengths and properties, but simply lacked any real power. She remembered reading about Chaos Control and how anyone was capable of performing them with a real emerald. She wanted to pretend that she could with those fakes.

It was after school and she practiced in one of the denser parts of the central park in Empire City, isolated from the rest of the world. She felt embarrassed about being seen trying to do something anyone could tell her would never work. Chaos Control could only work if the emerald was real and filled with the magical energy that could turn thoughts into reality.

At first, she was just playing pretend. She was simply pretending it was the real thing and enjoying the fantasy of being able to teleport around like she was the Ultimate Lifeform.

She got caught up in her play, shouting “Chaos Control!” with her shiny rock and running to a different place and pretending she teleported. As her little game continued, it was as if her fantasy had crossed over into reality. Despite not intending to actually do it, she saw herself get engulfed in a flash of light. Before she knew it, she was a few centimetres in the air and falling down. She knew she didn’t just jump, it didn’t explain the flash of light. It was something much else.

It couldn’t have been a fluke. But using Chaos Control with a fake emerald should be impossible.

She needed to know, was that real? Could it be replicated?

So, she tried again, and again, and again.

There were a lot of failed attempts.

But, right as she was about to give up, she tried one more time.

Then she managed to teleport upwards and landed on a tree branch. In that moment, she knew she didn’t jump there. She knew she warped. She could feel the replica emeralds had no power to them. They didn’t glow, only glisten in the sunlight as if they were just pieces of glass. Yet she was able to use Chaos Control with a fake emerald.

That fateful moment…

It was as if something had awakened within her. It was the moment she no longer felt ordinary. She couldn’t pretend she was just a normal green hedgehog.

Not many mobians had any abilities, but the most common powers were psychic powers like telekinesis, pyrokinesis, hydrokinesis or terrakinesis. Chaos abilities were a rarity among rarity.

She realised not only did she have powers, but that she had exceptionally rare ones.

‘That was 14 years ago…’

The point in her life where she wasn’t ordinary anymore.

She practiced her newfound abilities in secret. Eventually, she ended up being able to warp from one end of the park itself to the other in an instant.

If she could power a fake emerald enough to work like a real one, even for a brief moment, what else could she do?

She wanted to learn more about what she was capable of. Eventually, she remembered her mother telling her about the scientist that studied chaos energy, Dr. Sow-Had. In the secret of the night, she began to study the diaries for herself to learn more. She learned that the replica emeralds were capable of allowing someone to use Chaos Control… but only when they had a charge of chaos energy already in them such as from a Chaos Drive. The only other way was if the user themselves had chaos energy within them.

That was the day she realised that she couldn’t just use Chaos Control.

She remembered trying to use Chaos Control to stop or slow down time with the replica emerald, but she never succeeded. But she didn’t mind, she was just happy to be able to use any powers at all. But she had a feeling it wasn’t just the emeralds that allowed her to warp.

She tried to practice Chaos Blast, but could only knock a few leaves away with a small force emanating from her body. Eventually, she managed to knock a few twigs away, and then a few fallen limbs away with a small shockwave that barely projected a metre in diameter. When she fought Shadow only that morning, it was the most powerful Chaos Blast she ever managed to pull off.

Then she tried to practice Chaos Spear. But no matter how hard she tried, she never managed to perform it anything remotely like Shadow the Hedgehog. It never shot from her fingertips or formed into a javelin. It only managed to spark in her palm and no further. So, she could only manage to stun targets by slapping them or tapping them when her hands were charged with what little power she had. She discovered that by accident when she got angry at a kid at school and slapped him in the face, unaware her hand was charged with chaos energy. As far as anyone knew, she just had a static charge and slapped him very hard.

She never shared with anyone what she could do, no matter how much she really wanted to. It wasn’t because she was ashamed of how comically weak her powers were. It was so she would always at least have a small advantage by keeping her true potential hidden. Not revealing every card she had on the table was the only way she managed to get so far. That was a philosophy she had as a young teen and it rang true throughout a large chunk of her life.

But nonetheless, she tried to master them as best she could. As she studied the diaries to better understand how chaos power worked, she began to notice the more personal side to the diaries. They weren’t just scientific entries, but also personal ones. There wasn’t much information to tell a full story of his personal life, but some of the entries piqued her interest.

… Condition has been identified as what can only be described as ‘Temporal Displacement’. Notable symptoms include strange and distressing ‘flickering’ within reality.

5 hours ago, Venice had disappeared for over an hour. He could not be found anywhere no matter what. Not even his chaos energy signature could be detected within this reality and timeline.

When he was found, his clothes were partially singed and his eyes… He may be too young to remember what happened… but if the look he gave me meant anything… Perhaps that is for the best he won’t remember this. He didn’t care about eating. He wasn’t tired. He had to be held by his mother for over an hour before he settled down again. Part of me wonders if he is aware of his distressing condition.

Memoria is even worse.

The longest disappearance she suffered was over 5 hours. That was approximately 47 hours ago. When she reappeared, she was suffering dehydration and was snarling like a wild animal. Where did she go? I needed to physically restrain her so she didn’t break all the furniture in the house. She definitely has her mother’s strength, even as a toddler. It was physically exhausting to keep her restrained long enough to calm down again. When she calmed down, I noticed she had bites and scratches all over her body. What happened? What attacked her? How scared must she have been to act so feral?

…

…

…

I have a hypothesis on how they developed this condition. The only explanation I can think of is that perhaps they are drifting between two timelines. If something was wrong in the state of space-time, that wouldn’t explain why these twins are the only ones affected? Could it be a manifestation of chaos energy instead? I’ll have to take some readings to determine what’s wrong.

I fear something very drastic may need to be done. I can’t shake this feeling. The amount of work I do for my research doesn’t help either. Perhaps I can contact Miles Prower for some advice or a second opinion to it all. I can’t afford to take a stab in the dark. I need to be absolutely certain of not only their condition, but also what can be done to cure them.

If I can’t… If I fail… I… I can’t afford to think about that. I have to be strong for their mother.

She doesn’t know how dire the situation truly is. I don’t want her to find out. If I see such pain in her eyes I couldn’t live with myself. I am not one to tell a lie but… I can’t tell her what I know. She’s already worried and stressed enough. She managed to keep a secret to keep me safe, I have to keep this secret to protect whatever innocence she may have left.

I told her it’s just a manifestation of chaos powers and they will grow out of it soon enough. I told her, as an expert in chaos energy research, I would be able to find a solution to their “teleportation problems”. I am not sure she is fully convinced. If I am being honest with myself, I am not sure I would be either.

…

…

…

A voice has been speaking to me lately. Perhaps it’s intrusive thoughts from the amount of stress I am under, but the voice in my head is mocking me. It is saying that nothing can be done to save them and no matter what I do, I will suffer a horrible, horrible fate.

Apparently, the followers of a mysterious god are coming after me. He wants me to suffer dearly. I don’t know why. I don’t know what I did to anger such a god.

Is it to atone for my past transgressions?

Haven’t I already done enough to be considered redeemed?!

Haven’t I sacrificed enough to save this world time and time again?!

Of course, I already know the answer to that. In this world I wish to make a better place, it will never be enough. I will never suffer enough in the eyes of this world.

But my own self-pity should not be the priority. This is no longer about me and my problems!

They will be coming after me and-!

The end of that entry was scribbled out to a point where it’s completely illegible.

They will be coming after me and the twins I am trying to save.

All the more reason I have to hurry!

…

…

…

There’s no doubt about it. With data collected from the Jewelled Scepter with permission from Princess Blaze, it’s clear as day that Venice and Memoria are suffering Temporal Displacement. What’s more, the time they ‘flicker’ between is unstable. It’s as if they are travelling to a timeline that doesn’t fully exist except for some remnants. That might explain why they always looked so horrified every time they returned. What would such a horrific place look like? I’m just glad they are both too young to remember any of this. I hope that they don’t suffer any nightmares from it all.

Now… I need to find a solution. With help from Miles Prower, I was able to craft a simulation mimicking this situation as a way to try and predict their condition based on how it has been progressing so far. According to the simulations, their condition will progressively worsen until…

… … … The end result would be horrific to say the least.

According to the simulations, I have only a month to find a cure before they may suffer a fate worse than death.

…

…

…

Their condition has started getting worse. I have a hypothesis on what can be done to cure this. If the cause is that they are anchored between two timelines, with one of those timelines being drastically unstable, the solution would be to try and sever the ties to the other timeline. My only hope now is the Prototype Solaris in Soleanna. I need to get the Duke’s permission. Perhaps with the machine built to correct temporal mistakes, I can fix this tragedy.

But then there’s the cult that wants me to suffer fate worse than death.

I could fight them off, but this voice in my head, these monsters… They’re everywhere! But even worse, they’re ordinary people. They aren’t a single enemy or an army of mindless drones that can be fought. They are everyday people. They are anyone and everyone, anywhere and everywhere. Even my own division has been infiltrated. Apparently, their god has granted them insight into the future. They’re not only everywhere, but also know what I might do and when.

I caught word that these monsters managed to cause Sonic’s reputation to tank with slander and rumours.

These monsters managed to destroy SONIC’S reputation! The world-renowned hero of the world beloved by all except the wicked-hearted… They managed to destroy him without violence?!

What chance do I have if the legendary hero couldn’t save himself?

I haven’t been able to contact him for a few months now. He has been classified as M.I.A and his energy signature can’t be found anywhere on Earth. His wife came by to ask if I had seen him. I told her I would start looking for him as soon as I can save-!

The passages were scribbled out again, as if the author wrote something down that he really didn’t want anyone to find out in the off-chance somebody else would come across the diaries.

As soon as I can cure these children before the simulated deadline when the displacement will destabilise beyond the point of no return. I’m worried. I’ve been worried about a lot of things really. My wife has noticed I haven’t been sleeping at night anymore. I’m feeling burnt out already. But I can’t afford to rest easy. Every moment I have I am dedicating to curing this insidious disease!

I won’t give up. It all depends on me!

…

…

…

Time is running short. I thought I had another two weeks left. Now I am lucky if I have a few more hours! The simulations were wrong!

Venice and Memoria’s condition is deteriorating rapidly. I don’t know how I can stabilise them!

I may not have time to adjust the machinery correct to only sever ties to one timeline. But would my cure be a worse fate?

But even then, even if I succeeded, there’s still the cult that wants me to suffer. The voice in my head isn’t my own thoughts!

They’re after me! They’re after her! They’re after these kids!

Even if I cure them, we will be chased to the ends of the Earth for as long as we live!

There has to be something I can do to cure them and grant them absolution from the punishments I have been tormented with as soon as the voice appeared in my mind!

I have only one idea on how I can do both. However there’s no telling if it would be worth it, but what more can we lose? Things could not be any more dire!

I can’t be idle about this!

I need to do this!

It’s the only way to save them!

…

…

…

I saved them… but who is going to save me…?

The final entry in the diaries never failed to give her chills.

But it was also hard to understand it all. She realised the diaries weren’t just guides and research about her powers. It was another story that was buried over 180 years ago! She needed to know what happened to this Doctor. She needed to know the ties he had to her family. She almost wished she never peeked at the books, because she discovered something she knew would be a great focus to her life. She could almost divide her life not between childhood and adulthood, but between before reading those diaries and after.

So, in between research on chaos powers, she researched the life of Dr. Sow-Had, and tried to figure out the group that came after him and the tragedy that befell him.

However, she found nothing but dead-ends. The diaries were one of the only concrete pieces of information that he once even existed. Whatever she was trying to find, didn’t want to make itself know.

Then came the day her mother found out of her powers.

That was the day the questions she had intensified.

‘That was 10 years ago…’

She was getting skilled with her weak chaos abilities, but she was also skilled at keeping them hidden. Naturally, she got careless since such powers were so rare, not many people would believe she could use them.

She used to teleport around her house. Namely, she liked to go between her room and the attic where Dr. Sow-Had’s diaries were kept. It was an ordinary day when her mother checked in on her in her room just as she teleported into it, appearing just above her bed. There was an awkward silence as the mattress bounced the green hedgehog ever so gently as she landed.

“Freesia… Was that Chaos Control?” The burned-in memory replayed. “How do you know how to do that?”

Memori didn’t sound proud or amazed. She sounded like she was terrified.

“I learned how from Dr. Sow-Had’s diaries, mom.” Freesia lied. “There’s a page explaining how to perform Chaos Control. I used the replica emerald to do it.”

“Freesia… Those replica emeralds don’t work without a power source, and I know you don’t have access to chaos drives.” She replied, seeing right through the lie. “The fact that you’re able to use them… Oh, Freesia…”

That was the day Memori told Freesia many secrets she could never forget.

“Freesia… There’s something I need to tell you. You’ll want to sit down…” Her mother continued.

She was around 12 at the time. She didn’t know what she was going to be told. At first, she thought she was going to be punished, even if she didn’t know why she would be punished for having powers. She sat down and looked at her mother.

Memori was a dark indigo hedgehog with reddish-pink highlights along her quills. Her arms and legs were a peachy colour like her muzzle. They would be indigo like the rest of her, but she shaves the fur regularly for her occupation as a caretaker and nurse at an aged-care home. She did it to look more human and less threatening-looking to the frail elderly patients in her care.

Her eyes were a golden yellow in colour and her quills were unusually shaped. Her quills slicked downward from the back of her head, but had four quills that faced forward and curved slightly upwards, two on each side of her face, seven quills altogether. Even when hedgehogs could come in different colours and shapes, she was very unusual.

She had a few other oddities too. Namely, she had a very strange tail. It was long, thin, and had a pointed barb at the end. It looked alien. There was no explanation for why she looked that way. She also had a scar over her left eye, covered by a white eyepatch with a pale purple butterfly embroidered on it. Memori told her that she didn’t know how she got that scar, but she once had a nightmare about living in a world where everything was on fire and a terrible monster had slashed her across the face.

“Freesia… you come from very unusual origins.” Her mother continued. “You’re not adopted, if that’s what you’re thinking. Anything unusual about you is my fault… and I’m sorry. What I’m about to tell you, shouldn’t be told to anyone, even someone you feel like you can trust. Not even your father knows what I’m about to tell you and you have to make sure he never knows either. If you were able to keep your powers a secret from me for this long, I know you can keep this a secret too.”

She remembered how pained her mother looked each confession. The fear in her eyes and the quiver of her voice was strong. Freesia listened to every word her mother had to say, because she never saw the indigo hedgehog lose her composure like that before, and never would after.

“Freesia… I’m actually….I’m part-! I mean… My family is…. I mean… uh… uh… um… this is so hard for me to say… I’m actually terrified, but I have to tell you… I’m ……… Freesia, I’m… I’m not from this timeline… You know of Silver the Hedgehog from the history books I used to read you? Well… I’m like him! I’m also a time-traveller.”

Freesia gasped, almost thinking it was just a story or a joke, but Memori’s tone of voice was rather dour. She wasn’t joking.

“I’m not from this time, Freesia.” Her mother continued, her voice no longer quivering as much as before. “I’m from the past. I don’t remember what year specifically, because it happened when I was very young. I didn’t know who my parents were, but I was found by a strange robot and it took me to a time capsule that explained everything I know now. It was full of notes from my mother, and those diaries from Dr. Sow-Had. I was asked to keep the diaries safe and secret from the world. The letters explained how I was sent to the future to keep me safe from the Children of Faust and cure me of an unusual condition I had as a child, and how I had the chance to make a new identity and live a new life. I can only presume I was sent through time by the doctor and that’s why I have his old diaries.

“And I did start a new life, Freesia… I… There’s a lot of secrets I carry… You see I’m… I…. My… My real name is… Memoria Robotnik. I don’t know why that’s my last name, but I guess I’m a distant relative or associate of Professor Gerald. Nonetheless, that is my real name.”

Freesia silently gasped. She then realised why her family inherited the diaries. Her own mother was one of the children the doctor saved!

“I was Memoria Robotnik. I also have Chaos Powers, and I was once someone to be greatly feared by heroes and villains alike. I do not like that side of me. While your father knows I have powers, he doesn’t know about what I used to do with them when I was younger. If he found out I… I hoped that day would never happen…

“But now… I’m Memori Rosemary. I’m an orphan with unknown parents and work in aged-care as a caretaker. As far as the rest of the world knows, I’m just an ordinary citizen of Empire City, married to a botanist/pharmacist and a parent of a single, beautiful daughter. I actually hoped you wouldn’t develop chaos powers like me. I hope to never be under the radar of the Children of Faust, and I especially hope you never do either. Those people are cruel and relentless. Those letters told me what they did. They soured Sonic’s name as a hero. They are the reason Shadow became MIA. They are the reason I’ve been separated from my brother! And they attempted to kill the doctor who saved my life! And the worst part is that they are still here, with nefarious intents of unknown reason. I don’t know what they are up to, and while I want to find out and at the very least find your Uncle Venice, doing so might put you and your father in great danger….

“Freesia, I need you to promise me a few things, for your sake and mine.”

Memori looked her in the eyes, tearing up slightly. Whatever she had to promise, she had to uphold.

“Freesia… Promise me that you’ll never let anything I told you today leave this room ever! You need to promise me to keep your powers a secret! You need to promise me that you’ll never investigate those diaries further. It will only lead you to a difficult and possibly short life! Freesia… Look me in the eyes and promise me that you’ll live a normal life. Solemnly swear that you’ll never try to look into those diaries further and end up on their radar. What happened in the past is tragic, but there’s nothing we can do about it now! Promise me, Freesia… That you’ll just be a normal little hedgehog for me?”

Freesia didn’t want to agree to that, but she didn’t feel like she had a choice.

It was a long time of silence as Memori held Freesia’s wrist tightly and wouldn’t let go until Freesia made that promise. While it hurt, her mother somehow looked even more pained.

“I promise, mom.” She nodded, reluctantly agreeing to it.

At first, she upheld her promise. She gave in to living the mundane and everyday life of most mobians making a living like anyone else in the world.

However, some nights, she found herself having strange reoccurring dreams of the doctor calling out to her. He was pleading for help. In these dreams, Freesia was looking at the diaries and they spoke to her. They led her on a dangerous mission that made her feel more alive than anything her waking hours could ever offer her. It didn’t matter how each dream started, but they always ended up with her wandering alone down a dark corridor as the voice kept calling her and pleading louder and louder. She would wake up in the middle of the night in a cold sweat when that happened. She had to hold herself back with all the willpower she had to not sneak into the attic and look at the diaries again.

She wanted to heed her mother’s warnings. She wanted to return to ignorance back to when she didn’t know about the doctor or that she had weak chaos powers or that her own mother is one of the core players in such a convoluted and tangled story!

The desire to live her dreams began to consume her waking hours. She couldn’t understand what was compelling her, but it was there. She only made it a few months before she broke that promise. It was a week after her thirteenth birthday.

She snuck into the attic in the middle of the night, and looked at the diaries once again. It wasn’t for very long as she knew she couldn’t afford her mother finding out. But she thought, perhaps she could break the promise, but it would be inconsequential if nobody ever found out. If nobody saw her research or her powers… Maybe she could get away with it…?

She kept practicing her powers in secret. She kept reading the diaries to understand what happened to the doctor who saved her mother.

One day, without warning, her mother’s fears came alive. It was the afternoon after school one day in mid-autumn. She was in the attic studying in secret when she heard knocking from the door.

“FREESIA!” Her mother screamed as she heard thuds and bangs of something heavy hitting the walls and floors. “GET OUT OF HERE! RUN AND DON’T LOOK BACK! I won’t let you take my daughter! You monsters already took the rest of my family away from me! I won’t give up without a fight!”

Freesia froze in terror as her mother’s voice changed. She normally sounded rather deep, but her voice turned monstrous as she bellowed towards her attackers. Before she moved to action, she shuddered uncontrollably from her blood to her bones.

“I’ll show you the absolute power the last of the Black Arms has to offer!”

The young teen hedgehog didn’t argue or hesitate after the momentary shakes cleared. She grabbed her bag, the old diary chest, and replica emeralds, and warped to the roof of the house with the intention of running away like she was told.

Except that she didn’t run.

She heard her mother scream and she froze.

She saw the Children of Faust dragging her mother to the front yard and try to throw her into the back of a van. Memori struggled, and even managed to perform a Chaos Blast and knock them away, but they overwhelmed her. It didn’t matter how many she took down, more kept attacking in their place. Ivory wispons were used. She threw Chaos Spears towards the wielders to prevent them from firing. Memori’s spears were much smaller than what Shadow was recorded to use. They looked more like throwing knives. They were effective enough at keeping the Children away from her.

However, she could only fight for so long before she was inevitably zapped with an ivory wispon. She managed to pull through and keep fighting after the first zap, but many more followed. When she fell to the ground with smoke emanating from her body, she was quickly grabbed, restrained and a power-inhibiting choker was placed around her neck! After that, she was gone. Thrown into the van like a sack of laundry and driven off.

The Children of Faust came after her and they took her mother! She wanted to charge into the fight and save her, but she knew that she wouldn’t have a chance. She ran down the street in disbelief, hoping she would escape and scold her for breaking her promise. She hoped that things could go back to normal like it should have been.

“MOM!” She called out. “FIGHT THEM, MOM!”

She kept running, hoping to see the doors of the van break open and seeing the indigo hedgehog charging out towards her. She no longer cared if she was going to be severely punished. She just wanted to see her mother ok.

“MOM!” She called out again as the van started to fade further and further from view. “I’M SORRY, MOM!”

She bumped into various humans and mobians in the streets as she kept running, tears down her face.

“MOM!” She screamed one more time. “I’m Sorry!”

She kept chasing the street further and further down, the van long faded from her view, but she kept running. She kept running until her lungs felt like they were on fire and her legs couldn’t keep up. She kept running until time no longer mattered and her mouth felt drier than desert sand. She kept running until her body finally gave up and she collapsed to the ground, breaking down into a fit of dry tears surrounded by fallen autumn leaves from the trees planted along the streets.

“I’m so sorry, mom…” She mumbled, lying on the ground. “I broke your promise…”

As she lay down on the pavement, catching her breath, the adrenaline faded and the reality began to set in of what happened. She knew her father was already home from the university and likely calling the police to report that the house was broken into and that his daughter and wife were missing. She knew that he would never find them again. His wife wasn’t coming home that night, and neither was his daughter. They were never coming home. In one night, he was never to know what happened to make his family disappear. He was just an ordinary hedgehog who lost his family from circumstances beyond his control. And it was all her fault.

As it turned to nightfall, the streetlights began to shine and houses began to light up from the inside. Freesia was in the shadows, away from such light, and even if she was underneath it, nobody would have seen her. It was the first time she turned invisible and learned she even had that power. It was ultimately what stopped the Children from stopping the van and grabbing her too. They didn’t see her.

She didn’t know why or how she had such power, but she wished it could have gone further than just making her unseeable. That night, she wished she was never born at all.

Chilling winds cut through her dress and nibbled her ears as the first stars began to twinkle in the sky. It was the darkest point in her life. It was when she lost all her normalcy in life. She knew that the Children of Faust were going to target her next and she was never going to live a peaceful and mundane life again. All her friends would never see her again. She could never make any new friends without endangering them. The adventure she dreamt of became her new waking nightmare she could never turn back from.

However, before she completely gave into despair, she felt something else bubble inside her as she tried to stand back up. She felt furious at the Children of Faust. They took everything away from her. If they were coming after her next, she wanted to give them a good reason. She still had the diaries, and she was going to unlock all their secrets!

She remembered the hero of time, Silver the Hedgehog and the stories her mother would tell her about him. His heroism and unwavering optimism inspired her to get back up and refuse to give up despite everything that happened that day. When things looked dire, she would think of her hero and feel resolve continue burning within her. He sacrificed a lot to save the world time and time again. If he can do that, she can solve this mystery and find her mother again!

She changed her name to ‘Freesia Robotnik’, because she was already targeted by the Children anyway, and so they wouldn’t link her back to her father. She wanted to keep him out of what happened and why. He was just an ordinary green hedgehog with rose-coloured eyes and basic slicked back quills not unlike Sonic the Hedgehog. He had no powers, and she knew he could be used as leverage against her.

‘That was 9 years ago…’

She spent the next few years travelling the world, investigating the diaries and gathering any lost research she could find. She did odd jobs to keep herself afloat and learned how to evade the Children each day. It wasn’t an easy or peaceful life.

She also became obsessed with history, trying to learn more about the secrets her mother had. The mention of the Black Arms race haunted her. She needed to know where her mother was from, and understand many of the secrets she kept. There were too many questions that she needed to know the answer to if it meant getting a peaceful night’s rest.

It was a lonely life. She made friends, she left friends. She lived in the woods. She lived in the streets. She lived in an apartment. She lived in a small house. Since that fateful day, she was seeking and running. Never staying in one place, and never considering anywhere truly home.

She was always evading the cult and always running from them every time they located her. She had been running for so long, it was like she was running her whole life.

‘I’ve been running for nine years…’ She thought to herself, ignoring the pain in her shoulders from carrying Silver. ‘How much longer can I keep running?

And she was running away once again in the present moment. She was trying to get to the Forest to get to safety, but they were still on her tail. She heard the Children were getting closer, and she heard the clicking of their Wispons getting ready to fire.

She kept trying to fun as fast as she could, but speed wasn’t her strong suit. It also didn’t help that Silver was too tired to run with them and was weighing her down. She didn’t want to slow down, but her body wouldn’t let her go any faster.

Then she felt a sudden weight lift off her shoulders. It was Shadow. He picked Silver up and carried him under one of his thicker and stronger arms.

“You looked like you needed a hand…” He commented. “Fortunately for you I seem to have four of them.”

Freesia smiled as her body ran further ahead, no longer hindered by the weight.

“Thank you, Doctor.” She nodded gratefully.

She darted between buildings and alleyways in the New City area and darted towards the tunnel into the Forest area. The light of a full moon illuminated the area in an almost romantic fashion that would be perfect for a couple to have a dinner date to by the seaside. The moonlight also made it easier to navigate the darker alleyways and lesser lit places as they tried to escape the clutches of the organisation on their tail.

As she crossed over into the forest area, she ran down towards the dark tunnel that separated the different zones of Soleanna. She thought a little bit about her situation, and felt as though the notion of running in the dark was an almost perfect summary of her life since the day the Children took her mother away. She found herself chuckling a little as the realisation that she was running in the dark with a Shadow trailing behind her and with a Silver-lining in hand. Even though she was barely in the woods literally nor out of the woods metaphorically, at least she wasn’t facing the danger alone. She had two powerful hedgehogs with her, one even being the very scientist that likely sacrificed himself to save her mother and the other being her childhood hero.

As she began to reach the other side of the dark tunnel, she saw the faint moonlight at the end, shining in the Forest and she felt hopeful and assured that everything was going to be ok.

However, exhaustion started to get the best of her. Even with the weight of Silver off her shoulders, she felt herself slowing down again as she heard the fervent footsteps of the Children of Faust. Once again, her almost comically average body started to fail her when she needed it most.

She felt her running change to a burning jog as her legs could barely carry her much further. She soon tripped on a stray root from one of the giant trees and fell forward. As she braced for the impact of dirt, she felt a long, tree branch-like hand catch her. It was Shadow, carrying her as well in one of his longer and thinner arms.

“Tell me where to go and I’ll take us there.” He proclaimed as he rushed at speeds faster than she could ever manage.

“We just need to reach the mirror across the lake.” Freesia explained, directing him on where to turn.

As they reached the lake side among some of the largest trees, Freesia directed Shadow how to hop across the rocks and reached the Mirror of Soleanna that led to the maze-like Tropical Jungle. They were greeted to the sound of wind rustling the trees to a faint pleasant whisper in the night as she was carried by a moonlit Shadow.

From there, she directed him where to go to avoid most hazards of the region, what vines to grab, and what roads to run down. They weaved across all sorts of obstacles

Eventually, they stopped at a tiny clearing by a lakeside in front of a large tree that would be blanketed with beautiful white flowers at the right time of year.

Under the light of the full moon, the tiny clearing looked picturesque. A hidden gem for a romantic night for a couple, away from the riff-raff of civilisation and just enjoy a peaceful moment.

It was quiet. She breathed a sigh of relief of knowing they finally got away.

“They shouldn’t reach us here.” Freesia proclaimed as Shadow let her down. “It’s too far into the forest for anyone to comb through. I found this little place sometime last year when I went exploring a few times. This entire route was my evacuation plan when things went awry.”

“You were out of breath just after the half-way mark.” Shadow pointed out.

“I was carrying Silver most of the way.” She defended herself a little. “But… Thanks for your help. I really needed it.”

She grabbed her suitcase and placed it gently on a small flat patch of ground. She also picked Silver back up from Shadow and placed him down gently on a soft patch of grass.

“What happens now?” Shadow asked. “We have come this far, but what can we do next?”

“Well…” Freesia tried to answer. “I don’t know what comes next. The only thing we can keep going forward with… is looking deeper into the past. We need to look into your past and find out what caused you to end up like that, and find out how to make things right again. The Children of Faust are powerful in their numbers and relentlessness, but if we can get you back to your prime self again, it doesn’t matter how many of them there are. But where to start? Fortunately, I have a few theories as to what happened to you and Silver, it’s not much, but it’s a lead all in all. If there’s anything that my life has taught me, you can go pretty far with only a little advantage, it’s all in how you use it. Even if things seem bad now… I have hope we can forge a brighter tomorrow.”

Chapter Text

Chapter 16 - Seeds of Doubt

Freesia took a few moments to catch her breath. They made it to the safe zone. Even though things were still bad, the immediate danger was over for the moment. Her body still feeling uncomfortably warm after that much running. She carefully laid the luggage down on the damp soil.

She opened up her suitcase and carefully looked through its contents. She sorted clothes in one pile, and books in another. The chest that had the old diaries in them tipped over in the hasty unpacking and the strange bracelet rolled across the dirt, gleaming slightly in the moonlight. Her only lead in figuring things out was somewhere in one of her books that she hastily grabbed and packed.

Silver, having recovered a little from the exertion before, began to sit upright.

“Ok… where is it?” She mumbled. “I thought I had-! Dang it! I left my flashlight at home! I can’t go back now. I’ll just have to figure something out. Wait here! I’ve got this!”

She quickly ran off leaving her satchel behind, hastily gathering a few twigs and other wood she could find. Also finding a few rocks by the lakeside and quickly made a small fireplace. Rubbing both her hands together and focusing carefully, she sparked a small fire with a jolt of chaos energy.

She also managed to find a few large branches that she brought to the small clearing to act as a seat.

Though they lacked a sleeping bag or anything resembling a tent, it was otherwise an effective camp.

“I think we’ll be ok with this.” She explained, pointing towards the fire. “The Children almost never seem to have any air coverage. So we should be fine with a little extra light… At least for now… Their leader... is something else. I heard through an informant of mine that their ‘God’ grants them insight into what to do and when to do it to further their goals. It’s honestly terrifying… the idea of a group out to get you that manages to know your next move, or forces you to take certain drastic actions because they exhaust all your other options… But that doesn’t mean they’ll always win. After all, we managed to get away this time. They wanted me captured or otherwise for 8 years and I managed to get away. They wanted Mr. Shadow to be trapped on the ARK for the rest of time… and we got him out! Though I guess what that can mean now is… This fire should be fine, but we can’t let it burn all night. We should also probably try to keep quiet after we reassess the situation. They may still find us here, but it may be a long time before they catch up. Let’s not make their job easier.”

She pulled out the book she was looking for from the pile, with a little more light to help her see what she what she needed to find. It was the book titled ‘Sonic, The Shattered World and the Gaia Manuscripts’. With the light of the small fire, she was able to read the pages without straining her eyes too heavily.

“Alright, I should probably get to the point, shouldn’t I? I think I have a lead on what’s caused you two to turn into monsters. I mean, I already had a bit of a hunch before.” She explained, flicking through pages until she got to where she believed she had the answers. “I just couldn’t get around to double-checking until now. And… HERE!”

She stopped at a chapter labelled ‘Dark Gaia’s Influence’.

“Here… I remembering reading about this when I was younger.” She continued. “In between studying chaos energy, I also used to study the Gaia Manuscripts and the Shattered World Crisis 200 years ago. Just as a topic of interest. There was one study about the incident that I remember, and that was the impacts of Dark Gaia’s essence on living beings. When the world was shattered long ago, it was artificially induced by Eggman to awaken the destroyer, Dark Gaia. Because it was awakened prematurely, it could not sustain its own weight upon release, and its essence scattered around the world, manifesting as various creatures such as Nightmares, and Titans, and so on. However, some of that essence ‘infected’ people and animals, and even plants.

“When introduced to a living being, Dark Gaia’s power had been reported to have highly mutagenic properties. It also influences thoughts and personalities to a point of being a polar opposite of their normal selves. There were reports of people under Dark Gaia’s possession feeling intense loneliness, hopelessness, losing sense of self, unprovoked aggression, heightened impulsivity, increased paranoia, crippling anxiety and so on… And that’s from people who showed little to no sign of mutation.”

She looked towards her allies, feeling sorry for their situation and how she was essentially reminding them of the situation. She took in a breath, knowing she couldn’t just leave the explanation half-done, and continued.

“However… Plants were also reported to mutate and attack civilians during the crisis. But this effect didn’t just extend to plants. It could affect guardians such as the Great Pheonix of Chun-Nan, and turn them berserk. It could affect fish and other fauna. However, one of the most well documented examples of mutation specifically is from Sonic himself.”

Shadow and Silver turned to face each other, and then back to Freesia. Silver didn’t know about the event, since it never seemed to impact his future in the slightest. Shadow barely remembered anything like what she described, but something about the ‘Shattered World Crisis’ gave him a sense of familiarity, he knew he must have been alive during that time but not much else came to mind.

Freesia opened the book to a certain page, where it showed Sonic in his beastly form in a high quality sketch. Silver couldn’t see the book. He remembered he could only see living beings and certain energy with his strange sight.

Silver realised he never got the chance to get a good look at himself. It was strange that he could see living beings with his eyes closed, as well as the fact that he struggled to even open his eyes at all. It was like he was half-asleep yet conscious enough of the world around him. It was as if his form kept him feeling like he was stuck in a vivid and lucid dream where he didn’t have any control over what happened, only control over his own actions. It was certainly bizarre.

He needed to know what he looked like. He knew he transformed into a monster, but he needed to see for himself what happened to him. He didn’t want to end up as hideous as Shadow did, but he was also scared by what he might see.

“Umm…” Silver tried to ask. He noticed his voice had changed significantly. It was no longer his usual voice that occasionally cracked since he turned 13. It had a strange reverb to it that sounded unnatural, like a non-mobian cat suddenly learned how to speak beyond meowing. It made him hesitate more, but he needed to explain it.

“I… I can’t see…” He blurted out, unsure of how to fully word what he was experiencing. “Well… That’s not quite true. I can see you just fine. But I can’t see the books or much else. I don’t understand it either… It’s like you’re here, and Shadow is here and everything else is just a void.”

“What?” Freesia asked, the implications steadily dawning on her. “I… umm… I guess that makes sense with your eyes looking fused shut. But… Umm… I thought that… I thought that other eye on you was taking care of that…”

“My what?!” Silver exclaimed. A sudden chill rippled across his fur and made it stand on end. “Are… Are you telling me there’s… There’s a third eye on me…?”

Freesia nodded at first, then remembered what Silver just said and realised she should probably play it safe and talk rather than express.

“…uh-huh… Silver… You have a third eye on your forehead…” She tried to explain as softly and calmly as possible. “Uhh… Are you able to see with it or…? I mean if you didn’t know… umm… I… I’m sorry…”

Silver reached up towards his forehead. Sure enough, he felt that sensitive lump. It gave a dull ache as he touched it.

“This thing up here… Is this it?” He asked, hesitantly.

“Yeah…” Freesia answered, desperately trying to break the awkward tension in the air. “It’s ok! I’m sorry for making assumptions. I’ll just describe then. Thank you for telling me! I’ll do everything I can to fix this!”

Curiosity was getting to him. He needed to know, if he had a third eye with his other eyes fused shut, what else happened to him?

“What… What do I look like?” He asked, scared by what the answer could be.

Freesia gave a small gasp, lost for words as to how she should answer the question.

“It’s not as bad as it sounds.” She replied. “For one, you’ve certainly gotten a lot fluffier, which isn’t too bad. Your tail has gotten a bit longer. Honestly the weirdest part is that extra eye. Otherwise, you still look like you. At least, I know it’s still you, and that’s all I care about right now.”

“Is that all?” Silver asked, wanting to cling to her reassurance. “Just some extra fluff and an extra eye on my forehead?”

There was a slight hesitation in her reply.

“… Yes… There’s nothing much else to it.” She tried to assure him. “I can’t be seen in public either right now with a search party after me so we only have to worry about each other right now. Silver, I know it’s still you regardless. Even if you were unrecognizable, I know it’s still you.”

She came over and gave him a gentle hug, followed by a stroke of her hand over his quills. Her arms felt a little stiff as they wrapped around him, and her hand was trembling slightly as she delicately patted him.

“Don’t worry about it.” She answered, her voice quivering a little.

Silver didn’t feel satisfied with that answer. His body felt too alien to him for the only thing that changed being some extra fur and a not-so-enlightening third eye. There was something about Freesia’s tone of voice that sounded off. The gentle and almost motherly tone she usually carried in her voice sounded forced, like she was swallowing her fear.

Silver may not be the smartest hedgehog in the world, but he was often regarded as perceptive of others from time to time.

It wasn’t a satisfactory answer and he wanted the truth, no matter how bitter it was.

He tried to think of various ways he could figure out the true scope of his appearance. He tried to brainstorm ideas, from trying to guess based on feel, to trying to force his eyes open again. None of such ideas would truly give him much of an idea.

He also considered asking Shadow what he looked like, as a second opinion. However, he didn’t feel comfortable doing that. The Shadow he had known since that morning was different than before. He had been trapped on the ARK as a mindless monster for over 180 years. If their situations really were related, that meant Shadow was the direct cause of Silver’s transformation. The last thing he probably needed was an indirect reminder of that.

However, that wasn’t the only reason he felt hesitant in pressing for more answers. Even if this Shadow was a hollow shell of who he used to be back in Sonic’s time, it was still Shadow. Silver will never admit it directly, but he strongly looked up to Shadow and was inspired by his power and ability to power through even the most intense situations. The Ultimate Lifeform was his role model of being a strong hero, a little more so that Sonic. Whether he was aware of it or not, Silver always tried to act tough around Shadow and would try to emulate his behaviour whenever they interacted. It was a strange, almost unconscious desire to have his approval or praise. If he showed apprehension or insecurity over his appearance and what happened, it could mean showing weakness in an already tense situation.

He decided to keep silent, and just accept Freesia’s answer since such information wouldn’t change his situation by much at all. He decided to leave it be for now. Priority was immediate safety rather and trying to understand the situation more than anything else.

That was until a dark idea started to embed its idea in his mind. It started quiet, but eventually it started getting louder. It didn’t have a voice. It was just words, but it was as if there was volume to them like there was someone talking to him directly in his thoughts.

If Freesia is keeping this from you… What else is she hiding…?

Silver felt a few pangs of anxiety hit his heart slightly when those words manifested in his mind. Of course, he tried to argue some common sense.

‘Things are tense right now. If she isn’t running away screaming, it can’t be that bad, right?’ He reasoned.

Unfortunately, the small voice in his mind wouldn’t be satisfied so easily.

She is the reason you’re in this mess…

Can you really say for sure she can be trusted…?

‘She stuck by me through a lot in the past couple days.’ Silver reasoned. ‘Even risking her safety for me. If I can’t trust her… who can I trust?’

She told you that you would be targeted by the Children when you were already being targeted. She always acted sweet and innocent towards you while carrying a criminal record. She even forced you to sleep in her bed. Would any normal and trustworthy person do that?

‘Her bed was comfortable, and it she didn’t lock the room or tie me to it, there was only one bed that she voluntarily gave up. She made me breakfast and dinners, and even gave me a few rings to finally have a moment of fun in this future that should have existed long ago… Umm… A future that should have always existed! Wait, why am I correcting myself? These are my thoughts…’

Mere bribery… If you knew that a dangerous organisation would be after you and you would be turned into a hideous monster over the course of this adventure when you encountered that green hedgehog… would you still have agreed to help her?

‘This isn’t the end yet! And it wasn’t just me helping her. I had nowhere to stay and confusing flashbacks and memories she has been helping me out with.’

When was the last time she helped you with your problems? You’ve been doing most of the heavy lifting for her mistakes…

‘Why am I arguing with myself! Freesia is not a villain! And knowing what I look like won’t change that or make anything better right now!’

Don’t you understand? Can’t you listen to reason for once? What would she have to gain by lying to you? She’s always had something to hide, and you are choosing to ignore it because you don’t want to be alone. Stop thinking like a child! She’s hiding stuff from you and she’s the reason you are in this mess to begin with. You decided to trust her and now a dangerous organisation is after you, you aren’t any closer to figuring out the other timeline you seem to be remembering, and now you’re a monster. Aren’t you the least bit curious about what she is hiding? How much longer are you going to tolerate this?

‘What if you’re wrong?’ Silver argued back internally. ‘If I try to pry further, then what? If I pressure her for answers further… If I read her mind… If I scare her… I might lose a friend and I can’t afford to lose that. Things might get worse from trusting her, but things might be even worse than that if I distrust her now.’

Ahh… You just admit you think things could get worse from trusting her. You just admitted the real reason why you even decided to follow along with her little scheme. You didn’t want to be alone. That’s a poor excuse to put yourself in danger, is it not? But back to the original point at hand, her response to your innocent questions about how you look felt… off… to say the least. You don’t trust her, do you?

Silver had no thoughts to comment on such ideas intruding his mind. He was feeling his heartrate steadily increasing as it felt like his own brain was interrogating him. He didn’t know what to do anymore.

… You can know without needing to ask and assume you can believe the answer… You’re able to read minds now with your new powers. Why don’t you test her and see what you find…See how she truly sees you… with her own eyes…

The voice went silent after that. All that was left was doubts, anxiety, and the pressure to make a risky decision.

He looked towards Freesia. She answered him as if she were hiding something, and he had a power that would allow him to directly see if she was telling the truth or not. The problem of using it is if he used it on her and she noticed, he couldn’t take it back. It would be like getting caught reading her diary, except even more personal.

He thought carefully about it. Freesia had shown no signs of ill intentions in the past. She hasn’t lied to him so far. But he did remember that she would act a little odd towards him. The voice made a good point. She only told him of the danger he was in when he could no longer back out. She insisted on taking Shadow back to Earth shortly after he attacked them. She would sing him all kinds of praises before asking him to help her, and after he had helped. She was certainly odd and suspicious, even before they introduced themselves.

‘What is she hiding…?’ He wondered. If the voice didn’t bring up those quirks, he probably wouldn’t have noticed. But after they were pointed out, he couldn’t ignore them. ‘Was she just using me to fight her battles for her? Did she make up her backstory? Is this all a lie?’

He realised as those thoughts kept popping up, the voice was right. He didn’t trust her. At the same time, she was still his friend.

He felt conflicted about it. He didn’t trust her, but he wanted to trust her and didn’t want to ruin the friendship they built up with something so invasive. He didn’t want to read her mind

So… He thought of a compromise.

If he could just get a good look at himself from her eyes and nothing more, that would be all the proof he needed to know whether he can trust her. If it was how she described, he can put his mind to ease and be reassured she could be trusted and the voice of his concerns can be put to rest. If not, then he could dig deeper and see if there was more to the green hedgehog than he realised.

He couldn’t allow himself to get caught if he were to attempt it. His anxiety only began to grow the more he considered the action. Shadow and Freesia didn’t know he could read minds yet. It was bad enough he couldn’t see right. If they knew he could read their thoughts or feel their emotions, he didn’t know how they would react. He remembered the social sting when people learned he had psychic abilities. They would think he was a mind reader and avoid him. It always took a lot of explaining to clear things up again.

But this time, he really was a mind reader, and he had to tread carefully. He couldn’t afford to get caught regardless of what he might find.

He tried to reach out towards her mind. He didn’t want to be too invasive. He just needed to get a good look at himself. He didn’t want to look any deeper into her psyche.

“…An accident happened when Eggman successfully awakened Dark Gaia. Sonic ended up getting infected with a large amount that transformed him every night into what was often dubbed by many as the ‘Werehog’ due to his appearance turning much more beastly, as silly as that name sounds. I’ll describe how he looked, Silver… Compared to that I don’t think you look so bad by comparison… Now, things to note about how he looked as the werehog is that his fur grew to something more of a pelt, his teeth were razor sharp and he even howled like a wild beast…”

As Freesia tried to continue, describing the effects of Dark Gaia energy on mutation and why she hypothesised Dark Gaia was the reason they changed, Silver managed from a psychic link with her. At first, he could feel her unease, and he reciprocated.

He knew he was doing something wrong, but he needed to put his mind at ease.

‘Keep your voice calm. The situation is bad, but you can’t afford to panic. He might pick up on any unease in your voice, so keep calm. Remember, this is the same Silver you knew from before. Appearance doesn’t matter…’ He heard her internal monologue, and felt his cheeks redden a little as he realised he was looking into her thoughts. But he couldn’t stop there. He tried to go straight to her vision.

“… Now, if it’s any reassurance, according to interviews with Sonic about the condition he developed during the Shattered World Crisis, Sonic still managed to retain his original personality and self-control, unlike most people who ended up possessed. So it can be assumed that with a good heart and strong will, it’s possible to still be yourself even mutated.”

“If Dark Gaia had been sealed away 200 years ago, how would I have ended up like… this…?” Shadow asked.

‘That is a good point. While this looks like Textbook Dark Gaia influence (from what evidence and information I can gather anyway), how could a fragment still be around long after the sealing was complete. All I read about the Shattered World Crisis is that Dark Gaia entered Perfect state and a combination of Super Sonic and Light Gaia managed to team up and seal it back away again… Did I read anything about stray Gaia energy wandering around…?’ Silver could overhear her internal monologue as he found himself caught up in a stream of consciousness. As he tried to navigate his way through the psychic link, he found his own consciousness uncontrollably drift along, away from where he intended.

He was able to see the visual thought process as Freesia scrambled through her memories for relevant information. He was taken to a café in Soleanna and tasting a serving of leftover ground coffee with ice cream. From Freesia’s memories, they were delicious, though Silver knew he wouldn’t like to eat such a thing with his own body.

This was mom’s favourite… Dad was never able to make coffee ground compost when she was around… But I can’t dwell over what happened with mom. I may be the reason she got captured, but I am also the only one who can save her. I’ll make things right again. I have to. But for now, I need a break. That’s why I’m here and that’s why I’m studying up on something irrelevant. Memory Freesia thought to herself as she browsed the reading material on the elegant mosaic table by the waterside. I earned these rings fair and square. I can afford to splurge on a coffee and a couple hours of reading in the beautiful sun, right? Ugh… I can’t afford to do this too often though. That’s why I need to just relax and enjoy the moment. Besides, studying stuff that isn’t mandatory is always fun…

‘I wonder how my life would have gone if things turned out differently…’ Freesia contemplated in the recollection. ‘I wonder how Django is doing… I wonder if he still thinks of me from time to time… I hope he’s alright and happy…’

Silver saw Freesia recall a Mobian Rabbit with a kine not unlike her own. Something was different about that memory however. He could sense the matcha hedgehog felt a deep admiration of the rabbit, perhaps something even more than that. He knew her memories of that rabbit were very personal. He really didn’t want to know any of that information he was exposed to. He wanted to stop, but he had to keep going.

The scenery changed back to the café at Soleanna again. She was looking through a few books about the Dark Gaia. Not the books she was currently holding, it was borrowed from a library. She found a chapter labelled ‘Stray Manifestations’…

‘Aha!’ Freesia mentally exclaimed as she recalled the relevant information that would answer his question.

“I remember reading about stray manifestations of Dark Gaia energy that occasionally wander around the world from time to time. They’re dangerous as they want to be part of Dark Gaia again, but are easy to seal away. The actual tricky part is gathering them all together.” Freesia explained confidently. “An interesting piece of information I hope I’m recalling correctly here is that there was once an incident after the Shattered World Crisis where a small pocket of Dark Gaia Spawn, the smaller manifestations of Dark Gaia energy, were attacking near Spagonia. Fortunately, Sonic and Miles Prower with the help of Amy Rose acting as a vessel to lure them all together, managed to seal the essence away without much incident. However, an interesting thing happened. Despite Sonic being ‘cured’ of the werehog at the time, this incident temporarily turned him back into a werehog again each night. This was resolved when the stray manifestations were sealed off again. However, I don’t recall reading about anyone else being ‘Infected’ only ‘Possessed’ by Dark Gaia. So ultimately, this situation is still very hard to get a full grasp of what is going on. Personally, I think someone intentionally infused your body with enough Dark Gaia energy to turn anyone else into a kaiju. However… There’s still the how and why of it all…I have a few ideas but…”

‘I just need to see if I can look through her eyes! I really don’t want to dig much deeper yet!’ Silver cursed himself internally. ‘It has to be possible. If I can just…’

He tried manoeuvring the psychic link he created. However, instead of just trying to get to her vision, he ended up stumbling deeper into her psyche. It was like he was slowly sinking into the pool of consciousness, not quite at the bottom, but almost drowning with all kinds of snapshots of a life that wasn’t his. It was like a current or stream, except it wasn’t water and he couldn’t swim through it. The more he tried to resist, the deeper he found himself.

‘Maybe I should cut both this connection and my loss…’ Silver thought to himself, hoping his own thoughts aren’t detected by her.

He ended up being smothered by memories. He found freshly recalled memories she looked back on a few moments ago. It was her childhood, including memories of her mother.

He saw Memori for the first time, and he recognised her from the photo that was on Freesia’s bulletin board back at her house. The indigo hedgehog. He felt something familiar about her that he couldn’t quite recognise. He knew he never saw her before, and yet he felt a strange connection to her that he also felt with Freesia and to some extent Shadow. One thing he noticed was that Memori had the same golden eyes he had. It reminded him of Blaze somewhat.

He found himself looking at the memories of Memori a little longer than he would have intended. She looked mysterious, and dangerous. Yet, Freesia’s memories of her showcased her in a kind, and loving, perhaps even smothering light. He could understand why Freesia wanted to keep her family safe.

But nonetheless, they weren’t his memories or his family to be prying into. He tried to push his way out of the memories. They weren’t his to pry in the first place. He didn’t want to look deeper. He just wanted to see through her eyes.

“Freesia! GET OUT OF HERE! RUN WHILE YOU STILL CAN!” A voice called out. Before he knew it, he stumbled into the memories of Freesia’s broken promise to Memoria…

He saw the promise she made with Memori. He saw her break that promise. He saw Memori paying the price for it.

He was stunned. He accidentally found Freesia’s darkest secret. He didn’t intend to. But now that he had, he didn’t know how to look at her anymore. Her curiosity got her mother captured, endangered her life and his own, and now they were all in a bad situation.

He felt resentment and anger bubble up inside himself as he thought about it more. He almost forgot what he was doing as he began to sink deeper into the consciousness pool.

He quickly remembered his original mission. He tried to move back upwards. It was almost like the moment he broke what he could only interpret as the surface of the stream of consciousness, he finally achieved his goal. It wasn’t like swimming so much as mastering lucid dreaming for a moment and taking control of his actions in the psychic link. It felt like a dream-like trance as he finally managed to see in 3^rd person.

He managed to see Shadow just fine. She saw the books Freesia was looking at. However, when she looked towards Silver as she spoke, he finally saw it. He was hideous!

“Ahh!” He exclaimed as he almost tripped backwards over himself.

He jumped back as he didn’t see his own face, he saw something else much more frightening. His fur was much darker than before. It turned from a silver-grey or off-white to a dark grey, like a storm cloud just before a heavy downpour of rain. The five quills on the top of his head slicked back and drooped heavily like they were drenched. His teeth were sharp and pointed, but perfectly aligned; like his teeth were a block of white and his upper and lower jaw were separated with a single zig-zag.

Then he saw what happened to his right hand.

He didn’t see a hand, he saw a monstrous jaw in its place. As he tried to move the ‘mouth’ on his hand, he opened it and closed it. With a single row of pointed teeth, no eyes, and no visible throat, all he could do with it was bite. The gold cuff that was around his wrist looked more bronze and the once-cyan highlights were now a dark purple almost pulsing with a sinister power.

He looked at his other hand. It was still gloved, but the cyan highlights were a lilac purple. The glove was about ready to completely rip by the seams as the fingers already had holes from both strain and the sharp claws poking out. It was amazing that it wasn’t completely torn to shreds yet.

He looked at his boots, and they looked tougher and felt heavier than they were before. He found it strange that as his own body changed, so did his shoes. His boots looked worn, yet thicker. It was like they were made of leather and laced with steel. The treads had a different pattern, they were ripples instead of the hexagon pattern they normally had.

The fur on his body was also thicker, not like a pelt, but much thicker than his usual fur. It didn’t look like a magnificent coat one could expect a non-mobian wolf. It just looked messy like a feral mobian. But that wasn’t the freakiest feature he acquired. Just above his eyes, but just before his quills, was a glowing and sinister-looking green eye. The third eye Freesia was talking about before.

“AAAAAAHHHH!” He screamed as he saw his monstrous new form. The psychic connection he made with Freesia was severed and he was back to that monstrous body.

He was shaking. He looked unrecognisable. Whatever happened to him had turned him into more than just a monster, but a freak of nature that shouldn’t exist!

“Silver!” Freesia exclaimed in response to Silver’s sudden exclamation. “What’s wrong? Are you hurt?”

He didn’t know how to respond. Freesia lied to him He felt a combination of shock, horror, distrust, paranoia, and self-hatred towards his appearance and his judgement of character. It was intense and overwhelming.

“I… I have a monster jaw for a right hand…” He could only utter in his shock and tumbling storm of intense emotions.

“Huh?” She gasped in a bit of surprise. “I’d say it’s more like a clamp but… um…”

“Why?” He asked, turning towards her, but facing the ground. “Why didn’t you tell me? Why are you hiding so much from me?”

Freesia gave a quiet gasp.

“What are you talking about?” She asked, confused and taken aback by the question. “I didn’t want you to freak out. I was trying to spare you from the pain. This… This is a scary time.”

“Why didn’t you tell me the Children of Faust would go after me when I decided to help you?” He asked, pressing further as he felt resentment towards the green hedgehog. His voice hissed a little.

Freesia stepped back unconsciously, taken aback by the sudden interrogation.

“Silver, where is this coming from?” Shadow interjected. “This isn’t the time for a fight! We need to stick together right now!”

“Silver…” She trembled. “I… I wanted to help you… I wanted to protect you… But when I thought of telling you and sending you away for your own safety… I felt something deep down… It was apprehension and uncertainty. I didn’t want you to think I was some criminal. I didn’t want you to think of me in a bad light. You were a role model to me, a personal hero of my childhood. But as I met you and spent time with you over the past couple of days, I couldn’t help but also feel… I …Silver… I… I love you. Not like Amy Rose loved Sonic back in those historical times, or like a hedgehog loves chilli and hot dogs, but like a little brother I had to protect. We may not be related, but you are my family! It’s strange, but I can feel it deep down and I can’t shake it… Silver… I feel a similar connection with my mother, and to some extent with Mr. Shadow too. I don’t know if it is fate, or something more, but I feel something. I needed to know why and... If I let you go... I would never find out … I knew that in the danger, you are powerful. If I had a chance against them, you likely had a bigger chance.”

She tried to sound as calm and motherly as she normally did, but something about that answer infuriated him. After what he saw in her mind, her memories, he didn’t believe it. He didn’t even want to bother reading her mind again to see if she was telling the truth.

“Why didn’t you tell me about Memori?” He asked. "The other time-traveller?"

Freesia took another step back, her hands shaking slightly as she tried to clasp her hands together to steady them.

“Silver, stop it now!” Shadow snapped. “Simmer down or I will personally throw you into the river to cool off!”

“My mother kept a lot of secrets from everyone.” She answered, her motherly tone breaking down and revealing a scared young adult. “She kept a lot of secrets from me. But what she did tell me, I had to promise to never tell anyone else, not even my father. She may not be here, but I wanted to respect her!”

“You mean like when you told her you would be a normal little hedgehog?!” Silver snapped, his voice bitter and vitriolic.

Shadow grabbed him by his quills after that. The grip was very tight. Silver knew Shadow was about to fulfil his previous threat.

“Silver! Last warning!” Shadow snapped at him with a bellowing voice of authority. “Stop it!”

Freesia froze. It looked like her soul was ripped right out of her body as her face became blank and expressionless in pure, unfiltered dread. You could almost pinpoint the split-second her heart tore in half. 

“How…” She could only gasp, mortified and quivering. “How do you know about that…?”

Silver said nothing.

“You… You can't read my mind, right?” Freesia stuttered out, her entire body beginning to shake uncontrollably and she began to hyperventilate. "You're not that kind of psychic, right? You... You'd never do that, right?"

Silver said nothing.

The third eye simply glared at her. 

Freesia's expression changed from blank to horrified. She took another couple steps back as she realised there was no other way he could have known. 

“You... You actually did that…? No... Why…? Why! ... You… You were my hero…”

Tears began to gush down her face as feelings of shock, horror, fear, anger, betrayal, and intense sadness engulfed her like a tsunami.

Silver said nothing. 

The third eye continued to glare. 

“You…” Freesia choked out through a stiff throat as more tears began to regularly drip down her face like a leaking tap. “You... You hate me, don’t you?”

Silver turned to face her.

“You betrayed your mother for sake of curiosity… AND YOU ROPED ME INTO IT!” He screamed at her one final time.

The next thing he knew, water was rapidly making its way down his throat and nose as his body was greeted with a sudden blast of cold.

He struggled as he couldn’t see the water. He didn’t know how far the surface was or how far the current was taking him away from the camp. He just knew he needed to surface somehow or he was going to drown. He kicked as hard as he could, he could feel that his boots became heavy and weighing him down. He paddled as hard as he could manage with his arms and had no idea if he was making any progress.

He looked up and he saw Shadow and Freesia in the distance. He was drifting further away from them as Freesia suddenly ran off from the camp. He couldn’t hear them, but he didn’t need to. However, that also meant he was about to drown as he couldn’t even feel for the riverbed to dredge himself back to the surface.

He felt himself become tangled among tree branches in the current and tried to climb his way back up when he felt a sudden pull out of the river.

The next sight he saw was Shadow’s face, looking absolutely furious with him, his secondary lanky arms wrapped tightly around his body as he began to spit up water.

“Good job!” He snapped sarcastically, seething with every word. “She’s now run away crying because of you!”

“We’re in this mess because of her!” Silver argued, still angry about the whole ordeal.

“And she was also our only lead out of it!” He snapped back, steadily carrying the mind-reader back to camp. “What was your plan? Make her cry? Make her angry? Now she’s run off! If she had malicious intentions this whole time, she would have pounded you into a rice dumpling by now with how you acted! That was a stupid plan that might have cost us our only way out of this mess!”

“You don’t know what she did!” Silver argued. “She broke a promise that caused her mother to be captured!”

“And you were an attempted murderer once! You don’t have the moral high ground here! You have no right to use someone’s past against them!” Shadow snapped back, placing Silver on a log seat by the camp again. “Especially when they are actively working to rectify their mistakes!”

“How do you know that?” Silver yelled, flailing his legs to try and kick, only for his legs to be bound by Shadow’s extra hands and leaving him unable to move whatsoever. “Why are you siding with her? You only met her this morning!”

“Why would she respect another promise to Moria if she broke one before?” He asked, his tone switching to a cold logic. “Her mannerisms imply she spent a lot of her life not just trying to find and help me, but also to undo what happened to her mother!”

Shadow let him go again once again.

“I am going to look for her. You stay here and think about what you did and you better apologise when she gets back, or you won’t like what might happen.”

Shadow ran off on all six into the woods, leaving Silver alone, with nothing but empty space and himself. Besides the occasional spark of animal life in the forest, it was a lonely void. He couldn’t stand back up because he knew he would end up lost or fall into the river again.

He was still dripping and his body was chilling, leaving him grateful that there was the fireplace nearby. However, the fireplace didn’t last too long with nobody to put more firewood on it.

‘Attempted murderer?’ He pondered. ‘I’ve lost my temper before, but I don’t think I’ve come close to killing anyone…’

Suddenly, the space around him collapsed as he was greeted with the clear sunny skies of Soleanna’s Castle Town. He felt murderous rage against his target.

“Your actions will condemn us all!” He cried out, grabbing everything he could to throw towards his target to beat them until they stopped moving and didn’t get back up.

‘I remember… I didn’t know who he was at the time but…’

He remembered he had intent to kill. He threw a lot of debris and even grabbed his target and threw them repeatedly into the walls of the buildings as hard as he could manage.

‘I was going to kill him…’

“For the sake of the future, I will destroy you! IBLIS TRIGGER!” He roared.

‘Iblis! Iblis Trigger! That’s it! I had to save the world from the monster that burned away the world by stopping the one who released him. But…’

He saw the body he was beating up senselessly vividly in his memories. There was no mistaking who his target was. The one he intended to kill, the sacrifice for a safe future.

‘I had to kill Sonic!’

As he recalled fighting Sonic and beating him senseless, he realised what Shadow said was true. He was an attempted murderer. An attempted murderer of one of Earth's greatest heroes no less. Even if in another timeline.

Then it hit him.

‘Shadow also remembers that timeline!’ He realised.

While it was a breakthrough for his own mystery, he had nobody to share the news with. He was still alone. Or at least, he thought he was. He felt like somebody was watching him. He couldn’t see anyone, and he had no way of knowing if it was just paranoia, or if he was a sitting duck for anything that could come against him.

Water began to drip off him and pooled at his feet as Silver’s temper began to ease up again. He realised what he did. Instead of anger and betrayal, he only felt guilt and emptiness for giving into the heat of the moment. He knew he couldn’t undo what he did. He sat there alone, cold, and filled with regret.

Even if he could fight whatever may be out to get him, he knew he would be fighting completely alone this time, without Freesia or Shadow coming to his aid.

Even if he apologised if she came back, Freesia may not be so warm or cordial with him again. Even if she forgave him, she likely wouldn’t forget.

Even if he could change the timeline, he couldn’t change his own past as he knew it. He would still have those memories of what he did and the consequences.

He chose not to trust her, and things got worse just as he feared. 

All alone, he felt lost and uncertain about what the future could hold for him and he begun to wonder whether he had also become a monster on the inside. 

All he knew was that he didn't know, and that terrified him so much more than the monster he saw through her eyes. 

Chapter Text

Chapter 17 - The Longest Night Part I

Freesia continued running away from the camp, terrified, spirit crushed, and struggling to keep anything resembling composure.

She didn't know how to react to everything that happened, nor did she know what she was doing. She left her bag and her kine back at the camp. She didn't know where she was running to or why she was running at all. All she knew was, like a lot of her life, she was just running.

Tears were streaming down her face without end. She just wanted the ground to open up and swallow her whole.

But there was some part of her mind that was still capable of logic and reasoning. She knew she couldn't just ditch Shadow and Silver, no matter what happened. Their situation was still her fault and she had to make things right, no matter how hard it was.

However, she also couldn't look at Silver the same way again. The hero she looked up to her childhood and a large chunk of her life, betrayed her trust. The things he said to her still echoed in her mind on loop.

It wasn’t just because it was Silver specifically who said those things that it cut so deep.

The problem was... She agreed with him.

She did break her promise to her mother.

She is the reason Silver has become a monster.

She has done a lot of bad things without meaning to hurt anyone.

She decided to stop running for a moment…

And rested her back against one of the trees, and sunk to the ground, burying her head into her knees.

‘I'm a disgrace to hedgehog kind!’ She thought to herself. ‘I can’t do anything right! I can't even roll into a ball!’

She remembered how she was often picked on at school over it. Every other hedgehog or armadillo or even fox knew how to roll into a ball. Yet, she couldn't. She was the hedgehog who couldn’t do the one thing hedgehogs were known for.

Her mother used to tell her she shouldn’t worry about it. She couldn't either due to her unusual quill shape. Whenever Memori curled into a ball, the quills that pointed forward on her head would poke into her belly. But her mother also had powers that made up for such a shortcoming.

Her father could roll into a ball, like any hedgehog should, but he had no real powers besides his masterful knowledge on plants that's almost like a power to itself.

And there she was, with the worst of both sides.

'I'm... I'm useless!' She cursed herself, hugging her knees and sobbing quietly.

She didn't know what to do.

'I'm an adult now... Why do I feel so lost? I should have figured a lot of things out by now… but I don’t. Can I truly call myself an adult? Am I a failure at that too?’

She didn't want to cry like she did that day as a child. She couldn't stop despite wanting to.

‘I’m still crying like a child. Adults shouldn’t cry this much! Especially not over a few mean words like I’m back in the school yard!’ She berated herself.

She didn’t want to keep crying. She wanted to overpower the intense emotions and exorcise herself of it.

She tried to force herself to smile.

'That's how it is, isn't it? Children pretend to cry, adults pretend to smile. Isn't it mature to smile when you're unhappy? Adults shouldn’t cry when children depend on them. Adults need to grit their teeth and keep moving, no matter how hard, no matter how painful. Whatever comes my way, I have to keep smiling and staying strong… for them…'

She tried to force a smile, tears still occasionally trickling down her face. She hoped that if she smiled on the outside, she may be able to smile on the inside too.

It was no use. The fake smile collapsed quickly. It was hard to remain optimistic and hopeful when her role model for those things hated her guts and was suffering because of her actions.

She couldn’t abandon them either. She got them into that mess, and she had to pull them back out again. Eventually she had to return to camp, no matter what she chose to do.

‘I wonder if Mr. Shadow was worried about me? I must have made quite a scene. I suppose here I go again, messing things up, hurting people, and making things worse… I’m not a freesia. I’m a lily of the valley…’

Shadow and Silver may have become monsters, but she felt like she was also cursed. She was a bad luck charm to those who gave her any help. Ever since that fateful day, she was never truly able to make friends. Every time she did, the Children would eventually come after her and she had to cut ties without warning and leave them behind for both her safety and theirs.

She even had to leave her mochi instructor behind. That had to be the hardest parting she ever had to face. He was only slightly older than her, yet she felt something more than friendship. Despite his name being Django, she liked to call him ‘Dango’, after the rice dumpling.

She couldn’t even tell him goodbye. She had to leave in the middle of the night with only a packed bag and left without much of a trace. She left some rings, and took the Kine and Usu with her, a sort of unofficial payment. It was the last memento she had of him and her time making desserts for people.

She wept even harder knowing how she didn’t even leave a note behind.

Just like she had to do with her father. Just like she had to do with any friends she made. Just like she had to do with everyone she ever loved in her life.

The mystery of those diaries was the only thing she had left. Solving it was the only thing she could do if she ever wanted to find her mother again. As she found out that morning, it was also the only thing that potentially saved Shadow from exile on the ARK as a mindless monster.

She made progress at a great personal cost. She just needed to keep moving forward.

But there was the problem.

She had no idea how much further she could go. She saved Shadow from exile, but she didn’t know where to go next. Shadow had trouble remembering much, but he was also key to unravelling everything that was tangled up. She didn’t know how to help him remember other than giving him back his diaries.

She knew it was Dark Gaia energy that’s caused Shadow and Silver to become that way. But she knew nothing about how to exorcise them. She read all about it, but had no equipment or serious know-how to achieve such a goal.

‘I guess… Shadow did try to make a machine to purge the energy from him. But there’s one more issue. It’s become his new life force. He doesn’t have chaos energy. I guess that might explain why he doesn’t revert back to his normal self in the day. How can I fix him? How can I fix them? I have to do it because I am the one who caused them to be like this. I ran away like a coward, like a child. I have to go back. But… I’m terrified. They became monsters, scary monsters. And Silver can read my mind without me even noticing, even able to dredge up the darkest parts of my psyche. And he looks like could easily win a fight against me, even with my hammer. If Silver ever lost control and went after me… I don’t think I could even get away! I don’t know what to do….’

She tried to settle her emotions back down again, knowing there was the greater mission at hand. As she took in a breath to try and steady herself, she heard something. It was a set of heavy footsteps. Her heart jumped! The Children were already tracking her down so soon!

She didn’t even have her hammer to fight back!

Panic began to set in as she desperately tried to hide. She knew she likely wouldn’t be able to run fast without bringing too much attention to herself, or worse, she couldn’t afford to lead whoever may be after her back to the camp.

She ran towards the nearest tree to rapidly climb its branches. She ran upwards along the surface of the tree until she could reach the nearest branch. She grabbed on, pulled herself up, and then jumped across to the nearest branch that was a little higher. She continued jumping and grabbing onto any branches nearby she could get herself onto as she rapidly ascended a large tree in the forest.

When she thought she was high enough, she clung to the tree as tightly as she could and tried to be as silent as possible. She even turned herself invisible again with her unexplainable power just to be safe. She closed her eyes in the unconscious attempt to not be seen and kept her ears straining to hear the source of the footsteps.

“… … is where she is?” She heard a faint voice say on the forest floor.

“She would have had to come this way. Now remember, we have to get her in our custody, especially since her house got destroyed not long ago.” Another voice replied.

Freesia struggled to hear the voices clearly over her own pulse beating against her ears. She tried to keep still and keep her breathing as quiet as possible, hoping the ambient noise of the wind in the trees would mask any sound she could make. She hoped they would give up and move on.

“Weren’t there witnesses that claimed there were two others with her?” Said a third voice.

“Possibly. But we know she doesn’t like any long term bonds. She probably cut ties with them soon after for their safety like she always does.” Said the first voice again.

“Nonetheless, we know this is where she would be going. Roughly in these coordinates from that fake receipt…” Said the second voice.

Freesia didn’t know what they were talking about in her panic. But she knew they were talking about finding her. She gasped a little in hyperventilation and tried to control her breathing again.

They went silent for a while. It felt like an eternity for her.

“I found her scent! She’s nearby. If she isn’t here, she was here not long ago.” Said the first voice.

‘Go away! Please just go away! Leave me alone!’ Freesia mentally pleaded, refusing to budge.

She heard harsh scratching against the tree she just climbed up.

“She’s up here!” The previous voice called out. “Freesia, come down! I don’t want to have to come all the way up there to get you!”

‘I’m not up here! Just leave me alone. You can’t see me, therefore I’m not here! Don’t get closer. Sweet Merciful Light Gaia, Don’t Get Closer!’ She screamed internally, struggling to keep her breathing quiet and opting to just hold her breath. If she moved even a little bit, they would find exactly where she was.

She couldn’t teleport away with her replica emeralds completely disintegrated. She couldn’t fight back that well without her mallet either. The most she could hope for is stunning them, but she needs to be within range of slapping them. Her Chaos Blast would doom her more than help since it exhausts her so much to pull off.

All she could do was grip the tree tightly and hope they didn’t find her.

In the terror of it all, she was reduced to a scared child, hiding like she was trying to avoid being punished by her parents for doing something really bad. She hated it. She didn’t want to be a child. She wanted to be grown up and know what to do and how to handle such a situation without becoming a shaking mess of fear when things got intense.

The sound of claws digging into the tree got progressively louder.

“Freesia, please make this easy on us for once!” The climber pleaded. “At least tell me where you are!”

The matcha hedgehog stayed in place and didn’t make a sound. She was just hoping she wouldn’t pass out from holding her breath. The stress alone was making her dizzy.

The climber steadily got closer.

“Freesia, please don’t resist again this time…” The climber teased. “We’re some of the best trackers around. Just call out. I won’t bite. I promise!”

She stayed put.

The climber got closer still.

Freesia hoped she still remained invisible.

“Don’t you recognise my voice?” The climber called out. “Don’t you remember who we are?”

Freesia didn’t. She just heard words and knew someone was getting closer to her and that was all she needed to know about the situation. She didn’t know what to do. She had to get away, but she didn’t know how. She just froze in place. She felt trapped.

“Looks like we have to do it the hard way again.” The climber grumbled, getting so close she could almost smell his breath. “Talis! Now!”

Before she knew it, a pair of arms wrapped their way around her. It wasn’t the climber. It was someone she couldn’t even hear coming.

AAAAAAAAAAAAAAAAAAHHHHHHH!!!

She screamed so loud and high pitched it may have shattered glass. She struggled against the figure holding her. Her invisibility evaporated quickly.

“Freesia! Calm down already!” The one holding her cried out, struggling to keep a consistent grip on her. “We’re not going to hurt you!”

She didn’t calm down at all. She flailed as best as she could, not even caring that she was being held up at least a good eighty metres high in the air. She just knew she had to get away. In the instant she was grabbed, she turned from a childish bundle of nerves to a cornered animal caught in a trap. She squirmed and tried to use her quills to spike her captor.

“Let me go!” She screamed repeatedly, frantic and hoping everything that was happening was just a bad dream. “I can’t leave them behind!”

She managed to loosen the grip of her captor and she tried to use gravity to her advantage and drop.

“Varan! She’s slipping! Catch!” He commanded.

Freesia managed to slip out of his grip, opening her eyes again to see that she just got caught by the climber, a large mobain komodo dragon, after a short fall. As she fell into his arms, she saw a golden sun gleaming on his hat.

“Freesia! I need you to calm down!” Bellowed the Komodo dragon.

She didn’t listen. She tried to wrestle out of his grip, but he was much stronger than the previous captor. She tried to kick him in the face and dive off him towards the ground. Unfortunately, he held down her legs and he was much stronger than the flier.

“Freesia! Please!” He pleaded.

She tried to throw a punch. She swung at his head, but in the dark of night, it was hard to see exactly where it might connect.

“I don’t want to hur-ough!”

Instead of feeling her knuckles hit a jaw or face, she instead felt a sharp pain up her arm. She swung right into the jaws of the dragon as he had his mouth open, begging with her. The fist ended up halfway into his mouth mid-sentence as his jaws came down.

She was bitten.

The venom was already making its way down her arm.

Before she could truly get a look at the teeth marks in the moonlight, she began to feel faint and sleepy. Her body grew weaker and she could feel herself almost relax again as things started to go dark. Before she could even scream for help, she was already unconscious.

She wasn’t going back to the camp after all.

Chapter Text

The Longest Night - Part II

Splosh!

Silver jumped a little from the sudden noise. It was just a splash from the river, possibly from a rat or some nocturnal creature. He could see it after looking around for a moment, it turned out to be a large fish. Just another organism in the ecosystem living its life. Under any other circumstances, he would be enjoying nature and a moment of peace and quiet after everything that happened since that morning. But he wasn’t enjoying it. Too much went wrong to enjoy the ambience.

Silver never liked being alone. Even if was sometimes peaceful to be left to his own devices in the quiet, he never liked being by himself for long. Especially when he had nobody to turn to for help or advice or any kind of morale boost. In too many future outcomes he prevented, he often felt like he was one of the only survivors left in the world. He thought he would be used to it by now, being trapped in a world on fire, or completely desolate, or ruled over with an iron fist, but he wasn’t. It was always terrifying.

He was taken back to those dark places. Back when he would run and hide from monsters of fire or killer robots. Back when he was sometimes too scared to sleep at night because danger was everywhere. Back to when he didn’t know what he was doing and had to force himself to keep going because the only alternative was despair. He sat on that log, shaking as his damp fur was struggling to dry as the fire burned out, unsure of anything. His blindness didn’t help either. It was bad enough he was alone. He didn’t want to risk ending up completely lost by stepping away from the camp. Even if Shadow and Freesia were coming back, he had no way of knowing when or how long he would be sitting by himself for.

‘Just… when is Shadow coming back?’ He wondered.

It had been a while. If he could take a guess, it was probably an hour since he left, perhaps even longer. But he had no way of knowing the time. He couldn’t even use the moon’s progression in the sky as a timer since he couldn’t see that either.

‘What if… What if she’s in trouble?!’ A worrying thought came to mind. ‘I… I can’t help her. And if Shadow can’t find her then he might not come back either and… If… If they are both in trouble… then…’

Silver tried to take some slow and deep breaths to steady himself again, something Espio once tried to teach him a while back. Worrying in place wasn’t going to solve anything. He couldn’t let himself be consumed by panic, especially when there’s nothing he can do. All he could do is plan what he was going to say when they got back… if they got back, anyway. It took a few moments to steady his emotions a little again. He had to focus on moving forward, regardless of what happens.

He tried to take his thoughts off the terrifying idea and focused on how he could word his apology.

‘Could she ever forgive me?’ He wondered. ‘I didn’t realise then, but she must have been terrified about what happened to me. She tried to be strong, and I spat in her face… I’m not even sure I would forgive me for that…’

Even if his monstrous form would be reverted in the daylight, he knew she was never going to see him in the same light again.

‘I… I messed up… Stupid Silver! Stupid!’ He cursed himself.

Suddenly, he felt his heart jump with no explanation. He was already on edge before, but something pushed it further. Silver felt his body shudder uncontrollably. He knew that feeling, he sometimes thought of it like a 6^th sense of sorts. Something was watching him. It was the look of a cold, judgemental glare that was seeing right through him. He felt his heart run where his legs couldn’t take him, and his breathing exercises were immediately undone as he didn’t know what to do. The feeling wasn’t going away. It only intensified the more he tried to find where it was coming from.

He tried to look around to see what it was, but he didn’t see any living being. He breathed a small sigh of relief that he wasn’t about to be ambushed. But the feeling of cold judgement was still over him. He felt his fur pick up as he kept looking. He gasped, almost screamed when he realised it could be a robot surveying him, like a drone, and he wouldn’t be able to see it. His limited vision only extended to living beings as far as he was aware.

‘Stupid third eye!’ He cursed internally. He wanted to see with his real eyes, but they were sealed shut no matter what he did.

That’s when he finally saw it. It was circling around him. A dark pink starfish-like creature floating in the air with an eye in the centre, looking down on him. It was staring daggers. The eye was a golden colour, not unlike his own eyes. It didn’t blink. It just looked at him, never breaking gaze. Among the many things he expected to see, a floating starfish-eye wasn’t one of them.

‘What the heck is that?!’ He mentally screamed. ‘And I thought my third eye was weird enough!’

Not knowing what else to do, he went to try and swat the thing away. He stood up, and tried to grab it with his jaw-like hand and crush it. He flinched a little as his arm stretched out like rubber to close the gap.

‘Guess I can do that now…’ He thought, focusing on trying to get rid of this judgemental starfish. ‘But it’s not that useful…’

However, as his hand was almost able to grab the pink manifestation, it phased right through like a ghost.

Whatever the it was, it wasn’t physical. He had to fight it with something else. Any other day, he would be able to throw the thing with telekinesis or cut it with a psychic knife, but he didn’t have those abilities in his new form.

He tried to think about how to drive the unnerving eye away as it kept circling him. He couldn’t think of anything he could use. The only thing he could try to do was summon a monster of rogue psychic energy like he did earlier that night, but… He really didn’t want to. It burned him out badly the first time and he still hadn’t fully recovered yet. Also, he had no control over what such an invisible monster could do and there was no guarantee it was going to get rid of that starfish-eye thing. He had to try something else.

It kept circling around him. It didn’t attack. It just glared at him. Eventually, it moved in towards his face, looking him up and down, almost taunting him with its immaterial presence. Then, it just looked him in his third eye. It made no sound.

‘Wait… Is this thing even real?’ He thought. ‘Or… am I seeing things? Have… Have I already lost my mind?’

It’s just your imagination. A mere projection of your guilt… If you want it to go away, I can help you…

The faint voice in his mind replied. Well, more like the words forming a thought replied. It had no voice, but it spoke like it did.

You should be feeling the guilt. …

As soon as the voice reached his head, the starfish started to move almost panicked. It began to circle where Silver could only guess where Freesia’s belongings were as if it was trying to say something before a bolt of dark energy manifested from his body and zapped it. In an instant, it vanished.

“It’s… It’s gone!” Silver exclaimed.

The judgemental eye may be gone, but your guilt still remains. You have every right to feel this way. You broke the heart of your closest friend in this timeline and doomed Shadow to a one way ticket to oblivion. Not to mention you also doomed yourself to quite a curse as she was your only way out of this mess.

“I… I didn’t mean to… I just… I never wanted this to happen… And… I just… I didn’t mean to… I didn’t want any of this…”

When that happened, you gave into the heat of the moment, and you realised you didn’t trust her?

“But… I didn’t mean to say those things!” Silver tried to defend himself.

Who are you trying to justify this to? You are alone, Silver.

“Who even are you?! I know you’re not me! You spoke to me earlier! This mess is your fault!”

Oh?

“You’re the reason she ran away crying! You told me I couldn’t trust her!”

Did I say that? Or was I saying what you were already feeling deep down? Besides, I didn’t say anything to her. You did!

Silver wanted to snap back again, but the words wouldn’t come out. The voice had a point. He wasn’t under mind control or anything like that when he said those things

You want to know what I am? Isn’t it obvious? I am the voice of reason. Your conscience if you will… I am the often-ignored voice in your head that tells you right from wrong. And I think you should listen to me more often… Every time you have made a decision on your own without me, you were often very, very wrong. You thought murdering Sonic was the only way to save the world instead of dooming it further. You thought you could fight Eggman Nega all by yourself and you wasted time pointlessly fighting with anyone who annoyed you. You thought throwing cars at Sonic in the white limbo would tell you if he was an impostor or not. You thought Freesia couldn’t be trusted. The only time you made good judgements was when someone else made them for you. What I believe cannot be trusted… is your poorly-tuned intuition…

Silver had no reply. Those were his mistakes. Those were his judgements. Everything the voice had said was true.

Whatever he remembered from the other timeline, he did try to kill Sonic. He couldn’t remember why. Sonic was called the ‘Iblis Trigger’ but… Iblis was a fiery monster that burned away the world. Whatever he tried to think of… He knew Sonic would never do that! If anything, killing Sonic would have doomed the world more!

But… He remembered using his psychokinesis to beat Sonic nearly to death. He remembered the unsavoury thump of his body thrown again and again against the buildings in Soleanna. Even if it was only a fragment of the memories from that timeline, as he replayed that moment in his mind, he cringed every time he remembered the pain in Sonic’s eyes. Coupled with where he was in that moment and how he got there, his feeling of guilt only intensified.

“I’m… I’m sorry, Sonic…” He unconsciously mumbled. He knew the timeline was null and void, but that didn’t change the fact that he almost killed one of the most powerful heroes of history.

‘Shadow… he was right… I shouldn’t have acted like Freesia was a villain! She didn’t mean to break her family or cause any of this… She didn’t come close to killing anyone with her own hands!’ He thought to himself. Despite his eyes being almost sealed shut, the turmoil he was feeling was intense. While he still felt the river water dripping off his fur and quills, he felt warm tears start to trickly down his muzzle.

He remembered trying to stop Eggman’s descendant from destroying the future on two different occasions. One to stop him from destroying the future altogether by turning the world into a card. The other to stop him from releasing a monster known as the Ifrit onto the world. Both those times, he remembered he did waste time getting into fights, especially when they were all after the same enemy anyway! Even if they saved the day at the end, if they cut it any closer… Reality as they knew it would be shaped much more differently…

‘I… I guess I always got caught up in the heat of the moment…’ He reflected. ‘She thought I was a hero… but if only she knew how I nearly doomed everyone on two different occasions… even if the day was saved… I didn’t do it alone. Did I even do anything to save anyone at all?’

He wondered if he should even be considered a hero of history. He questioned whether he even helped move anything in the right direction. The last time he fought to save the world was the Phantom Ruby incident. But he struggled along with everyone else. He didn’t save the world. He couldn’t fight Infinite. He could barely help the rookie who ended up actually saving the day. And the rookie was just a powerless, ordinary mobian with a noble heart. An ordinary nobody he never learned the name of, made a bigger impact on saving the world than he did!

He barely helped during the Time Eater incident either, and he should have known more about the anomalies. Out of everyone caught up in the white limbo, he should have had the most knowledge and experience since it was a time-based incident. But all he could do was stay out of Sonic’s way and cheer him on.

But he didn’t do that immediately. He got into a fight with Sonic over a Chaos Emerald. He didn’t know if that was really Sonic or not, but even Silver was questioning how throwing cars at him on a burning highway was supposed to help him find that answer. He didn’t have proper discernment. He either could have nearly killed Sonic again and doomed everyone, or he could have given that Chaos Emerald to a fake and also doomed everyone.

No matter what he tried to look back on, even his victories felt sour.

And then there was earlier that night.

Sure, he may have taken on a more monstrous form because of her actions indirectly, but as he thought about the events leading up to that, it wasn’t her fault. The best analogy over what happened is like trying to fix up a dilapidated building. He knows from experience trying to make a shelter before. As you try to remove the rotten parts and clean up the debris, it always looked worse than starting off, before things could get better again.

It wasn’t her fault, yet he blamed her for it anyway.

He may not have known her for long, but Freesia only treated him with kindness and love nobody else before had. And he repaid her by reaching into her mind and dredging up the worst parts of her life. 

‘Was…even before I looked like this… Just… was I always a monster?’ He thought, his confidence only falling further.

He couldn’t talk about the storm within his heart with anyone, because he drove them away.

Freesia had run off, and it was his fault.

Shadow was trying to get her back, and that was his fault.

He didn’t even know if they were alright, or even if they were still alive. If they weren’t, that blood would be on his hands and nobody else. It would be his fault.

His judgements…

His thoughts…

His intuition…

He couldn’t be trusted with anything, much less the fate of the future he dedicated his life to protecting.

‘I’m not a protector of the future! I’m just an idiot only capable of screwing up again and again and again!’

You understand now?

“I’m Sorry!” He yelled out impulsively into the darkness, to everyone and also nobody at all. The tears down his face only intensified as they spilled down onto his mutated body and mixed with the cold river water that slowly dried in the cold night air. He started to silently sob.

He wanted to call for help. He wanted someone to tell him that things would be ok. He wanted the pain to go away. He wanted to open his real eyes again. He never knew his parents, but in that moment of intense self-loathing and pity, he wanted his parents to be there to help him. He wanted someone to guide him to make things right again.

But he had nothing.

He had nobody.

Nothing but loneliness and fear.

RRRRAAAAAAAOOOOOOUUUUUUGGGGGGGGGGAAAAALLLLLAAAGGGHHHH!!!

He wailed. It was the mournful cry of the monster he had become. It echoed across the forest. He didn’t care if that led to him being discovered by the enemy. He didn’t think he deserved anything less than being taken away. If Shadow and Freesia were still alive, perhaps being removed from the group meant he was less of a burden.

Good… The fact that you feel this way means you can make things right if you do everything correct… You don’t need to be a burden to them anymore.

“Really?” He choked out, his voice quivering a little. 

You now know the error of your ways. Granted, you didn’t need to hit rock-bottom first, but now there’s nowhere else to go but up. You want to be forgiven by them? All you need to do is listen to me…

“Then tell me what I need to do!” Silver exclaimed, desperate for absolution from the guilt pressing on his heart. “How can I get them to forgive me?”

It’s very simple…

You need to listen to me.

But to listen to me, you need to first trust me.

You trust me, don’t you?

Silver didn’t have an answer yet. He had a bad feeling about the voiceless voice in his mind. But… He didn’t know any other alternatives. It also didn’t help that he didn’t even know if he could trust his gut anymore. He made so many bad judgements before that he didn’t know what was even true or false. He was uneasy about trusting the voice, but he had nobody to ask for a second opinion.

“… I guess… I guess I have no other choice…” He answered.

Good enough. Now I can tell you what you need to do to make things right with Shadow and Freesia. It’s very simple. You need to do only two things. One, you need to empty your mind. Your thoughts are unwieldy and cannot be trusted, besides me of course. Two, you need to close your third eye.

“I… I can do that?” Silver asked, surprised.

Yes. It is possible. The third eye may be a mutation, but it is a form of enlightenment you should never obtain. The third eye… Is what you are using to be able to read minds. The eye of the satori, the enlightened one. Nothing good can come of it. All it does is allow you to see the worst in the world. If you close it, not only will you not be able to read minds anymore, but you will be on the same level as them once again. And if you empty your mind and let me handle things from now on, I can make sure you never make a mistake like that again.

“How can I do that?” Silver asked. “I didn’t even know it’s possible to close the third eye.

It’s very, very easy. Think of the third eye like a real eye. Try to blink with it. It will make it easier. As for emptying your mind, it’s even easier than that. Just… stop thinking. Just let me get a proper foothold and I can take care of the rest. It won’t be hard. It won’t hurt. You have nothing to lose by doing this.

So… Just try to close your third eye first and everything will start to get better for you…

The only way to truly see the light again, is to close your eyes…

Silver felt anxiety strike his heart after that. He felt something sinister about it all. But Shadow and Freesia were gone. That was his doing. If it was his only way to make things right, he had no other choice.

As he tried to figure out how to close his third eye, he saw the starfish creature staring him down again.

It was shaking itself left to right, as if to say ‘No! No! No!’.

“What do you want from me?!” Silver snapped at the non-physical creature.

As soon as he said that, another bolt of dark energy went to zap the thing again. However, it moved quickly and dodged out of the way.

It continued shaking itself left and right as it moved. Whatever it was, it was not approving of the situation.

“Stop staring at me!” He yelled at it again. “Or say something, you mute starfish freak!”

It said nothing, only dodging more and more bolts and continuing to swivel left and right.

Silver just wanted it to go away at this point. Whatever it was trying to say, he didn’t want to listen. He just wanted the nightmare to stop.

He just ignored the starfish eye staring at him anymore and tried to close the third eye. To his surprise, as soon as he thought of doing it, he saw the lids slowly closing on his vision.

Things started to get darker and darker.

As soon as the eye closed, his emotions and turmoil started to fade as well. It was almost relaxing at first. The burden was already lifting.

Then he felt a primal fear encase his whole being. It was nothing like he had ever felt before. He not only felt watched, but he felt like he wasn’t alone in his own body anymore. He felt himself, his mind, his thoughts and feelings, all slowly be covered by darkness and drowned out.

He tried to scream or call for help, but his mouth wouldn’t respond. In fact, he couldn’t’ feel anything anymore!

He hoped Shadow and Freesia wouldn’t return.

In the last bits of lucidity he had left before what made him him was snuffed out, he realised how the Children of Faust got their new recruits!

Chapter Text

The Longest Night - Part III

Shadow had been searching through the forest for Freesia for a while. He knew the direction she ran, but he had a slight delay from fishing Silver out of the river first. Unlike the werehog form of his late rival, his monstrous form still had a decent speed. When running on all six, he could travel from one end of the remains of the ARK to the other in less than a day. In theory, he could comb the entire forest in a single night to find her, assuming anyone else didn’t get to her first. He may have only known her that morning, but she was the key to him remembering who he was before the darkness partially claimed his mind.

It wasn’t amnesia. His memories were being suppressed by the same force that mutated his body. The same force that kept him alive, even if he didn’t want to call it a life.

But he didn’t feel like it was his only reason for wanting to find her.

He faintly remembered a few events of his time on the ARK.

His mutated body wasn’t ideal. He needed rest, and often. However, when he rested, he would have strange but vivid dreams of the same nature. Those dreams were usually of a dark hallway of sorts, not unlike anywhere on the ARK itself. The hallway twisted and distorted and just kept going on endlessly no matter how far he ran. He never found the end or beginning. What was worse was he would often hear voices behind him, taunting him and telling him that he did something to deserve his situation.

Occasionally he would call out for help. Sometimes, he saw a silhouette in the distance, and heard a faint voice reply. There were two different silhouettes he could remember. They weren’t always in the same dream together, but there weren’t any others he could recognise.

One would usually reply “Fate has been distorted to give you a bad hand… I will find you, but I cannot save you…” and disappear into the void. Shadow could barely see the shape of the figure before she faded. Something about her made him feel sad, as if he lost someone important to him. But he couldn’t remember who she was.

The other would normally answer “Where are you? I want to know! I want to free you, but I don’t know how! I… I will try!” and would run towards him. However, before he could see her face, he would wake up. When he did, he felt the desire to find out who was calling out to him, before sinking into frustration and despair once again as he realised nobody was going to help him. There were no escape pods left on the ARK. Nobody would ever really visit either. He had no way of escaping under his own power.

The Space Colony ARK, once his place of birth, his original home, became his prison.

Before he knew it, there were visitors, and he fought them. Next thing he knew, he was thinking much more clearly, like the fog over his mind had lifted just enough to be able to see again. After that, he was back on Earth. For the first time in over 180 years, he felt what he could only faintly understand as ‘hope’. Freesia reminded him of the girl he would faintly hear in those hallways while he slept. The one who called out to try and help him.

And then he was at a dead-end again.

His only lead back to learning the truth of what happened and regaining his sanity ran away, and the future’s guardian became a mind-reading monster.

Although he didn’t want to be too harsh on Silver. If the young hedgehog was infected with the same darkness he was, he probably wasn’t in the right mind. He didn’t want to leave him alone in such a state for long. He didn’t know what might happen or what he might try to do. If there was one thing Silver was known for, he could be very reckless and impulsive.

Shadow sighed, realising that the next few nights were going to be long if Silver is going to be that ill-tempered every time. But he knew deep down, the cost of his clarity meant the psychic’s psyche erosion. It was his fault that the now-storm-grey hedgehog was like that.

‘The sooner we can both be cured the better…’ He thought to himself. ‘This is not a way of life. It’s a way of death… A waking death where you’re still breathing…’

Aaaaaaaaaaahhhhhh!!!

His train of thought was disturbed. He heard a high-pitched scream in the distance. He rushed towards the source as fast as he could. He knew it was Freesia without a doubt. It was a scream that made his blood run cold. His mind was flooded with worst-case scenario predictions. Intrusive, vivid, terrifying predictions, each one more dread-inducing than the last.

On all six, he glided along the ground and felt the wind in his tendril-like quills. He wanted to be able to move even faster. He felt his arms and legs begin to ache from the strain, but he didn’t slow down. No matter what, he wanted to save the girl!

When he got to the source, he found Freesia. She wasn’t alone. She was being held by a large and muscular Komodo Dragon who was dressed in a thick dark jacket and wearing a cap with a shining golden sun on it. Her eyes were closed and she wasn’t moving. Shadow saw teeth marks on her arm. It didn’t take long for him to realise what happened.

Next to the Komodo Dragon was an abnormally large dragonfly and between them was a heavily armed but rather small spiky lizard who was dressed like a steam-punk maid.

He was just out of sight of the group, looking on in shock and horror. He was too late.

As he saw Freesia’s lifeless body hanging there, he felt a mix of emotions. Terror, grief, anger, sadness, and even some emotions he couldn’t quite recognise erupted within. He was shaking. His teeth gritted together so tightly they were on the verge of shattering and slicing his mouth open.

His only hope had been snuffed out and he wasn’t able to save her.

His breathing started to become heavier. He could feel something heavy resonate deep down at that sight. Tears began to fall down his face before he even noticed.

He may have only known Freesia that morning, but he wasn’t ready to say goodbye yet after she helped save him from an endless life of nightmares and isolation. He failed her. He failed himself. And he failed…

…

…

…

He felt a memory come back to him. It was from a long time ago. He knew he did something drastic. It was to save someone close to him…

He saw it.

A flash of violet and dark grey…

He heard the cry of children in the back of his mind…

Right before he could see their faces or recall their names… The colour was snuffed by darkness. Suppressed once again by the dark energy that riddled his body. He couldn’t remember who he tried to save. But he knew in that moment, he failed them too.

‘I… I failed her… I failed them… I may as well have failed the whole world…’ He thought to himself. ‘It’s lost. I couldn’t save her… I wasn’t fast enough… SHE’S DEAD BECAUSE OF ME!’

It felt like he just lost one of his own children. He knew he didn’t know her that well, but he knew she had some connection to him. He could feel it. It was instinct, perhaps even beyond that.

He heard something that grounded him back to reality once again. Beyond the breathing of the trio before him he noticed that, besides himself, he heard 4 different breathing patterns. The 4^th one was faint and weak, but it was still there.

Freesia was still alive!

Suddenly, he felt hope reignite within him. He had to save her! He could grab her and rush her to a hospital. Since Silver’s time seemed to be a relatively happy future, he figured there should be treatments for Komodo Dragon venom available. At the very least, it was giving her the best possible chance to survive. He didn’t care if he got captured or if people would try to kill him for such a monstrous appearance. If there was a chance she could live, he wanted to take it!

He looked towards the trio than held her, and he saw red.

It didn’t matter if it was only a few seconds since he found them, he was going to make them regret what they did!

He didn’t bother listening to what they were saying amongst themselves. It sounded like they were having an argument of sorts. Shadow didn’t care. Dark and dangerous thoughts crept into his mind and he let them linger. Whatever dark and depraved ideas populated his mind, he wanted them to fester and make his vengeance all the more brutal. A murderous tranquil fury overtook his body. It felt like being on the ARK again when the voices took over from time to time. It was something he could never get used to, but this time he didn’t resist.

He didn’t know exactly what happened next. He blacked out for a moment. When snaped back to reality, Freesia was gently cradled in his arms, and the Komodo Dragon was behind him, sounding like he was choking as he collapsed to the ground with dark liquid spilling from his jacket. In the darkness, it was difficult to make out whether it was blood or something else, but Shadow didn’t care. He didn’t even bother dealing with the other two. Freesia was in his arms and he knew what he had to do next.

He didn’t need to fight anymore.

He needed to run.

He ran from the scene on five, using one of his arms to clutch the green hedgehog close to his chest. He was trying to run back the way they came. He didn’t exactly know where the hospital was, but he was willing to search for one no matter what it took. He tried to ignore the fatigue he was already feeling. The choice was between him resting and her surviving. She made that choice for him.

“I couldn’t save her… but I will try to save you!” He shouted to Freesia, hoping maybe she may have been able to hear him.

Without the same burdens as before, he was capable of running much faster to the New City. However, his arms and legs were already beginning to ache. It had been too long since he last rested, and after he left the ARK, his strength was significantly reduced. He guesstimated he only had enough energy to spare getting her to a hospital door before his body would give up on him and collapse.

All the more reason to keep moving!

As he hurried through the unexplored lands, masterfully navigating any slopes or any obstacles, he heard trouble coming up behind him. It sounded like fluttering wings. It was getting close, very fast.

“I will give you one chance to give back the girl!” The dragonfly shouted beside him, keeping up almost effortlessly. He was carrying the spiky lizard beneath him. “And maybe you can go back to living in this forest peacefully!”

Shadow didn’t answer. He didn’t want to fight them. He didn’t have the time, or the energy. So, he kept running, hoping it was just a bluff.

“Looks like we’ll have to neutralise this fiend!” The dragonfly noted. “Opaque, get ready! Don’t hold back! I’m going back for Varan. Do your thing!”

“OK!” The little lizard girl answered. “Alright, Ugly! I’ll show you why they call me the Ultimate Disruptor!”

Shadow groaned a little under his breath after she said that. While most of his memories were faded, he felt offended that such a tiny lizard took a title of ‘Ultimate’. Especially when she looked about as ordinary as they came.

Next thing he knew, he felt something land on his back and grab onto his tendril-like quills. He felt a strong yank as if that lizard was trying to control him like he was a mount of sorts. He didn’t stop running. He tried to shake the lizard off his back with more jerked and sudden movements as he leaped over the rough terrain.

The lizard clung on well, and even used his tendril-like quills like a vine or rope and swung right back into him every time he managed to get her off his back. Shadow learned the hard way that that little lizard was very spiky as she partially stabbed into him each time she did that.

“You won’t throw me off that easily!” The lizard taunted. “You wanna know why I’m called ‘Opaque’? Because you can’t see through me! You can’t ignore me! And most importantly, you can’t escape me!”

‘You call that a one-liner?’ Shadow thought to himself. ‘That doesn’t even make any sense!’

Unfortunately, while Opaque lacked one-liner skills, she wasn’t bluffing.

He heard the clicking of something mechanical. He then heard what sounded like a whipped cream can and immediately felt something cold dripping down his arms and legs. The substance he was sprayed with seemed to be foam of sorts. It hardened rapidly, slowing him down.

Opaque kept spraying foam over him, rapidly manoeuvring around his body and managing to avoid getting covered herself. Quickly, it hardened to stone and he was stuck in place in a matter of a few seconds.

“Riot Foam, Baby!” She chanted, giving him a kick to the head before she leaped off. “Even Varan has trouble getting out of this stuff!”

She looked towards her achievement, before her expression changed to that of a child who realised she was in big trouble when her parents got home.

“Uhh…” She uttered. Her bravado evaporated like water on the sun. “Maybe I didn’t think this through…”

Opaque had gone overboard with the riot foam and the green hedgehog was also covered in it. Her head was untouched, so she was still breathing, but she was nonetheless buried along with Shadow in the rock-like foam. While he couldn’t move for the moment, they couldn’t take Freesia off him either.

“Opaque! You Idiot!” The dragonfly shouted, the Komodo Dragon carried in his arms. “Now what are we going to do?”

“Shut up, Talis!” The tiny lizard snapped back. “I stopped the monster, didn’t I?”

“Opaque, you are aware of the situation, aren’t you?” Talis snapped back. “It’s literally life or death! I don’t care about the monster. we were after Freesia! Time is the essence here!”

Shadow was enraged even more. Not only were they slowing him down when he didn’t have much energy left, but they were wasting his time arguing while the green hedgehog was slowly dying in his arms.

Any other day, he would be out for blood, but he didn’t have enough energy left to get himself pointlessly worked up. He tried to focus his rage to something more productive.

He pushed against the riot foam, trying to overpower it. He tried to find any weak points and pushed against them as hard as he was capable of into it. He heard crumbling against the inside of it as he could feel it gradually collapse.

He couldn’t do much about the noise. Talis and Opaque stopped arguing as they heard the cracks begin to form at the temporary containment.

“Let’s discuss this later!” Talis shouted. “Our mission still isn’t complete!”

“Right!” Opaque nodded. “Already on it! I’m getting the Glop Cannon ready!”

Before they could try to contain him again, Shadow managed to smash his way out of the riot foam. To make sure they wouldn’t try to pull a similar caper again, he threw the scattered chunks towards the trio at high velocity.

The dragonfly got grazed by one piece, and then immediately knocked down by another small chunk of debris. He fell to the ground and got a little winded.

The small lizard got pinned down by a much larger chunk, at least for a moment as it didn’t weigh that much to begin with. 

Shadow took that buffer of time and moved on a little bit slower than before as he burned through a lot of his remaining strength breaking out. He hoped that the nuisances would back off for a while.

“Freesia… Please hang in there… I am doing everything I can…” He whispered to her. She let out a small groan, letting him know she was still alive, even if barely.

Unfortunately, the trio were back after a few minutes. Shadow learned the hard way that not only was Talis a fast insect, but he was also capable of carrying both Opaque and the Komodo dragon for quite a while too.

‘They just don’t know when to quit, do they?’ He cursed internally. ‘But neither do I!’

Unlike last time, Opaque didn’t leap on his back again. Talis hovered around him with surprisingly good control over omni-directional flight, and Opaque wielding something else to try and snipe him from a distance.

Shadow tried to weave himself through the forest, hoping to throw off their aim. It was mildly successful as the thorny lizard ended up hitting the trees instead. He quickly realised that it wasn’t riot foam being blasted at him this time. It was a sticky goo of sorts, almost like thick caramel minus any sugar or heat.

A small amount got onto his arms and it stuck like strong glue. Shadow figured out quickly they were really desperate to stop him. He knew if he got covered with that glop, he wouldn’t be able to escape. Even if he could escape, his body would have run out of strength and any chance he could save Freesia would become null and void.

In that moment of realisation, he felt very afraid. He only had to fail once for everything to be for naught.

He tried to move more evasively, doing his best to avoid any of the glop blasts aimed his way. He tried to listen carefully for where the dragonfly was, since he was carrying the sniper that spelled his downfall. The dragonfly could keep up in speed, but he couldn’t silence the humming of his wings as he hovered around. With a bit of focus, his directional hearing proved fruitful enough.

It was a bit to keep track of however. There was trying to navigate where he was and not trip on the tree branches, making sure Freesia wasn’t slipping out of his grasp as he carried her, and keeping track of a dragonfly that was following him like a fruit fly to an overripe apple.

Wanting the madness to end, he tried to prepare a few dark projectiles and run on four instead. One arm around Freesia, the other arm preparing to throw a few balls of dark energy like he was pitching at a baseball game. Unfortunately, he couldn’t see where the dragonfly was, since he kept hovering besides Shadow and never in front. That meant, he was aiming solely based on sound and nothing more. Since his target was moving around rather fast, switching from one side to another and keeping up with him, it was easier said than done.

He tried to throw a few projectiles. They all missed. Talis began to move more erratically in response. Opaque kept firing.

Shadow did everything he could to not get hit. But eventually, in one brief moment where his fatigue was catching up to him and his judgement had a momentary lapse, he tripped on a tree root, just past the edge of the forest. In that moment of stumbling, he only made it a few more steps forward, into the clearing under the moonlight, he felt the globs of goop blast onto patches of his body. Specifically, his arms and legs, leaving Freesia uncovered this time.

“I got ‘em!” Opaque cheered.

He tried to break out, but it was like taffy of sorts, it didn’t harden. It was just really thick and sticky. He could move, but only a little bit, and certainly not enough to get away. As he struggled against, it, he felt his body weaken drastically. The exhaustion caught up to him, and even if the goop was gone, he couldn’t move anymore.

The trio caught up to him. To his surprise, the Komodo Dragon didn’t look that hurt, but he did look very badly shaken.

‘Of course, Komodo Dragons have scales like chainmail armour…’ Shadow realised. ‘I… I really have gotten weaker since this morning… Then no matter what… I really couldn’t save her…’

Talis pulled Freesia from his weakened grip and cradled her gently.

“Varan?” Talis called towards his teammate. “How is your supply?”

The Komodo Dragon, without saying a word, opened out his jacket, revealing many broken vials of fluid that spilled all over him. Glass shards almost gave a gently tinkling sound as they fell to the ground. Shadow realised that wasn’t blood he spilled earlier; it was whatever was in those vials.

“Oh no…” The dragonfly gasped. “There has to be one we can use!”

Carefully, the two of them searched Varan’s jacket for one unbroken vial, with Opaque pulling out a flashlight to help them see. Talis also handed Freesia to the small lizard, who appeared to be struggling to handle her weight. Shadow watched, terrified as to what those vials could be and why they were so desperate to find one. He was powerless.

As they searched, more fluid dripped to the ground as more and more shards of glass spilled out.

“What about here…?” The dragonfly mumbled as he searched his teammate. “No… that’s broken too…. There might be another pocket somewhere… there has to be!”

Shadow tried to struggle against the glop that held him in place, but he couldn’t move even a millimetre. He was stuck. It was hopeless. He couldn’t even use his neurotoxin attack. They were too far away.

“Fantastic!” Talis exclaimed, pulled out a single vial that managed to survive. “It won’t be cheap to restock this, but we can’t afford not to!”

Talis motioned Opaque to bring Freesia over. He took out a syringe needle and attached the vial to it. He was going to inject her there and then!

Shadow didn’t know what the substance was, but he knew the Children of Faust otherwise wanted her dead.

“NO!” Shadow exclaimed. “Please… Don’t hurt her! I… I beg!”

The trio turned to face him, all looking equally confused.

“Huh?” Talis responded. “You could talk this whole time?! That would have made things so much easier! We’re not killing Freesia! We’re saving her! She tried to punch my associate in the face and accidentally got bitten. This is the anti-venom she needs to counteract it!”

Shadow’s eyes widened.

“So… You aren’t trying to kill her? You aren’t associated with the Children?” He asked, puzzled and shocked by the news.

Talis had a delayed response. He was carefully injecting Freesia with the anti-venom. After that was done, he turned back towards Shadow.

“Why would we want to do that?” He asked.

“Isn’t that a golden sun you’re wearing?” He asked, confused by what the intentions of the trio really were. “The same sun the Children wear?”

“Golden sun?” They asked, altogether.

Talis face-palmed after a moment.

“Varan!” He snapped. “It’s that stupid hat! I told you before the mission it wouldn’t be a good idea to bring that thing out. No wonder Freesia tried to punch you in the face!”

“I am not getting rid of this hat, Talis, I tell you that every time!” Varan defended himself.

“Wait… If that’s not a sun, what is it?” Shadow asked, still rather confused by what was happening.

“My friend, take a closer look.” Varan answered, taking his hat off to show it much closer to Shadow’s face. It wasn’t a golden sun. It was a golden star with a Chun-Nanese character on it. “I got this hat on a vacation a very long time ago. The character says ‘Dragon’.”

“And I keep telling you that sometimes you need to leave that hat at home!” Talis snapped again.

“My hat is my friend!” Argued Varan. “It helps me keep my head in the game out on a mission.”

“Oh boy here we go again!” Talis argued back. “Look, we had a misunderstanding that nearly cost us a life twice in less than an hour because they mistook that star for a sun. I know this seems like a small thing to argue about, but maybe a lot of hassle could have been avoided if you just left it at home this time, or at least put it in your pockets!”

“To get back to the point,” Shadow interrupted. “If you aren’t the Children of Faust… What are you then? And what did you want with Freesia?”

The three of them turned to answer him, each with a cheeky grin on their face.

“We are the Neo Chaotix!” They chanted.

As soon as their organisation name was dropped, the three of them got into position, and struck a pose as a team. It was almost a compulsion. The komodo dragon stood in front, and didn’t strike much of a pose because Talis handed Freesia over to him to hold. The dragonfly then leaped atop his shoulders and stood along his spine. The thorny lizard then grabbed onto the tail of the dragon, who then flicked her up and over the dragonfly and landed in the front. As soon as she landed, she held onto what appeared to be a modified fire extinguisher and pointed the nozzle towards him, jokingly this time. Overall, they struck a pose that wouldn’t look out of place on a cheap knock-off of a superhero movie found in a bargain bin somewhere.

“I am Talis the Giant Darner,” The dragonfly introduced himself finally. “I handle most espionage and paperwork!”

“I am Varan,” Said the Komodo Dragon. “I am the leader and the muscle. I handle security and grunt work!”

“And I am Opaque!” Said the thorny lizard. “I make sure my team have a safe getaway in missions! I disrupt any threats that come our way!”

“From detective work, to security, to any odd job, we have you covered!” They all chanted in unison like they were in a commercial of sorts.

It looked like they rehearsed that for a while. Perhaps it was part of an elaborate promotion champaign. Shadow was a little caught off guard by that display. Of all the things he expected from the trio, he was not expecting that.

They reset their positions back to where they were before they gave their belated introduction.

Varan turned to answer his second question “Our mission was to find and protect Freesia from any threats, including the Children. It was… A request of her mother to keep an eye on her…”

“You know Moria?” Shadow gasped, only just managing to process the events that happened.

“Yeah, she was one of the first clients we met back when we first started up.” Varan continued. “Of course, that was many, many years ago. Wait a minute… How do you know her? How do you know Freesia for that matter?”

“Because… I’m the one who gave them so much trouble.” Shadow answered. “I am the one she called ‘Dr. Sow-Had’, or… I was anyway…”

There was a pause as all of them struggled to process the information.

Shadow also realised in that moment, if those vials were anti-venom and they were planning on using to help Freesia…

In his attempt to save her… He smashed almost every single vial of antivenom…

He almost became the reason she could have died!

He shuddered a little, but tried to push past it.

“It seemed we were in a massive misunderstanding.” Talis continued. “Now, I am sorry for all this trouble. I am sure you meant well. However, we can’t leave Freesia here. We were ordered to protect her, but we were also hired by a recent client who wants her audience.”

“Who hired you?” Shadow asked.

“They asked to remain anonymous.” Talis replied. “But rest assured if she meant so much to you, we will return her back here tomorrow. Of course, we’ll make sure she is fighting fit first. As a token of good will and apology for this mess, we’ll free you from Opaque’s red glop. It’s messy, but fortunately, it’s water soluble.”

The thorny devil handed the dragonfly a canteen of water, which the dragonfly hovered over and poured over Shadow. The goop melted and washed away rapidly, and he could move again.

“There you go.” Talis commented. “All free. Now, we will have to bid farewell as we have a long road to travel back to the office.”

“And that was our only water.” Opaque grumbled.

“Then we’ll just have to tough it out and suffer in silence.” Varan declared. “Though, speaking of water, we should probably make sure Freesia has a glass ready when she wakes up. She’s gonna need it after all that…”

With all his strength spent, he simply collapsed. The anger and shock faded, and he started to lose consciousness.

He saw the four of them get away, carried by the abnormally large and strong dragonfly.

He wanted to go after them, but he couldn’t even move.

Everything went as dark as the nightfall and solitude that decided to embrace him. It was something he was all too familiar with, and something he hoped to avoid the moment he came back to Earth.

He wouldn’t be returning to camp for a while.

Chapter Text

Chapter 20 - The Longest Night Part IV

Freesia noticed the dull pain in her head before she was aware of her own consciousness. As her eyes hesitantly opened up, letting in blurred and limited colour and light, she couldn’t recognise anything.

The first thing that finally came into focus as she lurched forward, weak and sickly, was a glass of water. Before she could recognise anything else, she had already downed every last drop that couldn’t cling to the container. She blinked a few times, trying to assess where she was and remember how she got there. As she slowly gained consciousness again, she started to become more aware of her surroundings. She was lying back on a rather comfortable couch of sorts.

When she could find herself able to think with words again, she looked around. She was in a messy, but familiar office of sorts. It was still very dark outside, very quiet too. The inside of the office was well lit, and disorganised with every possible sign that housekeeping was slacking again. She could recognise it anywhere. But she couldn’t remember travelling there. The last thing she remembered was being back at the camp with Shadow and Silver.

“Silver!” She exclaimed, standing up very fast, a little too fast. She began to feel woozy and collapsed. She fell back onto the couch she woke up on. She had to close her eyes for a while as the dizziness and intensifying headache washed over her.

“Woah there, girl!” Opaque quickly rushed to her aid, handing her a chewy chocolate chip cookie. “Take it easy! You’ve only just recovered from Varan’s bite. And you can’t leave yet, we have a client that’s been waiting to meet you for a while!”

“Huh?” Freesia grunted as she tried to sit upright again, taking a few soft and delicate bites of the dessert. “I have to get back. I can’t leave them behind! I have to make things right!”

“You can barely help yourself in your state, Freesia!” Talis argued, busy with paperwork. “It’s going to take a little while to recover from Varan’s venom earlier. Just… Please don’t try to punch him in the face again!”

“I did what?” Freesia mumbled, confused. “Just… What happened?”

She tried to remember what happened, but it all felt blurry. She remembered the camp. She remembered leaving for some reason and next thing she knew she was in the office of the Neo Chaotix.

“Like we promised your mother all those years ago, we were on our way to find you at the address on that old ‘Ventos’ receipt.” Varan explained. “Unfortunately, when we found you, you may have been a little bit panicked and one thing led to another and… well, you’re here now.”

“They must be so worried about me.” The green hedgehog replied, trying to stand up again, this time slouching forward and holding herself upright by leaning on the arms of the couch.

“We were just trying to keep you safe.” Said the Komodo Dragon. “Your house was just destroyed after all.”

“So… It’s really gone, huh?” Freesia slurred a little, barely registering the information. She may have only had that house for about a year, but it was the first time in years that she had a proper roof over her head. Before it was living outdoors and making camps in the wilderness or living in dark alleyways. The last time she had a roof over her head was cheap apartments in Station Square that always left her feeling unclean no matter how long she took her showers.

So many books were left behind too. So many memories she couldn’t take with her. So much clothing and food now all reduced to waste.

Yet, she didn’t have the energy to cry. She had to keep pushing herself forward. She finished the final bites of cookie and tried to stand fully upright. She had to push past the sadness and fatigue. She had nothing to fall back on. She just had to keep pushing herself forward.

She managed to get herself upright again. She pushed past the light-headedness. It intensified and her vision began to go fuzzy, like static began to grow at the edges of her eyesight.

Next thing she knew, she was held gently by Talis.

“You shouldn’t push yourself so hard, Freesia.” He gently told her off. “You can’t help anyone when you pass out like this. Please, just take it easy and rest for a while.”

He placed her back on the couch. Her head was spinning and she felt a wave of pain overtake her again. She felt nauseous for a moment. She thought she was going to be sick, but after a moment of lying back into the chair, it began to subside again. She didn’t feel much stronger, but she started to feel a little more conscious again.

“I guess… While I’m here… How is my dad?” She asked.

Freesia hated that night all those years ago. The night her mother was taken away. It was also the same night she had to cut ties with her father. She could never look him up or make any contact with him again. As far as he knew, she was as good as dead. The rare occasions she was in contact with the Neo Chaotix was the only time she could learn anything about how he was doing.

The last update she got was about a year ago. He was working towards research on herbal medicines for treating symptoms of NIDS. It started with research on the effects of garlic on the immune system and whether other herbs could possibly help boost immunity and nerve health as a natural treatment to help reduce the symptoms alongside proper medication. So far… unsuccessful, but he was nonetheless trying.

While she was often eager to learn if he was alright and safe, she always dreaded asking the question deep down every time. She always got good news, but she could never shake the feeling it wouldn’t last.

There was a delay in an answer. She felt the dread build up in anticipation of what they were going to say next.

“He… We lost contact a while ago…” Talis answered, his voice sombre and saddened. “We don’t know what happened to him whether he had been captured or wanted to start a new life elsewhere but… We lost him.”

Freesia’s heart sank. Tears finally started to fall down her face. Her mother was captured, and her father was missing. She regretted that her final words before that night wasn’t anything meaningful. Just the typical bye before he left in the morning for work. She didn’t even say “I love you.” that time, either.

‘I… What kind of daughter am I?’ She asked herself. ‘I… I couldn’t even tell my own father I loved him before I would never see him again! And now… I may never get the chance to say anything to him again. I couldn’t even tell him I’m alive! I… I’m doomed to have everything fall apart around me. No wonder mom never wanted me to read those diaries. They carried a curse I could never break. It doomed my fate. It doomed my father, my mother, my hero…’

As the tears silently fell down her face and as she did everything in her power to not break down and be strong, she remembered why she ran away from the camp. She remembered… Silver found out about what happened… She remembered what he said to her… She remembered how she reacted to it all…

“I’m sorry…” Talis interrupted her train of thought. “I should have told you in the morning… But there is some good news, you aren’t alone in your fight anymore. I suppose… we should introduce you to our client. Even if you can’t stand up right this moment, you are at least awake. Hopefully, she’ll prove just the new ally you need right now.”

He walked out into the other room and opened the door. He disappeared for a while.

Opaque handed the green hedgehog another cookie and topped up the glass of water.

“It was crazy getting you here.” The small lizard commented. “A big monster snatched you just before we could give you the antivenom and broke almost all of Varan’s vials. It took quite a chase to get you here safely. Tell you what, in all my years of working for these lug-nuts, I have seen my fair share of weird stuff. But that creature took the cake! Never seen anything like it. Talis thought it was a forest guardian of sorts like the Great Gaia Phoenix.”

Freesia downed the glass of water eagerly and took a few gentle bites of cookie. Her head was clearing up a little more again.

“Great monster?” She wondered; mouth half-filled with the soft baked goodie. “It wouldn’t happen to have 6 limbs, would it?”

“Yeah! Exactly!” She exclaimed. “It claimed to be someone you knew? Seemed pretty distraught when we had to take you here.”

It didn’t take long for Freesia to recognise who Opaque was talking about.

“Shadow!” She exclaimed, spitting out a little bit of cookie when the realisation hit her. “Mr. Shadow must have been so worried about me! What happened?! Is he alright?!”

The lizard jumped a little at the reaction.

“He’s… fine.” She answered. “And we promised him we’d bring you back the moment you recovered.”

At first, there was an air of calm and silence around the office. That was until the trio collectively realised the name Freesia just dropped.

“Wait… SHADOW?!” They exclaimed altogether, Talis even exclaiming from the other room.

“As in… THE ULTIMATE LIFEFORM?!” Varan added on.

Freesia nodded.

As soon as that realisation hit them, it was as if the temperature of the room suddenly got colder. Despite their differences, the expression on their faces showed they all felt the same way about the matter. That feeling was collective dread.

“I don’t know what happened, but I am going to find out!” Freesia proclaimed. “I found him like that. He wasn’t dead, he was imprisoned with no escape, trapped in the body of a monster… On the Space Colony ARK. He was the scientist I wanted to uncover. He was the one who saved my mother… before I doomed her. He was caught in the crossfire of this conspiracy, and I will help him back out of it… or at least I will try.”

“He… Doesn’t still have that list, does he?” Varan asked. “And you don’t think we’re gonna end up on it, right?”

It took Freesia a moment to understand what he was talking about. Then she remembered. It was in an interview. Shadow mentioned a ‘List’ of sorts that certain names were placed on, and hoped to cross off one day…

“Ohh…” She realised. “Well… He doesn’t remember too much about who he was before. He barely remembered he liked coffee. I think you’ll be safe. Otherwise, I’ll try to plead your case.”

The small and giant lizard mobians gave an uneasy nod.

“Agent Shadow?” Asked an unfamiliar voice. “I hadn’t heard that name in years… So… He lost his memories again, huh?”

The voice sounded like a grown woman, someone much older than Freesia herself. It was a voice of someone rather tough and experienced. It almost reminded her of her mother, but it wasn’t.

As Freesia sat on the couch, she tried to get back up, but a spinning head told her to sit back down again..

“Sorry, Freesia.” Talis replied. “This was our client. She wanted to find you for a while and she might have a few questions. The good news is, she’s willing to aid you on your mission and she’s no pushover, either.”

She tried to turn her head towards the doorway to see who the dragonfly was talking about, but she wasn’t able to yet. She still needed more time to recover. She could hear the footsteps of the woman getting closer.

“So… Freesia, was it?” The woman asked. “You’re the one I’ve been told to find? I hope my little escapade across time is worth it. I need to find out what happened and you’re the only one I’ve been told can help me. Because of that, I am willing to help you…”

Freesia felt uneasy. She didn’t think she could be relied on for much at all. As much as she wanted to help, she just wasn’t sure how much she could offer.

“I’m sorry… I don’t know who told you to find me, but I don’t think I can help you.” Freesia replied. “I can’t even help myself right now.”

“You’re closer than most and I have nobody else to turn to.” The woman replied, stepping closer and closer into view. “We both have somebody we are looking for. You want to find your mother again, and I want to find my husband, or at least find out what happened to him…”

“Your… Husband?” Freesia asked. “He was taken by them too?”

“Not just taken.” The woman replied. “They soured his legacy! He promised me all those years ago that we would never let it get to us… I promised to stick by him no matter what. Then, one day… He just vanished…. Nobody knew what happened to him, but I know he didn’t abandon me. He was stolen!”

Freesia felt her heartrate go up a little. She already felt the pressure to fix up what happened with Shadow and Silver, and now she was being requested to help find a missing spouse she didn’t even know about. She knew the Children of Faust had many victims, but she didn’t know them all.

“I began searching for him for a while and even asked his friends for any further information… I searched South Island, West Side Island, Seaside Hill, and infiltrated every abandoned Eggman Base I could find. I even hired the Original Chaotix Detective Agency to help me in my search. Everything I tried, kept finding nothing but dead ends!” The woman continued. “Then I made a trip to Little Planet after I had to resort to a fortune reading from Amy Rose… I didn’t find him, but I found my lead. As I wandered Quartz Quadrant, I came across a familiar-looking face. An indigo hedgehog…”

Freesia gasped.

“Mom!” She exclaimed. “But what…. What was she doing on Little Planet?”

“I don’t know. But she told me something I clung to for a few years now.” The woman continued, finally entering the green hedgehog’s field of view. “She told me if I wanted to find my husband… I had to find you! So, I left Little Planet. However, when I did, I wasn’t in my own time anymore. I was sent 185 years into the future! So… I found the spiritual successors of the Chaotix Detective Agency, and here I am now.”

Freesia finally got a good look at the woman before her. She was a woman who looked to be in her mid-30s. She looked intimidating and towered over her in height. She was dressed in outdated G.U.N military gear and even had a gun in a holster on her waist. She had short blonde hair and blue eyes. Even though she never met such a woman before in her life, she knew who she was facing. She couldn’t believe it!

“You’re…!” She gasped. “I read about you! This can’t be real!”

The green hedgehog couldn’t get the words out properly. She was shocked. Fortunately, the dragonfly decided to cut to the chase.

“Freesia… This is Madonna Garnet, your new ally and she claims to know a bit about not only Shadow’s past, but also your mother and uncle too!”

Freesia’s breathing went heavy. She couldn’t believe it!

“Madonna Garnet?!” She exclaimed. “The Ex-G.U.N. agent who became a famous singer? And the one who married… Who married…?!”

“Yes.” Madonna answered, bluntly, showing off her left hand and revealing a golden ring on her finger. It had a bright red stone in it. “The very same. You might have already guessed, but I want to know what happened to my husband… Sonic the Hedgehog!”

Freesia was speechless. She barely knew what happened to her own mother, or how her father was doing. While she knew that Sonic went missing and had read up a lot of discussion about the controversy, she could never suspect she would cross paths with the woman who stood before her.

She couldn’t think to say anything. There was just a silence in the room. Her head was spinning. She still barely had the strength to stand upright. So many questions were brewing in her head.

“Why…?” She managed to gasp out. “Why me?”

“I don’t fully understand either, but… your mother…” Madonna elaborated. “She never told me why she was on Little Planet that day. But she told me she had the power to see the future.”

“I…” Freesia responded, unsure of how many new revelations she could handle at one. “I never knew that. I knew she had chaos abilities, but she kept so much from me…”

“I got that impression from her.” The woman continued. “She somehow knew who I was looking for. She held my hands, closed her eyes, and told me only a few things. She told me if I wanted to ever find out the truth of what happened to Sonic, and if I ever wanted to reunite with him, that it wouldn’t be easy. She told me to find you, and to help you on your journey. She told me I needed to let go of my past, and to keep moving forward no matter what. It almost sounded like a threat when she told me. I almost didn’t want to believe it. But… She was the only who gave me any lead into what happened. Like it or not, I had to believe her. I can only guess, that the mystery of what happened to him, and the conspiracy you’re trying to uncover are connected.”

“I suppose so…” Freesia commented. “But I can’t wrap my head around it all. I… I don’t know what to do and I let everyone down! And now… I can barely get up. So many people either need me or were hurt by me and I can’t do anything about it.”

“Then do the only thing you can right now and rest.” Talis answered. “I had a feeling it would be a bad time to put this all on you now. Especially after all that’s happened, but this was the best condition I have seen you since we found you. We’ll reassess everything in the morning when you should recover. A lot has happened at once. I know you want to get back to Mr. Shadow, but I don’t think he would want to see you in such a state. We’ll take you back by morning and Madonna will fill you in on everything she knows when we get there.”

“I’m not expecting you to find him right out the gate.” Madonna added. “There’s a lot that needs to be explained and unpacked. The dragonfly is correct. Even if you have the weight of the world on your shoulders, rest is always important. Even for someone like Sonic, he could push himself too hard or try to take on too much at once. It almost cost him his life many times before. One of Agent Shadow’s biggest vices was his martyr complex. Even the greatest heroes of the past, needed to rest and recover once in a while, and you are no different.”

As soon as the suggestion of rest was given to her, the hedgehog felt suddenly drained of any strength she had and her eyelids felt heavy.

“I can see right away you have been pushing yourself beyond your limits, haven’t you?” The human woman observed. “You look very dark under the eyes. When was the last time you had a proper night’s sleep?”

Freesia thought about it, but her thoughts were starting to scatter. She tried to focus on the question and looked back. The last time she rested properly was when she slept in after making Silver some pancakes. She stayed up all night combing through those notes. The night before they went to the ARK, she stayed up very late again to make sure she could properly calculate her Chaos Control technique for getting to the Space Colony ARK without incident. If she could take a guess, it was at least 4 hours of sleep that night at most. It took her at least two fistfuls of coffee beans to stay perky enough to face that morning. When she tried to think about it, she realised it was actually quite a while since she last went to bed at a reasonable time and got adequate sleep.

“… It’s been a while…” She answered, honestly and her speech slurring a little.

“Exactly, so why don’t we rest?” Opaque contributed. “When you’re feeling like you can walk again, we’ll escort you and Madonna back to where we found you and you can continue on your quest, alright?”

Freesia nodded, as her consciousness slowly began to slip. In only a few seconds, reality around her collapsed again and she fell into a very deep sleep.

She didn’t have enough energy to cry beyond the few tears she already shed or process everything that happened. All she knew was she had to keep moving forward.

She hoped she could learn more in the morning about everything going on.

Yesterday was always stolen from her every night and the present kept being chipped away.

Tomorrow was all she had left!

Chapter Text

Chapter 21 – The Longest Night Part V

Shadow was once again back in that hallway, the one he would often see while asleep on the ARK. He saw a silhouette out in the distance. It was one he found both familiar, yet also one he knew he hadn’t seen before in the dark dreary limbo.

Faintly, he heard someone. It wasn’t like anyone he had heard before. It sounded like a young boy perhaps. He was crying out in terror but the distance made it difficult to tell what was being said. He recognised that fear however. It was the same horror he faced when he first had the reoccurring nightmares of the hellish dark plane.

Despite not fully knowing what was happening, Shadow felt an almost instinctual compulsion to close the gap between him and the new figure. He ran as fast as he could down the hallways. He knew how tumultuous the darkness was each time he closed his eyes. He never wished it on anyone. If there was a chance that he could free someone from that same burden he carried, he wanted to make that happen.

The hallways began to twist and distort as the gap seemed further and further away. The sense of time was always strange in that limbo. He could never tell the seconds from hours from years. It felt like an entire odyssey in the endless hallway that twisted and turned in all sorts of directions. He knew he was moving, yet progress almost felt non-existent. Yet, he kept trying to power through. If he didn’t, the only other option was despair. After being given a taste of hope once again for things to change for the better once more, he never wanted to go back every again. That determination began to pay off as eventually, for the first time since he started having those dreams, he ended up somewhere else altogether. It looked like a house of sorts, but the windows were distorted and the furniture was in odd places in the rooms. Some were placed on the walls, others on the ceiling, some were on the floor but upside down. It was vivid. It was surreal. Like an art exhibit of sorts.

Despite not seeing such a place before, it felt familiar. Very familiar. He was almost burning up as something within him was begging to be remembered. He knew without a doubt, it was once his house.

No matter how distorted…
No matter how long it had been…
No matter how much was suppressed…
He knew beyond any doubt it was his old house from a long time ago.

The figure that was calling out was in another room, out of sight. He sounded like he was crying. Shadow made his way to the doorway.

It was dark. Very dark. He could understand why the boy was under such duress. It looked like it expanded on endlessly and there was no way of knowing what or who else was inside. Even for someone so adjusted to the darkness like he was, it was a blinding black that snuffed out even the smallest hints of light.

He felt a little hesitant, but he knew if he was to get the boy out of there, he had to go inside, even at the risk of getting trapped. There was no other way. He could tell at a glance that he couldn’t coax the boy into following him to the doorway. The void before him was too intense and distorting to find a way out by sound.

Nonetheless, the child noticed him.

“Why…?” He asked. “Who’s there?”

Shadow tried to walk into the pitch black as the light started to be snuffed out around him. He tried to make his way through and keep walking in a straight line. He couldn’t think of another way to get the two of them back outside.

“Hello…?” Shadow called out, softly. He hoped the boy could hear him. “I want to help you. Where are you?”

“Don’t get closer!” The boy called out. “Stay back!”

“I will get us out of here, I promise.” Shadow tried to comfort him. He wasn’t sure how well he could make good on his promise, but he wanted to try. He at least wanted the child to know that he wasn’t alone.

He took a few steps further in. He felt his body seize up. He couldn’t move or see any light. It felt like something had paralysed him.

“You can’t! You need to get out of here! It’s a trap!” The boy cried out. “I’m not alone!”

The boy screamed, his voice gradually sounding unnatural and distorted. It was pulsed against his own body like he was suddenly hit with several blunt instruments. The next thing he knew, he felt weaker and hopeless. He couldn’t see what was attacking him, but he knew he didn’t have a chance to get out of it alive.

He felt something squeezing him. It grasped him tighter and tighter, threatening to break his ribs and collapse his lungs. He struggled to breathe. He thought it was the end as he could hear what sounded like sinister laughter in the background. The laughter got louder and louder, almost right in his face. It’s wasn’t the boy speaking anymore, it was whatever took his place!

He could almost see the eyes of the malicious presence. Emerald green eyes of a jealous and vengeful monster. It was mocking him every moment he existed. That voice… It was the same voice that always tormented him all those years every time he slept.

How does it feel, Shadow?

He woke up with a start. While the nightmare was over, he could still feel a tightness in his chest. It took a few moments for the phantom grip to loosen itself again.

He took in a few deep breaths as he tried to assess where he was and what happened.

Shadow didn’t know how long he was out for. But by the time he woke up, he was at least grateful it wasn’t daylight yet. He was still in the clearing. If the sunlight hit him, he had no way of getting out of such magnetism with the ground. He would be a sitting duck for any potential Child to capture him. Even in an ideal situation where nobody would stumble across him, it wouldn’t be pleasant to be trapped and unable to move until nightfall again.

As he got up, he felt a little more refreshed. But he still felt very groggy. He didn’t rest nearly enough. But he was nonetheless awake.

He tried to determine the time. Judging by the position of the moon in the sky, it was getting close to sunrise. If the Neo Chaotix were telling the truth, it shouldn’t be long before Freesia would reunite with them. All he could do was head back to camp and tell Silver the news.

That’s when he remembered how long it had been. He left Silver alone for quite a long time with no way of letting him know if he was alright or what was going on. It may have been 200 years since he last encountered Silver, and most of those memories were faded and distorted, but if there was one thing he remembered about the psychic, was that he was prone to irrational decisions by himself!

After that realisation of how much time had passed, he dashed on all six back to the camp as fast as his body could move. He could feel the wind in his face as he ran, for a third time that night, through the forest. He at least knew where he was going. It wasn’t going to take him long to get back. He just hoped nothing bad happened while he was out.

After a few minutes of running, and another moment catching his breath again, Shadow had arrived back at the camp. He saw Silver, standing quietly and facing the river.

He would have greeted the young mutant psychic again, and deliver the bittersweet news, but something didn’t feel right. Deep down, he sensed something was very, very wrong. He couldn’t place exactly what it was. Silver turned towards the luggage and started walking towards it.

There was something familiar, yet very off-putting with how Silver walked. Granted, he didn’t see Silver walk in that strange, almost monkey-like form before, but he knew he probably shouldn’t be moving in such a way. He slouched forward a little, taking slow, very deliberate steps. It almost looked like a well-animated puppet but without the strings.

It was uncanny. Something about it filled Shadow with extreme dread. It was an intense and primal trepidation very few things in the world could ever bring him to.

Silver reached towards Freesia’s hammer. One hand on the head, one hand-clamp on the shaft.

‘Wait… I thought Silver couldn’t see inanimate objects in that state? Did he manage to get his eyes open again?’ Thought Shadow, trying to rationalise what he was seeing. His unease only grew further.

After holding the hammer for a moment, Silver started to try and bend it, like he was trying to slowly, but brutally, snap the mallet in two pieces.

He could hear slight cracking from the shaft as it was already starting to strain under the force. The cracking gradually got louder as he could hear the splinters of the handle split and break. Whatever Silver was doing, it was intentional. Whether he still had a grudge against Freesia, or whether he wasn’t sure what he was doing, the hammer was going to be snapped in two if he did nothing to stop him.

“Silver! What are you doing!” He called out, interrupting the troubled youth.

Silver stopped and nothing more. He turned to him, showing his face under the remainder of the moonlight. The wind picked up for a moment, sending a chill across Shadow’s body.

Shadow almost never felt true fear in most circumstances, but the sight shook him to his core. There was a familiar, sinister evil that was looking back at him. He could not place a name, but he recognised those eyes! It made his blood run cold. He could hear the distant howl of the wind in his ears, almost warning him of what was about to come next.

The third eye was shut, but he wasn’t blind. His eyes were open, but it wasn’t Silver’s eyes. The sclera wasn’t white, or even yellowed like his own. The iris wasn’t golden either. The sclera was red, the iris a bright green with slitted pupils.

It might have been his body, but it wasn’t Silver!

“About time you came back!” He taunted. His voice, however, was still Silver’s, which just made it all the more unsettling. “Now we can have some real fun!”

Before Shadow could react, he felt something tackle him from behind. It was heavy and pinned him to the ground. His body didn’t have the cyan aura Silver’s powers were known for. He couldn’t see what was on top of him either. As he tried to pay attention to each sensation to figure out what had happened. He felt something like claws digging into his back and needle-like points pricking him all over.

He didn’t know what happened earlier that night when Silver fought off the Children, but he did overhear their exclamations of an invisible monster. He could only guess one such manifestation was summoned against him this time. It was heavy, and he knew almost instinctively if he attempted to get out of the it’s grip, he would probably have his neck snapped by the feral psychic energy manifestation.

“Who are you?” Shadow asked, struggling to keep air in his lungs. “What have you done with Silver?”

There was a moment of silence.

Not-Silver simply smiled. It was a wide and unnerving crescent moon grin that creeped to the edges of his muzzle.

…ha…ha…

He started softly chuckling. It was only barely audible at first. Then it started to get progressively louder.

Hee hee ha ha ha ha ha ha ha ha…

And louder.

HUHUHU HA HA HA HA HA HA HA HA!!!

And even more insane.

AHA HA HA HA HA HA HA HA HA HA HA HA!!!

Shortly after the laughing stopped, Shadow felt a row of sharp teeth bite into his back and throw him across the burnt-out fireplace and knock him into one of the trees. His tumbled and the back of his head struck the base, only slightly cushioned by the tendril-like quills he had.

“Have you forgotten so easily?” Not-Silver finally answered. “Or did you suppress all those memories because you couldn’t live with what you did?”

“What I did?” Shadow asked, confused and scared by the powerlessness he had over the situation. “What are you talking about?”

“I don’t believe it’s just the Dark Gaia energy that’s riddled your body suppressing your past.” Not-Silver taunted. “No… It’s your own guilt!”

“Then tell me what I did if you’re treating me like a criminal!” Shadow snapped back, trying to get back up. “If you know my past, then tell me! If you want to kill me, then you can at least tell me why I deserve it!”

“Kill you?” Not-Silver asked in a mocking tone. “Why would I want to do that? It wouldn’t be any fun. Besides, that’s not why I am here…”

“Then why are you here?!” Shadow snapped.

“It’s an easy explanation.” Not-Silver answered. “I am here to remind you of what you did. Since you suppressed your own memories because you took the coward’s way out of your fate. But that’s far from my only reason. As for why I have gone to more… unconventional means? Because there was only one way I could get you to listen to me! What better way than borrowing the form of someone who can keep you held in place? But besides that, what kind of God would I be if I didn’t take care of my devout followers?”

Shadow felt the horrific realisation of who he was dealing with crawl across his skin. He wasn’t talking to an impostor. He was talking to a God that assumed Silver as an avatar. He was talking to the God the Children of Faust devoted themselves to!

Whoever the malignant God was, Shadow was able to quickly figure out he wasn’t going to reason his way with words. The being before him wasn’t going to invite him for a friendly chat. It was a ploy. The Children of Faust would be on their way to capture him once again like they did all those years ago when they imprisoned him on the ARK.

His only way out of the situation would be to find a way to somehow exorcise Silver before they both got captured.

“What have you done with Silver?!” Shadow screamed. “If this is about me, leave him out of this!”

Not-Silver stared down at him. He walked closer in that almost puppet-like fashion. His face lost its smile. It was replaced with a look of sheer disdain and hatred.

“Oh… This still involves that boy.” Not-Silver replied. “I want to punish you all for what you did to me! Since you’re so careless to forget everything like the coward you are… Why don’t I give you another lecture?”

Not-Silver took a deep breath, and with the clamp-like hand, reached out and grabbed Shadow by the throat. With a forceful yank, he pulled Shadow upright and pinned him against one of the trees. The toothy clamp closed tightly, leaving Shadow barely able to get enough air. It wasn’t enough to suffocate him, but it was just enough to leave him struggling to breathe.

“I wanted to do what you all did to me all those timelines ago…” Not-Silver explained. “I’m sure if roles were reversed, you would want the same thing. I could have killed or had all three of you killed, but that wouldn’t be enough. You can only kill somebody once, and then what? It won’t undo what you did. Besides, I tried that once, and it was never enough. Your friends… Your families… Your allies… They would work to find a way to bring you all back every time, won’t they?! If it wasn’t with the Chaos Emeralds… It was with the Time Stones or the Sol Emeralds or even a wish upon a shooting star. None of you would ever stay dead!
“So… I did something else. I couldn’t banish you all to hell, so I brought the hell to you! I altered all your fates, where you will find happiness and have it ripped away from you one by one! Sonic will never find love or ever be considered a hero ever again. Silver will never have family or any stability in his life, nor ever know his true heritage. And you… You will forever be trapped within this hell!

“But it wasn’t all bad, was it? You found love, a lovely wife no less. You found purpose with your existence in times of peace, following in the footsteps of your own creator and working towards fulfilling the promise you made to your dear friend. You were admired by the military and scientific community. Now… You are nothing.
“But that wasn’t my fault. No. I wanted to ruin you, but I didn’t need to. You ruined yourself and now you suppress all memories associated with it. You rejected your own identity because you couldn’t live with what you did! And now Silver and Freesia have suffered getting caught up in your mess and they couldn’t get you out of it. You dug your grave, and now they have fallen in with you. And it’s your fault…”

“…iar…” Shadow choked out.

“What was that?!” The possessed psychic screamed at him.

“You Liar!” Shadow gasped out, a little stronger this time. He wrestled the grip around his throat with all 4 of his arms. He was still worn out in his scuffle against the Neo Chaotix, but he still had some strength left in him. Even if heavily mutated and unable to fight like he used to, he knew no matter what, he would always fight until the bitter end.

Not-Silver responded to the resistance and tightened his grip. Shadow felt the pseudo-teeth on those jaws start to pierce his hardened skin and threaten to crush his trachea further. With a quick lunge, Shadow was once again flung and hit the ground head-first. It left him dizzy for a moment.

As Shadow tried to get back up, he felt something tightening around his body. It felt like a snake coiling around him. But he couldn’t grab it with his own hands. It was yet another manifestation of feral psychic power in action.

‘I… I have to get Silver back!’ Thought Shadow. ‘But… I need to know how he got possessed!’

He tried to think of a way out, but he felt the coil tighten yet again. It was slowly squeezing the air out of him. He felt a memory trickly back of fighting Finalhazard with Super Sonic as he was falling back to Earth where he ‘died’ once. He remembered when his super form wore off and the cold suffocation of space when Sonic desperately tried to grab his hand and save him from falling.

Of course, Sonic wasn’t successful, but if he grabbed Shadow’s hand then, they would have both fallen. He remembered the burning heat as he re-entered the atmosphere and blacked out. Though he wasn’t burning at the moment, the suffocation he felt took him back to those times.

‘Wait… How come I remember that event fine… but whenever I think of before I woke up like… this… I can’t remember much at all?’ Questioned Shadow. ‘I… I can figure that out later. There are more important things to worry about!’

“A liar?” Not-Silver replied, almost seething every word. “Did I lie when I told you the world would betray you? Was I lying when I showed you your future? Did I lie when I said I would make good on my threats?!”

Shadow didn’t know what he was talking about. But it was nonetheless familiar. Part of him knew deep down that Not-Silver was telling the truth, but he couldn’t understand why.

“You’re…” He heard the possessed psychic choke out. “You’re… a preacher… who lies! Get… Out of me!”

The mutated Ultimate Lifeform was taken by surprise. Silver was still in there!

“Silver!” Shadow called out to him, almost instinctively, struggling to even use his voice as his ribs were on the border of cracking under the pressure.

“You couldn’t even handle one job!” Not-Silver snapped back. “And I didn’t lie to you then, either. I am making sure you make all the right decisions now!”

In the internal confliction, the tightness began to weaken a little. Shadow was able to breathe again, and he closed the gap quickly. He thought it might be possible to exorcise Silver by fighting against whatever lied within his body.

“Sh… Shadow!” Silver struggled to even grunt out. It was like he was being strangled every moment he took back some control. “You need to… Get away… From me! I can’t… I can’t… fight him…”

Shadow could see that his eyes shifted from green to golden for a brief moment every time he fought back. He knew he had to free him, no matter what.

‘I shouldn’t have left Silver behind this long. I never should have fought him on the ARK and trapped him in the same darkness I am. I never should have…’

Before he could finish that thought, a small memory started to trickle back. Two children, no older than 2 years old. One was violet with adorable pink highlights. The other was a dark grey not unlike Silver’s current form. They looked very weak and frail and barely kept their eyes open. They looked terrified, as if at such an age, they understood the concept of their own mortality. They were suffering dearly. He had no choice but to do something drastic and risky. It was the only way…

It was a snapshot of a moment. The look in their eyes. The mechanical sounds of the machine he switched on. The weak crying. The rapid beating of his own heart pounding in his ears. He couldn’t remember much more. Just a few snippets without context.

‘I remember… Those names… Memoria… I called her ‘Moria’ because she almost reminded me of her…’ Shadow felt it coming back to him a little.

But before he could remember the other child, he felt that familiar snuffing out of his memories. The jolt of darkness that always broke his train of thought, like a barrier between who he is and who he used to be that refused to be crossed.

Shadow launched himself at Silver, tackling him to the ground. He pinned the psychic down with all 4 of his arms. He wanted to make sure Not-Silver couldn’t hold him in place again.

“One thing you forgot about me!” Shadow called out, not sure why he said such a thing. “I Don’t Run Away!”

“You aways have such a martyr complex.” Not-Silver spat in his face. “But do you really think you’re doing something?”

Shadow snarled at the demon that stared him back.

“If I really am a monster now… I will fight like one… Like I always have!” Shadow proclaimed.

Not-Silver didn’t even snarl back. His face only reverted to a more neutral expression.

“You cannot use the visible to fight the invisible!” He countered back. “But what exactly are you doing now? By trying to fight me, you only hurt the one you are really trying to save here.”

Shadow wanted to strangle the life out of who was in front of him, but Not-Silver was right. Any damage he deals is inflicted onto Silver’s body. While the psychic hedgehog is capable of taking quite a beating and getting right back up, whatever is over him won’t even be hurt. The creature before him is immaterial. He could only fight with immaterial means. He can’t even freeze the monster in place with a point-blank nerve agent blast either. Silver was immune to it for some reason.

But something about the whole scenario felt familiar…

‘I fought someone like this before… I know I did… But where?’

He knew he fought something he couldn’t hit. The déjà vu went beyond any reasonable doubt.

But what did he do last time?

As much as he tried to remember, he couldn’t.

There was only one thing he could do to have a fighting chance…

“If my mind doesn’t remember…” Shadow proclaimed.

“You can’t be serious?” Not-Silver taunted.

As all 4 arms had Not-Silver pinned down, every hand began to give off a sinister aura.

“My body… Will!” He exclaimed, as he pulsed his dark projectile attack right into Silver’s body. The dark energy pushed its way in, forcing the entity within Silver out for a moment.

AUUUUGGGGHHH!!!

Silver exclaimed as it looked like it hurt quite a lot.

But… As he blinked, Silver’s eyes were looking back for a moment. It worked.

Shadow still couldn’t remember why he knew it would work. But he decided whatever happened to him, it was clear some of him remembered the fight against an immaterial being, so he was going to fight without thinking and let the records within his own body guide him. But deep down, he wasn’t sure he won that fight last time…

YOU CRAFTY PIECE OF SCUM!!!

Exclaimed a demonic voice both familiar and menacing.

Shadow and Silver turned to the source. It was an amorphous cloud of darkness. Nothing about it looked alive.

Did you really think you had a chance against me? You might have forced me out then, but you still cannot touch me!

The black mass taunted.

Shadow wanted to test that.

He rushed towards the black mass and tried to slam himself down on it. Unfortunately, it was about as effective as trying to grab onto a puff of smoke like it were a piece of cloth. The black mass simply spiralled around him and brushed past him very gently.

I told you you’re wasting your time!

The amorphous smoke regrouped once again behind him and spiralled towards Silver. The mutant psychic tried to summon his psychokinesis to hold it in place once again. Unfortunately, his new beastly form disabled that power.

When you closed your eyes, the gateway to your mind opened. All that you did, Shadow, was buy my Children more time!

It latched back onto Silver once again. The scream Silver let out when it did so rattled Shadow violently. It was a blood-curdling scream of both intense fear, and absolute agony.

“They say that idle hands are the devil’s playthings. But there is something far, far worse.” Not-Silver taunted. “An idle mind is the devil’s playhouse! A stage for the most vapid, horrible, and destructive stories to be made real! You can try to force me out again, but it will mean nothing! I entered his mind once, and there will always be that backdoor for me to come back again, and again, and again. But… I might as well get to the point since we wasted so much time.”

With a raised clamp-hand, a sinister purple aura enveloped Shadow. Reality around him began to crumble and melt as he did.

“Why don’t we take a trip down memory lane?” Not-Silver explained as the landscapes around them twisted and changed into a peaceful landscape. It was a beautiful blue sky in the daylight. As Shadow looked at his own body, he saw he was his old hedgehog self once more.

“Remember this?” Not-Silver continued. As Shadow looked towards the possessed psychic, he saw a more distorted version of Silver. This one still had the green eyes and red sclera staring at him, but the body looked like it was made of purple and blue rock with pieces missing like chips taken off his quills and hands and feet being non-existent. It only looked like Silver in shape only if barely that.

Shadow looked around. It felt very familiar. He saw a café nearby, and he was making his way to it.

“This was when your life began to turn around.” Not-Silver continued. “This was when Eggman was defeated once and for all. This was the moment that sealed your fate.”

Shadow looked towards the distant memory. He saw a familiar figure at the table with him. She ordered a drink, he ordered a small cup of just the coffee beans. It was when he first encountered Amy again after many years.

“There was more to that promise you made than just fighting bad guys, wasn’t there?” She asked him, rhetorically.

“Yes… I also promised her I would give humanity a chance to be happy. But with Eggman gone for good and no new villains to fight on the horizon anytime soon… It’s like I’m just biding my time for a day I don’t know will happen.” His past-self answered. “It’s been a while since the last real mission that wasn’t garden-variety recon or war games. But in that time… I’ve been thinking. I was created to be the Ultimate Lifeform, yet I spent a good chunk of my existence as a living weapon and not much else. I spent so much time fighting, that I don’t know how to best fulfil that promise I made to her. I know I was made to be more than just a bio-weapon, but now I… I don’t know…”

“So… You feel like you lost your purpose?” Amy asked.

“Yes… I felt like I lost my purpose for a while…” Shadow muttered to himself as the memories finally began to replay clearly for the first time in over 180 years. “I was still good at my job… but with so many garden-variety recon missions… it felt pointless sending me when anyone else could have also done the job. It was like…

“Yes… It’s like the only reason G.U.N. keeps me around is to keep me on a leash… But at the same time, I should be doing more. I can protect the world with my life, but doing that and only that… I feel… Incomplete…”

“Well… There’s more to saving the world than just fighting bad guys.” Amy tried to comfort him. “You weren’t made to just be a weapon. You were made to save lives. There’s more than one way to save a life.”

Shadow nodded.

“Someone from the Decryption Division decided to have me assessed. It was a simple enough test. I scored perfect… naturally. According to her, I was qualified enough to transfer to her team.” Shadow elaborated.

“What does that mean?” Amy inquired.

“Apparently my IQ is 200.” Shadow explained, though with an uncharacteristic uncertainty to his tone. “Nobody believed it, not even the Commander. They had me do several intelligence tests to make sure it wasn’t a fluke or a mistake in the system. Some tests scored slightly higher or lower, but the average result was 200. But… I don’t know if I should transfer… I guess… I don’t know what to do about my future and what I should do to better the world while things seem peaceful…”

“Then how about I read your future and we’ll see?” Amy offered, smiling and finishing her final sip of mocha and pulling out a small deck of cards.

“Yes… It was that conversation that made me decide to transfer to a different division…” Shadow realised, feeling an ache in his chest. He knew it only kept going downhill. “My future… It could only be interpreted as me walking in the footsteps of my creator and using science to better the world… But… I know I did something horribly wrong on that path…”

“Your memories are buried very, very deep.” Not-Silver explained, his voice changing to something that was more gentle and coaxing. “Let’s go down a little further…”

The scenery began to distort once again. Colours and sensations swirling by in a whirl of kaleidoscopic hues and feeling ranging from pain and pleasure and everything else in-between. Faint things could be made out, but barely resembled anything recognisable before they shifted like everchanging ripples across a mirroring pond. In the corners of the vision of his mind’s eye, was a swirl of darkness.

Anyone would be disoriented, but with the fragile psyche left of the Ultimate Lifeform’s mind, he was just about used to the feelings of confusion and dizziness.

They kept going deeper and deeper. Eventually, they stopped at a snapshot memory. He saw the layout of his old home. It was night time. The lamps were on, but not the main lights, giving the room a warm glow. He was in a comfortable chair, looking over towards two cribs. He remembered the dampness around his eyes. Those two children. Their names trickled back into his mind: Memoria and Venice.

He faintly recalled he wasn’t the one who named them. He couldn’t remember what was wrong with them, but in that moment, they were in a deep sleep, clearly exhausted from a massive ordeal. Memoria in question was covered in minor burns and cuts all over her body. She had been through enough, and he just wanted to let her sleep.

Shadow recalled the pain in his arms from muscular strain and his own exhaustion from stress and exertion, but he forgot the context as to why.

“Shadow… This isn’t normal…” Said another figure in the room. It was Amy. She looked dishevelled. Her quills were messy, she was missing her signature headband, and her dress was dirtied by smudges of soot. She looked exhausted and just finished a session of crying in the other room. Even though she looked composed through it all, it was extremely clear she was still very much in deep pain. “They vanished into thin air and the moment we find them again they were covered in wounds and burns… Are they going to be ok? They are going to grow out of this, right? I don’t want G.U.N. to get involved in figuring this out, because if we have no choice… If they find out where these two kids came from… I… Shadow… I don’t want them to get taken away! But… I hate how they seem to be in danger all the time and there’s nothing we can do to stop it! Shadow… Please… tell me! Are they going to be ok? Are we going to be ok? Your research…? What does it tell you about their condition? Please tell me!”

Shadow felt a deep ache within his chest and a confliction that was slowly tearing his mind apart. He knew things were actually extremely grim. Venice and Memoria were losing their stability within the timeline… Nothing was anchoring them in their proper place in time. They kept ‘flickering’ between the moments they knew, and another timeline that should no longer exist.

The memory trickled back like a slow poison.

Amy didn’t know where they kept going, but he did. He faintly remembered that old timeline. He knew what the place used to be called. It was called Crisis City. It was a world of flames and destruction when the flames of disaster, known as ‘Iblis’ was unleashed upon the world. He never told Amy the nightmares he occasionally had about that old timeline. He didn’t destroy the world, but he was made into the scapegoat for it. He was hunted down and eventually imprisoned for the rest of his days. He was betrayed by the very world he swore to protect.

He didn’t remember much else, but he knew that timeline shouldn’t exist anymore. Yet, for some reason… The two children… They were teleporting there and back… He couldn’t understand it. Yet he knew deep down that they were ending up in Crisis City. They were being attacked by the fiery Iblis Spawn that ravaged the landscape and turned it into a kingdom of ash and death.

Shadow was hard at work at trying to find a cure for them. He had no choice. He was working all-nighters trying to understand the exact scope as to what was happening and what can be done to fix it. He ran all sorts of simulations and learned what might occur if he couldn’t find a cure in time.

Venice and Memoria…. They were going to scatter across space and time and never be seen or heard from again. As good as dead, yet worse in every imaginable way.

He hated the concept of dishonesty. He promised Maria he would never lie. But… When he saw Amy in such a state, it felt like a knife had plunged itself into his heart repeatedly. He couldn’t tell her the truth on what was happening. Those children… Those were her children…

He couldn’t tell a mother that her own children were likely to suffer a fate worse than death and there was nothing she could do to stop it. It was bad enough he carried that burden in his own mind. As much as he wanted to believe he will find a cure for them… The intrusive thoughts of doubt haunted his waking hours.

He looked her in the eyes.

She couldn’t handle any more bad news.

He took in a deep breath

…and tried to steady the turmoil within

…he had to lie…

“They’ll be fine. They’re just mastering chaos control. It’s in their blood after all. I’m already trying to find a solution to this. I was thinking something like developing a set of inhibitor rings for them to steady their powers until they are old enough to master them. Unfortunately, I just need to gauge their energy signature first and get the correct measurements. That’s easier said than done. I have this under control. It’s just another week or so of worry before I can figure this out. They will be alright. I was made to be perfect… I exist to fulfil my promise to Maria… and you…”

He stood up and gave her a kiss on the forehead and a gentle hug. He made sure to keep his own fears under lock and key so she couldn’t detect them. He needed to be as convincing as possible.

Amy let herself loosen up a little in his embrace, but her worried expression eased up only slightly.

“I’m just… I’m so sick of this… I shouldn’t have to worry about the kids teleporting off to nowhere and trying to keep them away from G.U.N.’s radar. I just want them to be kids. I want them to live a normal life. Do whatever it takes… Just please… Make my kids normal kids again! Please!” She cried into his chest fur. He tried to gently stroke her head to comfort her. It didn’t do that much. “I love them so much… Please, Shadow… Help them!”

The earnest pleading in her voice. It took him back to those times on the Space Colony ARK during the raid. Those dark days that were forever burned into his mind so vividly that he would not forget those events, even if time itself did. As much as he didn’t want to lie… He couldn’t break her heart. He pushed those fears and sadness deeper and deeper into himself to make sure she could never pick up on it. She was already dealing with enough. He had to be strong for her. He had to protect what little innocence she had left.

“I will… This nightmare won’t last much longer…” Shadow continued lying, his tongue struggling to comply with the brutal dishonesty.

He tried to remember what happened next, but the dark borders of his vision grew and snuffed it all out again. Shadow felt a very real pain in his chest, he knew he was being forced deeper and deeper into what he could only understand as the root of such agony. He wouldn’t be able to tell if something was attacking his physical body. It was bad enough he was lying to a distressed mother, someone he deeply cared about no less. He could only dread what happened next after that.

All he could do was try to keep himself together in the all-consuming darkness that snuffed out the painful memories. It didn’t take the pain away. It only made him forget it was there.

“You made a promise you couldn’t fulfil. You lied to her.” Not-Silver taunted him, his once coaxing voice now mixed with a menacing combination of animosity and glee. “As painful as the truth is, it would have been preferrable to the cruel false hope you decided to deal her. This is only the tip of the iceberg of your sins, and you are already trying to suppress them. For the Ultimate Lifeform, you really are pathetic in how you handle the pains of your own past. Why don’t we go a little deeper and find the root of how you ended up here, and why you deserve every bit of suffering you have now…”

The darkness swirled around him further and further as he felt himself forced deeper and deeper.

“Where are my kids?” Amy pleaded, her voice cracking from a lengthy breakdown of crying and screaming. “WHERE ARE MY KIDS?!”

Shadow was caught off-guard at how quickly he found himself in a room full of angry people interrogating him.

“I saw you run off with them that night… What did you do? Where are they? What happened?” Amy continued to plead.

Shadow just stayed silent. He knew he did something terrible. He did something truly appalling. He knew he had to confess, but didn’t want to see her reaction when she learned the truth.

The two children he was trying to cure… were gone… He didn’t know where they were, but nobody would ever find them again.

He failed…

The weight on his chest pressed even harder. The weight of the guilt threatened to crush him as he struggled to get in every breath But… He stayed silent.

“Shadow… We’ve worked together for a long time… I know you don’t want to tell her the truth, but can you at least give us closure to what happened?” Asked Rouge, rather concerned. The tone of the voice said it all. It was the voice of someone who didn’t have faith in him anymore. His co-worker who had stuck by him and trusted him when he wouldn’t have trusted himself, didn’t know what to believe anymore.

He continued to say nothing.

Many more people questioned him. He was pressed for answers. He was beaten, starved, and tortured in a variety of ways for interrogation, yet he still said nothing about what happened. He didn’t give them any closure. He never showed them the horrible truth.

“Why did I stay silent?” Shadow asked as the memories replayed. “I know I am guilty of something… but… Was what happened so bad I had to take it to the grave? What did I do?”

“I can show you your crime…” Not-Silver answered. “But let’s see your punishment…”

The scenery changed once again, this time to being restrained and placed into a machine. He remembered doing the research that led to the development of the device back in his scientist days and felt betrayal pulse through his very blood. It was called a ‘Chaos Syphon’.

It was his punishment. Since he went to such extremes to cover up an atrocity, G.U.N. decided to seal him away for a fixed sentence. It was about 80 years he was meant to serve that sentence, or until war was declared and he would be needed again.

They didn’t trust him to not escape or have someone attempt to break him out. So… They were going to take his powers away. The pod he was going to be sealed away in was a life support system. His own research concluded that if he ever had his chaos energy reserved sapped away from him, he would be too weak to even be able to stand under his own strength. Granted, it was only theories on paper, but it was the most logical conclusion that he could calculate.

He was strapped inside the machine like a death row inmate awaiting the electric chair.

“Any last words before you are placed into stasis?” Asked the operator.

Like everything else, he just stayed quiet. He didn’t even look anyone in the eyes. Amy, Rouge, and Omega were watching it all happen behind a one-way mirror. All he saw was the beaten and burnt-out look in his own eyes staring back. Part of him hoped it was death waiting for him. Unfortunately to the world he once fought to protect, he was too dangerous to keep alive, but was too valuable to let die.

“Even when you had the chance to clear your conscience, you said nothing. Even then, you couldn’t live with what you did.” Not-Silver continued to torment.

The operator flicked the switch and Shadow let out screams that could only be described as monstrous. It was eerily similar to various children of the Black Arms that he was related to. But nobody could blame him. The process of syphoning off his own power was inefficient and agonising. It was like he was both set on fire and frozen to the bone while thousands of needles pierced every single part of his body all at once.

In that moment, he knew it didn’t matter if the process killed him or not, he was already in hell, and he deserved it.

He saw a display of his power level hanging in the corner slowly tick down.

85%...

84%...

83%...

He struggled to breath in-between his vocal cords tearing apart. He wanted the nightmare to end. Yet the counter ticked by ever slowly.

65%...

64%...

63%...

He wanted his body to give out and black out, but it was too resilient to lose consciousness.

43%...

42%...

41%...

Deep down… There was no way to turn back and undo what had happened. His fate was sealed.

13%...

12%...

11%...

He just let it keep ticking as the pain never stopped.

4%...

3%...

2%...

It stabilised at 1%. Just enough to keep him alive and conscious, the final percent was going to be stolen from him when he was placed in stasis so he wouldn’t die on transport.

It was over. He felt heavy, and he felt helpless. The pain might have faded, but all he could do was wait. If war never happened, when he woke up again, his closest friends would have died of old age and only known him as the Ultimate Lifeform and scientist who let two children suffer a fate worse than death and never gave them closure.

“Wasn’t that lovely?” Not-Silver taunted. “Before I show you your crimes, I feel like we should replay that once again before we continue! It’s what you deserve… maybe even more!”

The scenery shifted once again to being strapped down and awaiting a looped agony.

STOP!

Called out an unfamiliar voice.

In the corner of his eyes, Shadow saw a hedgehog break into the room and rush towards Shadow with extreme speed.

“This is revisionist history!” The girl continued, pulling Shadow off his bindings and rushing him out the door she initially burst through.

“You… You wretched abomination!” Not-Silver cried out with the voice of a demon.

“What… Who are you?” Shadow asked his unexpected saviour.

“That doesn’t matter now! He isn’t telling you the complete story! You are NOT guilty!”

Further and further up, she pulled him through the pains of the past and back to the present day bit by bit. It was like he was submerged in deep dark sediment and she was pulling him back to the surface to breathe once again. 

Shadow got a decent glimpse of the hedgehog girl. Indigo with pink stripes. It was familiar.
However, it was the voice that rang a few bells. It was a deep, feminine voice. He knew he heard it before. As he saw the shape of her head and she held his hand and continued pulling him up and back to reality, it finally hit him.
The girl before him, was one of the silhouettes he would see in his dreams. This was the one who couldn’t help him before.

“Thank you…” He called out to her as things began to feel fuzzy for a moment as he snapped back to reality.

Shadow took in a deep breath, as he found himself in Soleanna forest as a monster once again.

In front of him, a familiar starfish-like creature staring at him. It looked like Doom’s Eye… But something was different. There were only 5 points to it, and the eye didn’t have a slitted pupil like Doom had. It was definitely from the Black Arms in some way, but it wasn’t Doom.

“Did… You do that?” Shadow asked.

The eye didn’t bother answering. It moved erratically, trying to get his attention. It hovered around the luggage, specifically the chest that once contained his old diaries.

The eye began circling around another artifact in question. It was the silver bracelet with the green gem.

“You… You Wretch!” Not-Silver screamed as a bolt of dark energy zapped it out of existence once again.

Shadow didn’t quite understand the message, but he knew that piece of jewellery was key to fixing his current situation. With his body freed of any invisible aggressors once again, he bolted for the treasure. Not-Silver wasn’t happy.

“You really think you are doing something?” He taunted. “Look around you. Do you hear anything? Notice how much brighter everything is becoming?”

Shadow’s heart dropped in dread.

The sky… It was getting brighter.

He heard multiple footsteps in the distance.

The entity did what it sought to do, it wasted his time to be ambushed and captured.

The mutant psychic grunted in pain for a moment.

“Shadow…. You need to get out of here! They’ll get us both!” Silver called out to him. “You’ve got to leave while you still can… And… Tell Freesia I’m sorry…”

Shadow didn’t want to run away. It was his mess that he needed to fix.

“Tell her yourself!” Shadow snapped back.

With one lengthy and lanky arm, he grabbed the bracelet. Then came the tricky part. He didn’t know what he was supposed to do with it. He just had to take a guess and hope for the best that placing it on Silver was enough.

He had no other plan. He just ran towards him and hoped to be too quick for the entity to summon another psychic creature against him. He didn’t have much strength left after that scuffle, but he had enough to spare for one final gambit.

‘I… I couldn’t save Venice or Memoria… But I can still save Silver! I can’t fail now!’

With a powerful tackle, he pinned the possessed hedgehog to the ground and, using his spare hands, wrestled against Silver’s hands to place the bracelet around his wrist.

Not-Silver was snarling and hissing at him as he struggled out of the grip.

Shadow had one last push of power left to blast Silver with dark energy and force the entity out once again.

AAAAAAUUUUUUGGGGGGGHHHHH!!!

The entity screamed at him. It was hard to tell where the being ended and Silver began in such a pained shriek. But as soon as he managed, he pushed the bracelet over Silver’s hand. As soon as it went past the palm of his left hand and sat awkwardly next to his tarnished cuff… It was like the heavy presence was finally banished. Shadow was blasted with a pulse of bright green energy that pushed him off and sapped the very last spark of energy he had.

Silver’s third eye opened once again and he regained his senses.

Unfortunately, the sun had finally risen across the sky. Silver reverted back to his regular hedgehog self in a flash of light, and Shadow was spent off all his strength to move as the sun pinned him to the earth once again.

He might have finally freed Silver from his possession, but that freedom wasn’t going to last.

The Children of Faust had caught up.

“Shadow…?” Silver asked, too exhausted and hurt to move. “What happened?”

Shadow’s consciousness was slipping away every passing second. Nothing played out like he wanted it to. He tried to free Silver, but he failed. It was already too late. Power inhibiting collars were placed on both of them and it wouldn’t be long before they would be taken away.

Only two words could truly explain the situation to Silver. Only two words could summarise everything wrong that he faced since that day that changed his fate. Only two words could capture it all. From trying to save Memoria and Venice… To trying to face his past once again… Even when trying to save Silver from a malignant force before they got captured. Only two words could describe it all.

“I… Failed…”

Chapter Text

Chapter 22 - The Darkest Dawn

The longest night that Shadow, Silver, and even Freesia had faced in their lives, a night that broken them down and destroyed their spirit, was finally over. However, the damage was still done and there were so many more things that needed to be mended again. As much as the rising sun would have given hope any other day, for the three of them… It only brought to light how bad things truly were.

“So… that’s what happened to Agent Shadow after all this time?” Madonna asked, trudging her way through Soleanna Forest.

They left at daylight, but it was mid-morning when they made their way through the dense flora. The sunlight peacefully beamed through the trees. While Freesia recovered very well after resting, she still wasn’t at her full strength yet. It worked out well enough since Madonna, as a human, was incapable of running at the same speeds as a mobian.

“Yeah… I haven’t quite figured it out yet myself, but I think what we need to do is help him remember. I have a theory on how we can do this too after… what happened…” Freesia continued.

“Are you still blaming yourself about that kid?” The human asked.

“It’s just… He’s right…” Freesia answered, with a sad tone to her voice.

Even though their partnership was based on a common goal rather than anything else, Freesia felt herself stabilising a little bit with someone else besides her. Even if Shadow and Silver turned against her when the truth came out about her biggest regrets, at least she wasn’t completely alone. It also helped that Madonna had a stun gun in case Silver ever went berserk or if they ever got attacked. It just shot a small charge of electricity that temporarily stunned a target without doing anything permanent. It was like Freesia’s Chaos Stun attack, but with greater range.

While she was scared to come back after disappearing and causing such a scene, she knew she had to power through and return.

‘I… I haven’t managed to get this far by letting fear get to me…’ She tried to assure herself. She hugged herself a little as she kept powering forward.

‘I’m glad I could freshen up a little at the Neo Chaotix office though. I feel like I managed to wash some of the previous night off my mind. I can leave it behind me now. I have to keep moving forward. Today is all I have!’

“He read your mind and saw things he wasn’t supposed to see.” Madonna broke her train of thought for a moment. “From what you told me, it sounds like he went right for the jugular too.”

“I… Yeah…” Freesia mumbled a little in response. “I just… I couldn’t believe he would do that… After everything we went through the past couple days… He… He was my hero…”

“Unfortunately, there’s a wise saying that might apply here. ‘Don’t meet your heroes’.” The woman continued. “If this kid has any decency, the first thing he says to you better be an apology. Otherwise, I might shoot him for what he did.”

“You don’t have to go that far!” The green hedgehog exclaimed. “Yeah… what he did hurt but… We don’t have to kill him over it!”

“Who said anything about killing him?” Madonna clarified. “I meant shoot him with the stun gun a few times.”

“Still…” Freesia argued back. “I… I don’t know… I just… I just want to know what happened to him… Madonna, I know this is going to be a little rocky, but I’ll be honest… I don’t know what I am supposed to do anymore… I wanted to solve this mystery, and for the most part minus a few final puzzle pieces, I have. But… I don’t know how to untangle this web I found myself in. I know even if I never met Silver, I would have gone to the Space Colony ARK at some point… And I think without him with me… I… I could have died up there… Or at least ended up infected like Silver did. I know Dark Gaia energy is corruptive to one’s personality and mind… I don’t wanna know how badly it was poisoning the both of them… Maybe what happened last night wasn’t entirely his fault. It wouldn’t be right to punish him if he had no control over his actions.”

“Even if he wasn’t completely in control of himself, it doesn’t change what he did.” Madonna argued back. “Besides… Sonic was once infected with that same energy and he only changed on the outside, remaining that same beautiful heart deep down no matter what. I bet if he were here right now, he would have dragged that kid across town by his quills if he found out what he did to you.”

“But… What if he’s sorry?” Freesia argued back. “It doesn’t sound like Silver to try and willingly hurt someone like that. If my research about him is anything accurate, he’s usually not very good at even basic trash talking. I don’t believe he would ever be so cruel on his own, and if he was even remotely aware of what he did, I know he would be sorry for it.”

“He better say sorry or he will be sorry!” Madonna argued back. “But we can figure this out when we find him again. Do you have an idea of what we need to do next at this point? Any leads?”

“I have leads, but no idea how to actually get there.” The green hedgehog answered. “There’re a few problems that need a solution and a few more pieces of information we need to truly understand this whole conspiracy that’s been going on for over 180 years.
1. We need to find a chaos emerald or something filled with chaos energy. Shadow lost his powers somehow and we need to figure out how to at least partially restore it. I think if we can find a way to inject chaos energy into his body again, it might help.
2. We need to figure out a way we can cure Shadow and Silver of this Dark Gaia infection
3. We need to help Shadow recover his memories if possible, since what happened 180 years ago is still shrouded in darkness.
4. We… We… we need to find the ones we lost… I need to find my mother…. And my father… and you need to find Sonic.”

Madonna nodded solemnly.

“We will find them. We’ve already got a lead.” Madonna assured her. “But for now… I think I should talk to them at camp. How much further away are we?”

“Not much further…” Freesia assured her. “At least I hope so, I could definitely use a rest…”

“Yeah.” The woman nodded. “From what they told me, the venom of that Komodo dragon hasn’t quite worn off yet. So, it would probably be a good idea to rest up when you can.”

Freesia nodded. It was an exhausting night and even the walk through the forest was sapping the little strength she had. Her legs wanted to give up and buckle beneath her and collapse among the damp roots of the trees. But… She had to keep pushing herself to keep going.

It wouldn’t be too long before they reached the camp anyway and she could relax a little again.

But that’s when she got a bad feeling.

She realised things were quiet…

Too quiet…

She felt her heart thumping in her chest as an unmistakable feeling of dread struck her with the force of a professional with a baseball bat. She already started to breathe heavily as her hands began to shake.

“Are you alright?” Madonna asked, noticing her change in condition. “Did you need to sit down for a moment.”

“No…” Freesia choked out. “I need to get to the camp now.”

Using the last of her strength, she ran as fast as she could. Her legs felt like they were made of stone and each step felt more tiring than the last, but she kept moving. Madonna keeping up with her close behind, ready to try and catch her if she fell.

That’s when Freesia saw a stray piece of clothing that she packed up hanging on a branch. Her heart sunk.

In the clearing… Was her luggage scattered around… and Shadow and Silver were nowhere to be found anywhere.

“Where are they?” Madonna asked.

Freesia didn’t answer. She noticed something glinting on the ground. It looked golden like a ring.

She slowly stepped towards it, hesitantly. She knew deep down what it was… But she really really hoped it was something else.

It couldn’t be…

Surely the camp was safe…

She found it herself…

But when she got close enough to check the glinting object… Any hope or delusion was extinguished.

“No…” She gasped. “I shouldn’t have run away… I… I shouldn’t have left them behind…”

There was no doubt about what happened while she was gone.

It was unmistakable.

A little golden sun laid on the ground…

A little symbol of despair…

Freesia fell to her knees, weakened, afraid and feeling completely lost.

Madonna placed her hand on the hedgehog’s head and gently patted her a little.

“We’ll get them back, Freesia.” The military woman assured her. “At least we know who took them… The Neo Chaotix has managed to find intel on some of their base locations… We have a lead… Try not to lose hope…”

As much as she wanted to cry… She took in a deep breath. She couldn’t’ afford to lose hope yet. Especially not when she was still needed.

Even though things seem bleak, it wasn’t the end just yet.

While the false sun by her feet reflected despair, the real sun continued to shine hope on their path.

This was far from over.

Chapter Text

Chapter 23 - Sealed Away Hedgehogs

When Silver woke up, he already felt extremely drained.

Things were dark. He could barely see a thing. He almost thought he went blind if it weren’t for the faint glow of the patterns on Shadow’s mutated quills in front of him. He felt something hard and heavy over his arms and legs. Upon trying to feel them, he noticed a chain attached to them. While he was on the ground, he was chained to a wall.

He tried to remember what happened. It took a little while.

He remembered Freesia’s house got raided… He remembered collapsing to the ground… And that’s when things got a little fuzzy. He remembered writhing in pain. He remembered some kind of monster rampaged on the Children of Faust… and he felt responsible for that for some reason.

He remembered… Hearing a voice in his head…

‘Yeah…’ Silver thought to himself. ‘There was a voice… It was telling me to do things… I could… read minds? Then it was something about Freesia… Freesia… Where is she? I did something to her… What happened? What did I do…?’

He felt the guilt intensify and grow in his chest, threatening to crush him inside.

He tried to remember after that but… It was too hazy… The more he tried to remember, the more the events eluded him. But somehow deep down he felt like he deserved what he had been given.

“You’re awake, huh?” Shadow asked.

“Where are we?” Silver asked. “What happened last night?”

“Don’t you remember what happened? What you did? How you acted?” Shadow replied, agitated.

“It’s… pretty hazy… But I know I did something bad…” He replied, ashamed. “It… It felt like a nightmare… I only remember bits and pieces.”

Shadow shook his head.

“That’s been my curse for almost two centuries.” The mutant replied. “But as for what happened… I hate to tell you this… But you’re infected with the same curse, except it only triggers at nightfall.”

“So… I… I became a monster last night?” Silver gasped in horror. “What did I do?”

“You managed to fight off the raid last night. I don’t know how.” Shadow continued. “It was like you managed to create an invisible beast that thrashed them around. That’s how we managed to escape. We made it to a camp site Freesia had plotted in the event her house got raided and we were safe for the time being. Then out of nowhere you started shouting at her. You kept going on about how she betrayed her mother and how she was the reason everything happened. You seemed to have read her mind and brought up her worst memory. You wouldn’t stop. I threw you in the river but it was too late. I saw it… You broke her heart. She ran off crying. I went after her to try and bring her back… And she got taken in by a group called the Neo Chaotix. By the time I got back… You got possessed. The God of the Children of Faust used you to get to me, and we both got captured. She’s probably managed to get back to camp about now… And realising we aren’t there.”

“This… This is my fault…” Silver hung his head low. “And… I broke her heart…”

“Yes.” Shadow confirmed, nodding. “But it wasn’t all you. Part of this… was also me. I… I was the one who infected you. I left you alone when you weren’t yourself… And I failed to break his hold over you before we got captured.”

“I guess… A lot of mistakes were made.” Silver nodded. “But wait… So, I got infected by that purple gas stuff you sprayed on me?”

Shadow nodded.

“Oh yeah. That reminds me.” Silver remembered something he forgot to ask. “What was that paralysis gas before that? Do you know why Freesia and I weren’t affected? You hit me with that stuff point blank and I could still move.”

“It’s a nerve agent the Black Arms used when they invaded other worlds. It reacts with atmospheric gases when their Black Comet sets down on the surface of a planet. It rapidly paralyses anyone who breathes it in.” Shadow explained. “I don’t know why I have the ability to exhale it specifically, but very few are immune. Robots, anyone with breathing protection equipment, or… Anyone who is also Black Arm… At the very least partially. I don’t remember those times too well… But I faintly remember the invasion long ago. I was the only one who could stop it. Everyone was paralysed and if I didn’t act quickly… Would have been eaten alive. As for you and Freesia… I have no idea why you weren’t affected.”

“I… I guess it’s a mystery.” Silver replied. “I wonder how we are going to get out of here… Where are we anyways?”

“Your guess is as good as mine.” Shadow answered. “But one thing is for sure. We’re prisoners of the Children of Faust.”

Upon learning such information, Silver tried to activate his powers to break the chains, but as soon as he tried, he felt something restraining him. He could feel his power was still there, but couldn’t tap into it.

“They placed power-inhibiting collars on us.” Shadow answered before Silver could ask. “There’s no breaking out this way.”

“Then… What can we do?” Silver asked.

“I don’t know.” The mutant Ultimate Lifeform replied. “But I have a feeling we don’t have too long to figure something out before they do something to us. We’re captured now, but they may be preparing for something more sinister. The last time I was captured by them… I was banished to the ARK for over 180 years… And then they tried to finish the job...”

While Silver was not the type to give up so easily, he felt defeated. He didn’t want to give up hope, but at the same time, he couldn’t think of anything that could work. So… Until he had any ideas, all he could really do was talk.

“Do you think she’ll try to rescue us?” He asked. “Even… After what happened?”

“I wouldn’t count on it.” Shadow replied. “But I know if she knew where we are, she would try to stage a breakout for us. But that is no guarantee. We don’t even know where we are, and she may not know either. Who knows, we might even be trapped here as bait to lure her out and capture her too. The thing is… if she really wants to know what happened all those years ago… She still needs me to try and remember that. Though… Speaking of… I have a favour to ask of you.”

“What?” Silver raised an eyebrow.

“You gained the power to read minds when you transformed.” Shadow explained. “Despite how you used it, there is something very useful in that. When the God of Faust possessed you… You ready my mind. You dredged up old memories I thought may have been lost forever. Perhaps… That power might be key in helping me remember what happened by bypassing whatever is suppressing my past. So… I need you to read my mind at nightfall! Can you do that?”

“I… I don’t know.” Silver answered, honestly. “I don’t even think I was fully myself last night. I… I hurt Freesia so badly last night… I don’t even know if she can forgive me. I can barely forgive me for what happened. What if I make things even worse for you?”

“That is a risk I am willing to take. I have already hit bedrock years ago. I am out of options. I need you to be able to do this. At the very least, do this for her! Even if she never forgives you, the least you can do is help her put this mystery to rest and make sure all her sacrifices weren’t for nothing! You want to be her hero again? Then start acting like one!”

“I don’t even know if I was a hero to begin with…” Silver replied. “When you left me alone for a while, even if it’s all a little fuzzy, I remember a voice talking to me. It was telling me that I always kept messing things up, making things worse, and I can’t even tell if someone is good or bad. The worst part… It was right…”

“You know what you can do about it? Learn!” Shadow snapped back. “Nobody has a past that doesn’t have mistakes. The difference is whether you choose to keep making the same mistakes, or whether you can accept them and do everything in your power to not repeat them. Things are not in our favour. The last thing we want to do is make it easier for them to win!”  

It felt weird hearing Shadow giving him the pep-talk, especially after everything that happened to him, but Silver nodded. He had a point. Even if things seemed hopeless, that was not a reason to give up! He had to figure out a way to break them both out of there and soon, hopefully before nightfall in case he lost himself again.  

‘If there is a chance I can make things right… I will take it!’ He proclaimed to himself. 'At least... To right the wrongs I made...'

He started pulling and tugging at the chains that kept him to the wall. He tried using his powers despite the inhibitor placed on him. He was willing to try anything and everything possible!

“I won’t give up!” He proclaimed. “This all depends on me! I can’t lose!”

Silver continued to wrestle against his restraints, pulling at his inhibitor and searching the cell for anything he could use to help aid his attempts. Even if he wasn’t going to be successful, he wasn’t about to stop trying.

Even though it was too dark to see, Shadow smiled at the sight. His own eyes were accustomed to the darkness and he could see everything clearly. There was always that tenacity in Silver’s eyes to keep fighting, even if it feels like a battle that may never end. Even if it was an eternal struggle, he never gave up.

It reminded of a few moments before he became a monster. He faintly remembered he was a hero once. He never gave up until he won every battle, no matter what it was…

For the first time in over 180 years, he felt pride within him.

Shadow joined him in his attempts, wrestling against his own restraints. He was so close to learning about what happened. He couldn’t afford to give up either. He may have failed the previous night, but he wasn’t about to give up yet!

“That’s the Silver we need right now…” He mumbled to himself. “That’s the hero she needs…”

Chapter Text

Chapter 24 - The Calm Before The Night

“To think… To think I was already here a few days ago…” Freesia whispered to the human next to her. "To think they were right on top of me this whole time..."

“You have the Neo Chaotix to thank for narrowing down where they got taken to.” Madonna whispered back.

They were just out of sight of the security cameras behind a few pieces of ruins of Kingdom Valley. The afternoon sun turned the surface of the water into a bright orange. Before them was a hidden entranceway that would have led to Aquatic Base over 200 years ago.

“We… We only have one shot at this…” The green hedgehog braced herself. “They’ll likely be moved elsewhere before long if they’re lucky. We can't afford to wait too much longer. It's now or never.”

Freesia took in a deep breath, before shuddering a little.

“Madonna… I’m going to be honest right now, I am terrified.” She commented, losing her composure. “I have a feeling that whatever the Children of Faust are up to… They’re almost completed their goal.”

“We must not fear, Freesia.” Madonna commented. “Fear is the mind-killer. The moment we panic or let our fears and insecurities get to us, we’ve already lost. We have to approach this carefully but the moment we get inside, we can’t afford to look back. So… Do we have a plan?”

Freesia took in a deep breath to steady herself again, before nodding.

“I have a rough idea where they might be held.” She explained, pulling out a stick to draw in the dirt below them. “I just about mapped out a lot of the facilities looking for remnants of Dr. Sow-! I mean, Doctor Shadow. So, I know where to not look at least.”

She sketched a rough draft of the entrance to the base before them, and a few tunnels.

“I don’t know the exact layout, but I think I have pieced together what roughly happened with Shadow. He mentioned last night that he woke up in a basement of sorts when he turned into a monster. So, I suspect they’re both going to be held underground. So... After we get inside, we just need to find a way to go down until we find something.”

She began to doodle a few other rooms and passageways.

“Now, I haven’t mapped out this particular area of Aquatic Base, but that doesn't mean we'll be completely blind. I have managed to research the layout of these labs a little bit from back when they were active. Don't ask me how I got said information, it was never declassified to the public... I have no idea how accurate they were or if they were completely outdated but it's better than nothing... I know there would likely be a generator we would need to take out to disable security systems. The generator would likely be a couple levels down for this particular section of the old labs. Now regarding getting there I think... I... If there’s one thing I’ve always found scary about the Children of Faust… It’s the fact that anyone can be a member. Which means almost everyone we face will be ordinary people convinced they are doing something for the greater good. They use Wispons most of the time. So, what they believe is so engrained in them even wisps are convinced they are working towards bettering the world. But back to the topic at hand, we shouldn’t try to kill any of them. Most of the security we will face had nothing to do with Sonic disappearing or capturing my mother. So… Just use your stun gun on them.

“But… Here’s the plan. I will try to sneak in ahead and silently take down the guards. I have the ability to make myself invisible for some reason, so I should be capable of doing that. Once I get a way inside, I want you to follow me and cover me in case anyone sounds the alarm. I’ll see if I can follow any cables or wiring and I might be able to find the generator. We sabotage that and… We would probably stumble in the dark for a while, but a place like this would likely have an auxiliary for emergency evacuation lights. So, we use the chaos to our advantage!”

“… And use that moment everyone is trying to regain their bearings to escape, hopefully with Shadow and Silver in tow?” Madonna added. "Of course, after finding them and breaking them out of their imprisonment."

“Exactly!” Freesia nodded. “And we need to be quick about this too… It’s almost nightfall… And if Silver changes again tonight… I am a little afraid he may not be too cooperative.”

“We’ll just have to stun him and carry him out with us and hope to Gaia we don’t get captured.” The human nodded.

The hedgehog nodded in turn.

They both took in a deep breath, knowing that what came next was going to be intense, but they didn’t have many other options.

"This is it..." She whispered. "I am about to take down the guards. The moment I signal you over, you need to come in behind me. We can't afford to waste any more time. Ready?"

Madonna nodded. 

"At your signal. It's about time we start to reclaim what they took from us!"

Chapter Text

Chapter 25 - A Fortunate Turn of Events

Huff… Puff… Huff…

Despite several hours of efforts and trying seemingly literally everything he could think of, their restraints had no dent in them. The only thing worn down was Silver himself. While his stamina wasn’t the worst, even he had his limits as he pulled at his shackles to try and rip them off the walls, and tried again and again to use his powers against his inhibitor stuck around his neck.

“I… huff… I… huff… I’m done…” Silver groaned as he was pushed to his limits, collapsing to the cold hard floor. “I can’t do any more… I need to… take a rest…”

“You tried your best.” Shadow commented. “That’s all you can do.”

“Yeah… But it did nothing!” Silver snapped, angrily. “It all rested on me… and it did nothing! We… We lost… I failed… I couldn’t get us out of here. I couldn’t break this… stupid collar off me! And… I couldn’t make anything right!”

“That doesn’t mean all hope is lost.” Shadow replied, oddly calm and patient about the whole situation. “They kept us here, but they haven’t done anything more yet. We still have time. We may even be able to break free the moment they try to transport us elsewhere.”

“Shadow…” Silver interjected, annoyed. “I can barely move. I can’t fight back. It’s… It’s hopeless! It’s no use!”

While the exhausted psychic seemed to be right, there was one thing Shadow was watching for since the two of them woke up in that dark cell. He had one final idea how they could get out, but it was a massive gamble. The first step was biding his time and carefully watching Silver until then. 

That's when he finally saw it. 

Shadow could see in the darkness of the enclosure easily as if it were brightly lit. Silver’s eyes… Grew darker.

Not the glance of someone who has lost all hope or gave into despair. But his pupils looked blacker than black.

‘So, it begins… There was only one way we were truly going to get out of here…’ Shadow thought, the first stage of his plan finally rolling into place.

Sure enough, Silver shut his eyes and placed his hand to his head.

“I… I feel dizzy… I… I don’t feel so great…” He commented, his breathing becoming more laboured. “My… My hands are shaking… My eyes… Just opening them makes my head hurt… Am I falling through the floor?”

His body began to shiver and shake on the floor like he was close to freezing.

Silver tried to steady his breathing, but he gritted his teeth as pain flashed over him. His breathing became even heavier as his right hand began to shake violently.

“Shadow… It’s… It’s happening again… Isn’t it?” He gasped out, his voice quivering with fear.

Shadow simply nodded.

“Ha… Ha…” He gave a fake chuckle.

AAAAAAAAAAAAAUUUUGHHH!!!

He cried out as dark purple smoke enveloped him. Unlike the previous night, the transformation was much quicker. Just when he braced himself for even greater pain, it was already over. 

He stood back up, recoiling in horror that he couldn’t see the faint outline of the shackles or walls anymore. He could only see Shadow in front of him and nothing but a void of darkness everywhere else. 

“I… I’m this monster again…” He despaired to himself.

Something he feared deep down was realised ever since he saw what he looked like through Freesia's eyes. He truly was cursed to change at nightfall. 

“Try breaking your collar now.” Shadow suggested.

“If I couldn’t do it before, how can I do it now?!” Silver snapped. “Was that your plan? Waste my time until I became this hideous thing again?! Couldn’t handle being a monster alone while we both wait for our deaths?!”

“Before you continue, focus that anger on your collar or shackles again.” Shadow suggested again, his tone of voice remaining calm.

Silver growled, but obliged just to shut him up. His right hand once again transformed into a monstrous maw, he decided to clamp it down and hard on the collar around him.

Hrrrrrrr…

He gritted his teeth together as the teeth on his hand also bit into the metal all the harder. He could hear the collar itself straining.

Ghgrrrrrr…

He could hear the little mechanisms inside pop and snap inside the inhibitor.

Clang!

The device dropped to the floor. The ringing of it echoed through the prison cell for a few seconds afterwards.

As soon as it fell off him, he felt a surge of power rush through his body like a bolt of lightning. He knew there and then, he was at full power once more. 

“Now… Your shackles.” Shadow directed.

“Hmp…” Silver grunted, not wanting to prove Shadow right, but wanted to let off some steam against his bindings after wasting so many hours trying to break them before.

With a quick pull, they came off the walls, scattering rock fragments and dust in the progress.

“Now… Remove mine and we can get out of here.” Shadow commanded.

Silver growled a little, but went up to him. After getting his true power and potential back, he had to push his own grievances aside. They needed to escape and their window to do so finally arrived.

“So, this was your plan all along?” Silver hissed, breaking the collar off Shadow.

“Would you have agreed to it if I told you?” Shadow replied, breaking off his chains. “I couldn’t see any other options. Your new form is a curse, yes. But tonight, it is our blessing. It was our only ticket to escape! Now… Let’s use that ticket before it expires and get out of here!”

As much as he wanted to feel empowered and triumphant, the recently transformed hedgehog didn’t feel happy about the circumstances behind the small victory.

“I… I didn’t want to be this… thing again!” Silver snapped. “It’s hideous! It’s dangerous! It’s hard to control! And all it did was hurt people! Even her…”

“If you could do something like that to Freesia, imagine what you can do now to the people who hunted her and all of us down.” Shadow replied. “Think about how much you hurt her last night… Now imagine using that against someone who deserved it. Think about how much Memoria sacrificed against these people. Think about how much Freesia had to run away from and struggle to fight them off her whole life. Think about how much you could avenge her. How much you could avenge us. Tonight… If you want to be her hero, you have to be their monster!”

“… What if I lose control?” Silver asked, uncertain. “What if I get possessed again?”

“I won’t let that happen.” Shadow replied. “But don’t listen to that voice in your head telling you doubts if it comes back. But if that happens, I know how to force it out again. Besides… we fought to a stalemate once and I managed to knock sense into you before… I kicked it into you!”

Silver took in a breath, a little reassured that he wouldn’t be alone in his situation and the previous night wasn't about to repeat.

But something felt familiar… He didn’t remember fighting Shadow very often before, but he somehow knew exactly which incident Shadow was talking about before.

Just a faint image. The feeling of his metal shoes thumping the back of his head and lying on the floor, angry, humiliated, but not willing to give in yet!

“I won’t let anyone get in my way! I’ll change the past and save the world!”

“Mephiles isn’t trying to help you create a better future… He’s trying to eliminate the past.”

“What? What are you talking about?”

It felt surreal after everything that's happened… he was still slowly having memories of the other timeline trickling back. The mystery he was slowly unravelling ever since he came to this timeline still had many more twists and turns. Something about that memory… Perhaps it was the Dark Gaia energy currently flowing through his veins, but something about that memory felt painful. He felt like he wasn’t going to like the context of the full story when it’s all uncovered.

‘Mephiles…’ He thought. ‘That name…’

With one swipe, Shadow broke down the doors, disrupting Silver’s train of thought. Shortly after, the hallways flashed bright red and sirens started blaring all around. In the distance, many footsteps of several Children of Faust descended down various stairs towards them.

“They won’t let us leave easily.” Shadow commented, anticipating a long fight ahead. “Let’s not give them an easy fight!”

Silver nodded in agreement.

Shadow charged up dark energy projectiles, Silver focused his altered powers once more to snake his way towards the minds of his targets. He could look deep into their minds. Their plans. Their mistakes. Their traumas.

It didn’t take long for him to see what they were thinking. Every step they were making. Every decision of how they were going to attack.

So much potential without even needing to land a scratch on them…

“Here’s where it really begins.” Silver grinned sinisterly. “Might as well have some fun…”

Despite many ways he could go about the issue, he decided to go with his strongest card. He felt a psychic connection like an invisible thread being made among the crowd. He syphoned off their anger, fear, sadness and wrath like a long distance parasite. He felt it surge and build within his own body and pool steadily in his right hand.

Building…

Rising…

Intensifying…

After sensing the morale die in his aggressors after sapping their bloodlust, he unleashed all that stockpiled wrath. Much like the previous night, it manifested as a rampaging monster. This time it looked like a large serpent with a giant mouth and sharp teeth. It went straight to work and charged towards the first unfortunate human closest to them and slammed him down the halls with a powerful headbutt. The human was thrown into his allies behind him and knocked them down as well like a bizarre game of bowling. The invisible beast bellowed an audible roar that rattled the hallways, forcing the armed cult-members into retreat to preserve their lives.

“Certainly one way to clear a room… But it’s not over yet. We still need to find a way out of here!” Shadow commented.

“About that…” Silver commented. “Remember, I can’t see in this form. I can only see living beings. Everything else is invisible to me. You’re going to need to lead the way.”

Shadow nodded, before making his way forward, Silver following behind and the manifestation vanishing. Unlike the previous night, Silver didn’t get too fatigued or burnt out after the invisible creature disappeared.

“Danger will be lurking around every turn. But with some luck, I’m sure we can make it through. We don’t really have many other options.”

He braced himself for more serious conflict ahead and hoped his altered powers would cooperate with him. Part of him was almost giddy to use his powers more offensively, but another part of him was scared things would go wrong when he found new targets. There was only one way to find out what would happen next. At least he was sure he could put up a good fight.

“I don’t care what lies ahead.” Silver replied. “Whatever happens, I’ll take them all on!”

But... Since he was wandering essentially blind, he had to trust Shadow to help lead the both of them to an exit. He had to have faith Shadow could navigate for them. 

Something about such a leap of faith, was both scary and familiar to him. 

“Follow me if you want the truth…”

Chapter Text

Chapter 26 - Submerged Scurry 

Freesia enacted out her plan as relayed to Madonna.

So far so good.

She managed to get past the guard and knock him out before opening the door for Madonna to follow her. She regretted leaving her mallet behind the previous night, but she had to make do with everything else she was capable of.

As she tried to stay focused to keep her invisibility maintained, she charged up her fingers with a weak jolt of chaos power onto any camera she could find. Not enough to last, but enough to interfere with the video feed for Madonna to follow her behind without being detected too soon. They were both in enemy territory. The stealthier the better.

She noticed the power cables embedded into the wall, and hoped following them will lead to the generator.

‘To think… that night he followed me… when I discovered some of the last pieces of Sow-Had’s mystery… it was right above me that whole time…’ She thought to herself.

As she ran down a hallway, she found a door that opened to a large expanse, and a large metallic orb just floating above the edge. She remembered seeing that before. She didn’t know what it was last time, and she didn’t need to. Silver levitated the both of them across the gap without question.

‘But Silver isn’t here now…’ She grumbled to herself.

She knew that the ball was some kind of security system. Something too scary to want to attempt to pull off. She knew that it should in principle be possible to step on that sphere and walk on it as a means of moving around. Why else would it be there like a very bizarre vehicle?

Laser obstacles were around that path too. She suspected they were capable of popping the mirror bubble. Otherwise… why else would lasers exist?

They were almost zig-zagging left and right, forcing whoever was on the ball to move around in a sine-wave pattern through.

She knew she was on the right path when she saw it. Such a layout made access for most lower-level cult members basically impossible, unless they were very reckless.

Very scary to even think of attempting…

Her form shimmered for a moment as her focus faltered. She almost allowed herself to be seen again. But she kept it together for a moment, taking in a deep breath.

This time… Silver was not going to be there to catch her if she fell. Madonna was relying on her to keep the both of them going.

“Hey-hey-hey! You shouldn’t be here!” Shouted a Child of Faust.

Bzzzzzt!

Thud!

“I don’t want to stick around for some boring conversation.” Madonna commented as she caught up, her stun gun still warm. “Sorry. I can’t run as fast as a mobian and I got spotted.”

Freesia noticed Madonna was looking her way. Looking at her gloves, she realised her invisibility wore off.

“It was inevitable something was going to go wrong…” She commented. “Alright. We have to get across this gap. All we can use is one of these bubbles and walk and avoid the lasers. Good news at least, only one bubble can exist here at any moment. The moment we get on, we can’t be followed on foot. I can’t say the same thing for drones though. Bad news, we can’t both walk on that at the same time without falling off. Now… I have studied every conspiracy about this place for years… Not even I know what’s waiting for us at the bottom of that chasm.”

“Who do you suppose out of the two of us will go on ahead?” Madonna asked, occasionally checking over her shoulder. “We won’t have much time before reinforcements arrive.”

The human went up to the green hedgehog and picked her up in her hands. Freesia was taken aback to the ground no longer being under her feet as she did.

“I can carry you and walk on the ball if I have to.” Madonna reassured her. “You mother requested I try to help you any way I can.”

Freesia shook her head.

“Put me down. I have a better idea.” She commented.

“Quickly now, let me hear it!” Madonna commanded, hearing footsteps coming their way.

Without saying anything, Freesia went to scoop the human up in her own arms, holding her princess style.

“Out of the two of us, I have a better chance of carrying us on there.” She commented. “But… I will need your sharp eyes to fire at any drones they may send out way. Just because they can’t catch us on foot doesn’t mean they can’t send other things after us!”

Despite being taken by surprise, Madonna nodded firmly.

“Let’s do it then!”

Freesia nodded. With her human assistance gently cradled in her arms, she took and deep breath and braced herself for a deadly cross.

“There they are!” Snapped another Child, many others following behind. “Security Alert! Freesia is inside! Repeat! Freesia is inside!”

She jumped onto the ball and started running.

Her heart thumped hard in her chest, knowing that her impatience may get them killed as they rapidly approached a laser trap. He thought she could stop the ball if she stopped running, but all it did was slow down. The momentum was just as slippery as she was afraid it was going to be.

‘CRAP!’ She internally screamed.

Not knowing what else to do, she had to turn around on the spot and start running the opposite direction, looking directly at the Children on the edge as she did.

‘DAMN… Not here!’ She cursed on the inside further.

As the momentum rapidly decreased under opposite direction, she found herself looking dead on at their Wispons pointed her way.

“Madonna, I need you to stun them!” She commanded.

“They’re out of range!” Madonna replied.

“Damn it!” She cursed under her breath.

They were trapped. She could continue trying to manoeuvre along the laser path, but she was essentially a sitting duck, and they knew it. The gathering Children smiled a sinister grin with the information. They reading Indigo Wispons to try and snipe her from a distance!

As the pressure picked up, time almost slowed down for Freesia. She had only a second or two at best to decide what to do next. She had to figure out a path away from the laser traps while also being a target too difficult for them to hit. So, she had to move fast enough but also calculated enough. They pattern past the lasers was a sine-wave…

She ran the numbers in her head how that could be accomplished.

‘If this ball is bouncy… Then maybe I can… at the right angle…’

She had an idea but no time to second-guess it.

There was only one thing she could do. Only one technique could make such a plan possible. Something she never managed to accomplish before. Something she never believed she could ever be capable of doing.

She had to try. She had to seriously try. She looked back on every little sliver of research she ever did before. From every chaos technique, to every movement she was capable of…

Only one thing could save them…

One technique hedgehogs were capable of…

One thing hedgehogs were known for…

She felt bad about what she was about to do but there was no other way.

With a grunt and a lunge, she threw the human into the air…

Tucked her head between her legs, curling up as tight as possible…

That’s when everything slowed down…

Sriiiiiiiiii!

Charging up a spin, faster and faster on the spot, unable to see anything ahead of her, she kept building up energy.

Just a little more…

Just enough to get the job done…

Then she felt it in her gut. The time to let it go.

Just before Madonna was about to fall on her, Freesia uncurled on the spot, readying her legs to start running faster than ever before to keep up. With a thud, the human landed in her arms once more.

“Freesia, what are you doing?” Madonna gasped, her stoic expression breaking.

“Something extremely smart!” Freesia answered, not very convincingly.

With the charged up kinetic energy, they were both hurtling towards one of the walls, almost about to crash at high speed.

Blop!

In the blink of an eye, Freesia turned around, keeping up the momentum and speed as they ricochet off the wall and bounced at a peculiar angle away from the initial laser trap, too fast for the Children to lock on to her so easily as they did.

Then, she bounced off the other wall and back again. Just bouncing one side and another slowly inching forward across the chasm to the other side in a perfect zig zag around the lasers. Only slowing down slightly as she tried to gently correct her trajectory enough to avoid further laser traps.

A little to the left…

A little right…

She was out of range soon and only had to worry about the last few laser traps.

“Ugh! My head is spinning!” Freesia exclaimed as the adrenaline started to set in and she slowed herself down to focus on the final few obstacles in her way.

“You’re telling me…” Madonna agreed.

Soon, they reached the next edge. Freesia slowed down and jumped off with the human in tow.

The moment her feet were on solid ground again, she collapsed, catching her breath and taking a moment to process what just happened.

“I… I spin-dashed…” She gasped, unable to believe she wasn’t dead. “The very first time…”

“We can’t afford to celebrate now. We still need to keep going!” Madonna commanded.

The green hedgehog nodded, getting herself standing back up again, and powering through ahead.

“That was a gutsy move back there…” The woman commented. “As someone dear to me might say.”

“Heh… yeah… We shouldn’t be much further from the power. With obstacles like this, up ahead must be something they really want to keep safe-guarded.”

“And it should make things easier for those two to break out when we cut the power.” Madonna agreed. “We’re almost there. We’ll see them again in no time.”

“I hope so, Madonna…”

After a lengthy navigation through the inner layers under the sterile white light above the clean metallic walls, following the power cables, they eventually found one final door.

“If I had my hammer with me, I could have knocked this down…” The hedgehog complained. “So, we just need to figure something else out.”

She stood at the metal door, trying to think of anything she could do to bust it open. It would require a lot of force… She couldn’t punch it. She needed to hit it very hard somehow within her own capabilities.

She got an idea.

“Stand back.” Freesia commanded, charging herself up with chaos energy.

Madonna wasted no time getting a safe distance. She knew what the hedgehog was about to do. She’d seen it enough times from a fellow G.U.N Agent.

“Chaos… BLAST!”

KA-POW!

An explosive pulse of energy shot through her body, leaving a notable dent in the door. Unfortunately, not enough to blast it open, but enough to make a small gap in the frame. It wasn’t big enough to squeeze through though.

Unable to stand up after such an attack, Freesia collapsed to the ground.

“Madonna… could you… pry it open a little more…?” She gasped between heavy breathing as she tried to recover.

“I will do what I can.” She obliged.

Getting her hands into the gap, she pushed against the metal in towards the room.

She was slow and methodical, but eventually started making the gap widen bit by bit.

In the time it took for Freesia to regain enough strength to get back up, Madonna only made it a few inches wider.

“A human is only so strong…” She explained as the green hedgehog joined her.

“Good thing you’re not alone.” Freesia commented, pushing against the metal door further.

With combined effort, they managed to force an opening large enough for Freesia to crawl into.

“I’ll keep watch out here.” The woman assured her. “It probably won’t be long before they find another way to us somehow.”

Freesia nodded, and entered the room.

She breathed a sign of relief. It was the generator room!

The inside was bathing in an eerie red light that almost hurt her eyes to look at. There were all kinds of machines and settings she felt too scared to touch. But, she made her way to the core, looking for an emergency shut-off.

What she found was unexpected, but even better!

While she didn’t necessarily believe in luck, what she saw in the centre of the room, contained in glass tubes may be the biggest stroke of good luck she ever had in her life.

Inside it was… Two Chaos Emeralds!

Green… and Blue…

She blinked. She rubbed her eyes. She wasn’t seeing things.

They weren’t replicas like she was used to either. They glowed and pulsed with their own energy. She could sense the infinite power radiating through the glass.

There before her, was the real deal!

“A… Two Chaos Emeralds? Here of all places? You… You have to be kidding me.” She gasped in amazement. “This… This is like taking candy from a baby…”

She almost felt guilty about what she was going to do next. No guns. No security personnel ready to take her down. Nothing but a thin glass container. It was too easy.

“… Which is fine by me!”

With a single punch, she broke the glass and snatched the two gems, plunging the entire facility into darkness except for the glow of two of the most powerful objects in existence in her hands.

‘These Children don’t deserve candy anyhow!’ She reasoned to herself.

“You figured out how to shut down the power?” Madonna asked from outside.

“Even better!” Freesia cheered, giddy like she was a little kid who stumbled upon a giant sack of Halloween candy. “I found two trump cards!”

“Excellent. Now here comes the hard part… We now need to navigate this chaos in the dark and find them and get us all out of here before they can organise anything.” Madonna commented. “That… may be troublesome.”

Freesia beamed as she crawled through the gap again to reunite with the woman.

“I don’t think that will be a problem.” The hedgehog showed off the plundered treasures. “If these are anything like the replicas I was used to… we have the high ground now!”

The human woman was stunned, unable to speak.

“Was that… all the security they had for this?” She asked. “Why wasn’t there anything else guarding this place?”

“Good question.” Freesia answered. “Come to think of it… We got off light if this is one of their bases… No drones… and only a handful of Wispons before that gauntlet. Something doesn’t add up.”

She thought about it for a while.

There should have been extra security around the emeralds.

Either there was a reason why there were no extra guards, such as an emergency going on that meant all hands on deck… or there was a logical reason why no security would be needed.

Such as a system that only activates when the emeralds are removed…

An idea came to mind. A terrifying idea that made her excitement turn to dread instantly.

Freesia quickly went back through the gap into the power generator, looking for any sign to curb her fears.

Surely it was just that easy…

Surely there was no catch…

Then she saw it and her heart sank. Just below a panel where the emeralds were contained, was a timer counting down from 15 minutes…

“Madonna… We need to find them right now!” She shouted. “And we need to get out of here!”

“Freesia, what’s wrong? What did you find?” The human asked, picking up on the severity of the situation.

“There’s a reason security was light. They accounted for us doing this! We need to find them and get us all out of here before this base blows up with us in it!”

Chapter Text

To Be Their Monster

“The next thing you’re gonna say is that you will shoot, but you are secretly hoping not to because you haven’t even held a Wispon up until now. Yes, I do know that. Do you really want to test your marksmanship against a mind reader who knows where you are going to aim?”

The Cultist dropped their wispon, shaking, and quickly running away.

As soon as the would-be assailant was out of sight, Silver heaved a little in place. Though it wasn’t difficult for him to read minds of those near him, the bombardments of different thoughts and feelings as well as the absolutely invasive nature of it was making him nauseous.

What was worse about it all was… He was looking at some pretty intimate details of people he didn’t even know the names of. He saw all the different reasons why they became of the Children. It was disturbing, but also humanising. He missed fighting Eggman Robots or Phantom Ruby copies. At least he knew there was no trouble or dilemma in destroying them. But the Children? Even if led astray and causing harm, they were still at the end of the day, just ordinary people.

Not only that, but many of them were under the influence of their God.

And he saw first-hand how… influential… that being was.

“Let’s get moving!” Shadow ordered, snapping him out of his train of thought.

“R-right. Of course!” Silver replied, getting behind the mutant Ultimate Lifeform.

Silver followed Shadow as best he could. With no means to see his surroundings or avoid running into things, staying directly behind him was the best course of action he could take. Unfortunately, Shadow has very limited strength to spare in his current state. While he could lead, he was in no state to combat many opponents without risking collapsing altogether.

But, while Silver’s vision was limited, he was still able to see living beings around him. Even if they were on the other sides of walls. And unlike Shadow, even in only his second night still getting used to his monstrous form and corrupted abilities, he more than had plenty of strength to fight!

So, they had an unspoken deal. Shadow would lead the way and keep ahead, and Silver would deal with any foes they did face, minus any drones anyways. Since the mutant psychic couldn’t see robotic foes or machinery, Shadow dealt with them easily with a few dark energy projectiles.

The moment Silver saw enemies incoming, he would call out to Shadow to get behind him and take them down.

It was most efficient to use the mind-reading abilities to scare the nuisances away. Saves him from hurting them or risking them being killed, even if each time he did, he felt like a real monster.

But… Tonight he had to be a monster.

To be Freesia’s hero and helping Shadow escape and figure out the greater mystery at hand… He had to embrace that new identity. He used that power on Freesia and broke her heart, the least he could do to make amends was use that same power against the forces that ruined her life and likely was the reason for Shadow’s state of being.

It was at least good practice of what he could do with such powers as well. If he was going to be stuck turning into such a beast at night for a while, he may as well figure out his new body could do.

Or so he thought anyhow…

As he followed Shadow, following his lead over various obstacles and trying to navigate the confusing labyrinth and hopefully find the exit, they noticed something off about everything.

They leapt over a gap onto a platform that could take them to the other side. Or it would have if the power wasn’t out. The other side was also too far of a gap to jump over.

Any other time, Silver would have had little trouble getting them both across with his psychokinesis alone. But he didn’t have access to that, nor did he have time to wait until he would turn back to normal again. Unfortunately, Shadow’s abilities in his current state wouldn’t be of much help either.

He did have at least one trick up his sleeve to help them both out.

Silver used his monster-jaw hand and stretchable arm like a grappling hook to swing them over the gaps. The jaw clamped onto some sort of apparatus or pipes on the ceiling (not like he could exactly see what they were for himself), and with his other arm holding onto Shadow, swung them over to the other side of a large gap.

As soon as they landed safely, they decided to take a small break to note something that’s been silently bothering the both of them.

“They don’t seem to be sending anyone after us…” Shadow commented.

“Yeah… Nobody seems to be bothering us after that last guy.” Silver added.

“No robots either… It just feels like they are just letting us escape…”

“But why…?”

There was a pause, as if both of them knew the answer, but neither of them wanted to put words to the fears.

“When you were looking into the minds of our enemies, did you find any information that might explain why nobody seems to be after us?” He asked.

“To be honest, I didn’t see anything like that at all. Not that I was looking beyond their immediate thoughts unless I had to.” He answered, semi-honestly. “But, the last few Children we faced seemed a little… independent. Unlike the raid last night. So maybe… Maybe they missed the memo?”

Shadow went silent for a moment, before deciding to rip off the band aid and put into words the likely severity of their situation.

“If they aren’t sending anyone after us, after so much trouble getting us down here, that means one of two things, I think…” Shadow deduced. “Either they already got what they wanted out of us… Or there is something else at play here. I have a bad feeling about it all. I suspect we may be on borrowed time and we need to find out way our as soon as possible. The only reason they wouldn’t be worried about us escaping our cells at this point, is that something is down here with us, guaranteeing we will never make it out alive.”

“I don’t know what’s going on, but I feel the same way.” Silver agreed.

They nodded and continued trying to push forward. Finding ways upwards through the one part of Aquatic Base that was still in operation and hasn’t fallen to the decay he saw with his own eyes a few nights ago.

Despite the very real possibility that they were completely lost, Shadow’s navigation of the cult base of operation was confident and fast. Silver was trailing behind and struggling to keep up and avoid tripping.

“Do you know where we are going?” Silver asked.

“Yes and no.” Shadow answered, honestly. “… It’s strange… I don’t remember this place at all and yet… Deep down… I feel like I know this place like the back of my hand. It’s a surreal feeling. While my mind may have forgotten almost everything, my body still remembers. It’s giving me deja-vu.”

Despite how bleak the situation was; both of them as monsters trapped underground struggling to find an exit amid the very real possibility that something was out there or a very real danger lied ahead of them, Silver couldn’t help but chuckle a little at his choice of words.

“What?” Shadow asked, a little annoyed. “What’s so funny?”

“It’s just… Actually, it would be deja visite.” Silver corrected. “At least… That’s what Freesia told me when I first came to this time. Despite not visiting Soleanna before, I somehow knew this place like the back of my hand. That’s when I started having strange recollections of another timeline coming to me… But… I know now that this timeline did exist once. At least… I know that now. So, if you are feeling the same thing, I don’t have a single doubt that you were here once before.”

Shadow nodded.

“Maybe there’s hope for us getting out of here after all.” He commented.

They continued wandering the seemingly expansive labs. The eerie silence of everything kept them on edge. There wasn’t even any mechanical whirring or electrical buzzing either. Nothing but the sound of their footsteps on the metal floors, and the soft echoes of their breathing in the halls. Nothing to distract from the ever-growing dread that they may not get out alive, but neither of them could truly word what specifically was waiting out to get them.

They crossed great gaps in the darkness, knocked metallic spheres out of the way, ripped open sealed doors with brute strength, and even climbed the walls to get higher with no elevators online and no way to find any stairs.

It simultaneously felt like it was taking forever, yet also felt like everything was moving so quickly. Time was relative as they hopefully progressed to an exit.

Or so they thought…

They entered what seemed to be a large room of sorts. Silver had no way of knowing what it was, but one thing he did know was that Shadow froze in place.

“Shadow…?” Silver asked.

Shadow didn’t answer. He froze where he was. It wasn’t a trap, as Silver wasn’t affected. But he sensed something had happened to Shadow.

The way Shadow froze. Silver could sense the shock rapidly paralysing the former Ultimate Lifeform.

“Shadow… We need to keep moving…” Silver persisted.

Shadow didn’t respond. 

“Shadow!” Silver snapped. “Don’t bail on me like this!”

But he still didn’t respond, or even as much as flinch. 

Silver grabbed him and tried to shake him. As much as he dreaded the possibility of getting smacked in the face for it, he needed to get Shadow moving again.

Nothing. It was as though the moment they walked into the room, Shadow’s very soul left his body, and even the mindless beast that sometimes took his place was also absent.

A breathing, but otherwise dead entity.

“Ugh! Don’t make me reach into your head to pull you out!” He warned one final time.

Shadow still didn’t respond.

Silver had no choice. He had the gut feeling they were on borrowed time, and he needed Shadow to snap out of whatever spell he was under.

“Ugh… I really didn’t want to… But you leave me no choice…” Silver muttered, bracing himself for what he was about to do next.

Tapping into his powers once more, Silver reached into Shadow’s mind.

‘…I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice I had no choice…’

He heard Shadow’s thoughts whispering again and again.

Silver’s nerves were a little uneasy hearing that. It was quite foreboding. But… he really had little choice but to continue diving to see what exactly had Shadow frozen in place. He could see Shadow’s current emotional state. He didn’t know what exactly the feeling was, or knew how to word it aside from… cold…

“I know I had to do this at some point…” Silver muttered, bracing himself. “You literally asked me to do this… Though, I hoped it would have been after we escaped this place… H-here goes!”

The mutant psychic dreaded by what he might face. He had a bad feeling deep down that it wouldn’t be as easy as it was with Freesia. In fact, he knew he was likely to face a lot of resistance and obstacles.

Taking in a deep breath, he reached further into Shadow’s mind and took the plunge. His own sense of reality melted away as he dived deep into an endless ocean of sadness, darkness, betrayal, trauma, and so much more pain. He felt like he was falling, falling, falling, into a sky full of twinkling stars. A broken mindscape full of fractured memories…

Freesia kept running. It didn’t matter how heavy it was to carry Madonna, or how much her lungs burned. She had to keep running. She was running out of time. She needed to find them!

“Freesia? How much longer do we have left?” Madonna asked.

“Seven Minutes!” The green hedgehog answered. “That’s how long we have. Don’t worry about us escaping. If I can find them, I can use the chaos emeralds to get us all out of here with Chaos Control! If-If I can use a replica emerald to teleport myself with little issue… The real deal should be a piece of cake!”

“I hope so, Freesia…” Madonna commented.

As she kept powering through, running through the dark hallways and inactive machines, she saw some movement in the corner of her eye. At first, she ignored it, because as much as her curiosity was getting to her, she could not afford to stop to see what it was.

Fortunately, she didn’t need to check, as she saw it in the corner of her eyes again, a little more in her peripheral vision. Eventually, as she just kept running with everything she had in her, she saw it… A starfish floating in front of her. Pinkish in colour with a golden eye in the middle.

“… You?” Freesia gasped.

She recognised the entity. She knew not to react in fear.

“Freesia?” Madonna inquired. “What is it?”

The green hedgehog didn’t answer at first. As she kept running, she watched the floating starfish keep up with her, trying to swim through the air away from her and occasionally looking back. It seemed to be trying to show her the way.

Freesia followed, hoping it would lead her to either a way out or where Shadow and Silver were to get all of them out at once. She followed it down a long corridor and into a room.

“… Dead end…” Madonna commented.

The hedgehog almost stomped her feet in frustration. It was a waste of time!

But the starfish didn’t let up. It circled a corner of the room. It was difficult to see in the darkness, but the light emanating from the emeralds gave enough of a glow to see something twinkling.

Freesia placed the human down to investigate the items. She pulled out the blue emerald and quickly scanned her eyes across the room. It appeared to be a storage locker of sorts that opened when the power was cut off. The twinkle was a bracelet of sorts. It looked familiar. That’s when she gasped. She checked the corner. She saw the small chest that contained the diaries. The bracelet that came in the box. Then her eyes fixated on one final item, and one she was glad to have back in her possession again…

“My kine…” She gasped. “They must have confiscated these during the camp raid! Oh, I missed you!”

It was all there… The most important items that set her on her journey to uncover the mystery. It was all there!

Wasting no time, she packed the bracelet and the diaries in the box, and grabbed her mallet.

After handing the chest to Madonna, and placing her mochi hammer into a special notch she made in the back of her dress to carry it, she picked up the human once more, ready to continue the hasty search.

At the doorway, was the starfish entity, waiting for them.

“I guess… Could you show me where Shadow and Silver are?” The green hedgehog asked.

The starfish nodded, and moved ahead of them, looking back once in a while to make sure she was keeping up.

“Freesia, what are you talking to?” The human asked, puzzled.

“Huh? You can’t see it? The pink starfish leading the way?”

“Freesia… Is some of that Komodo Dragon’s venom still coursing through your veins?” Madonna asked in a concerned voice. “Are you ok?”

“I feel fine, Madonna.” She replied. “I guess only I can see it for some reason. But sometimes when I felt lost and didn’t know what to do when I was a child, after my mom was captured… Sometimes I saw this pink starfish. I don’t know why but… Whenever I followed it, I always ended up where I needed to be when I needed to be there. Like a guardian angel of sorts. Though I guess, even though I am looking for my mom in this all too, whenever I saw this pink starfish… It was like she was still there with me…”

“As long as we can all get out in one piece, that’s the main thing.” The human answered. She didn’t sound too convinced.

“We’ll find them… and we will make The Children pay for everything they took from us! As soon as we are out of this place before it blows, we will have the upper hand in this fight for once! I promise you… Hope isn’t lost yet!”